CN114107540A - Qualitative and quantitative analysis method for detecting different plants in soil - Google Patents
Qualitative and quantitative analysis method for detecting different plants in soil Download PDFInfo
- Publication number
- CN114107540A CN114107540A CN202111330099.8A CN202111330099A CN114107540A CN 114107540 A CN114107540 A CN 114107540A CN 202111330099 A CN202111330099 A CN 202111330099A CN 114107540 A CN114107540 A CN 114107540A
- Authority
- CN
- China
- Prior art keywords
- primer
- reverse
- degenerate
- primers
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a qualitative and quantitative analysis method for detecting different plants in soil. The invention uses chloroplast conserved gene RbcL as a molecular target to distinguish plant groups in a soil sample, and can be used for qualitative and quantitative analysis of different plant types in any ecological, geological, archaeological soil sample or biological metabolism residues.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a qualitative and quantitative analysis method for detecting different plants in soil.
Background
Obtaining the biological distribution on the history of a specific geographic position is helpful for understanding the current ecological environment and reflects the dynamic balance of biological diversity. However, there are still significant technical challenges in reconstructing historical vegetation in past habitats, identifying the plant populations present in soil samples. The most common method currently used is to infer the historical vegetation composition by identifying pollen morphology using plant pollen records stored in sediments. However, this technique has a great disadvantage that pollen is very easy to be blown away by wind due to its characteristics, so that it does not stay in one place for a long time and is not regionally strong. At the same time, the collection and identification of these pollens requires a high level of skill and high-throughput operation is not possible. This makes it difficult to reconstruct the historic vegetation types and ecosystems.
On the other hand, organic carbon contributed by plants in soil is an important part of carbon storage. The contribution of different plants to stored carbon has not been estimated in a reliable way. The current sterol test method for identifying plant distribution in soil technically requires high-end mass spectrometry equipment, cannot perform high-throughput determination, and can only identify a few species of known secondary metabolites.
With the advent of DNA molecular marker technology and the widespread use of DNA high-throughput sequencing technology, it is becoming increasingly possible to use DNA molecular marker technology to reduce plant species present in historic habitats. However, there is a problem as to what is an effective plant DNA molecular marker, and how to use the molecular marker to construct sequencing libraries and analyze different plant species is also a challenge.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provide a qualitative and quantitative analysis method for detecting different plants in soil.
The technical scheme of the invention is as follows:
a qualitative and quantitative analysis method for detecting different plants in soil comprises the following steps:
(1) designing a degenerate primer group aiming at a plant chloroplast conserved gene RbcL region, and carrying out PCR amplification on DNA in a plurality of soil samples by using the degenerate primer group to obtain a plurality of first amplification products;
(2) designing a plurality of first forward primers and a first reverse primer, wherein the first forward primers respectively correspond to a plurality of soil samples, the 5 'ends of the first forward primers and the first reverse primer have different barcode sequences so as to distinguish different soil samples, the 5' ends of the first forward primers and the first reverse primer both contain Adapter sequences, the first forward primers are partially complementary to the forward degenerate primers of the degenerate primer group, and the first reverse primers are partially complementary to the reverse degenerate primers of the degenerate primer group; taking the first amplification products as templates, and carrying out PCR amplification on the first amplification products by using a plurality of first forward primers and a first reverse primer to obtain a plurality of second amplification products;
(3) designing a second forward primer and a second reverse primer, wherein the second forward primer and the second reverse primer are partially complementary to the Adapter sequence of the second amplification product, the 5 'end of the second forward primer is provided with a P5 sequence, and the 5' end of the second reverse primer is provided with a P7 sequence and an index sequence; performing PCR amplification on the plurality of second amplification products by using a second forward primer and a second forward primer by using the plurality of second amplification products as templates to obtain a plurality of third amplification products, namely a DNA amplicon library for sequencing amplicons;
(4) performing high-throughput sequencing on the DNA amplicon library obtained in the step (3) to obtain sequencing data;
(5) and performing bioinformatics analysis on the obtained sequencing data, wherein the bioinformatics analysis comprises establishing a chloroplast RbcL gene database, splitting the data according to the barcode sequence, performing quality control on the data, and then performing operation classification unit clustering to distinguish various different plants to belong to or species.
In a preferred embodiment of the invention, the forward degenerate primer is RbcL-F, the nucleotide sequence of which is shown in SEQ ID NO. 01; the reverse degenerate primer is RbcL-R, and the nucleotide sequence of the reverse degenerate primer is shown in SEQ ID NO. 02.
Further preferably, the size of the plurality of first amplification products is 240-280 bp.
In a preferred embodiment of the invention, the barcode sequence is 6 bases in length.
In a preferred embodiment of the invention, the DNA in the Soil sample is extracted using the Power Soil Kit.
The other technical scheme of the invention is as follows:
the application of the chloroplast conserved gene RbcL in detecting different plants in soil.
In a preferred embodiment of the present invention, the method comprises the following steps:
(1) designing a degenerate primer group aiming at a plant chloroplast conserved gene RbcL region, and carrying out PCR amplification on DNA in a plurality of soil samples by using the degenerate primer group to obtain a plurality of first amplification products;
(2) designing a plurality of first forward primers and a first reverse primer, wherein the first forward primers respectively correspond to a plurality of soil samples, the 5 'ends of the first forward primers and the first reverse primer have different barcode sequences so as to distinguish different soil samples, the 5' ends of the first forward primers and the first reverse primer both contain Adapter sequences, the first forward primers are partially complementary to the forward degenerate primers of the degenerate primer group, and the first reverse primers are partially complementary to the reverse degenerate primers of the degenerate primer group; taking the first amplification products as templates, and carrying out PCR amplification on the first amplification products by using a plurality of first forward primers and a first reverse primer to obtain a plurality of second amplification products;
(3) designing a second forward primer and a second reverse primer, wherein the second forward primer and the second reverse primer are partially complementary to the Adapter sequence of the second amplification product, the 5 'end of the second forward primer is provided with a P5 sequence, and the 5' end of the second reverse primer is provided with a P7 sequence and an index sequence; performing PCR amplification on the plurality of second amplification products by using a second forward primer and a second forward primer by using the plurality of second amplification products as templates to obtain a plurality of third amplification products, namely a DNA amplicon library for sequencing amplicons;
(4) sequencing the DNA amplicon library obtained in the step (3) to obtain sequencing data;
(5) and performing bioinformatics analysis on the obtained sequencing data, wherein the bioinformatics analysis comprises establishing a chloroplast RbcL gene database, splitting the data according to the barcode sequence, performing quality control on the data, and then performing operation classification unit clustering to distinguish various different plants to belong to or species.
Further preferably, the forward degenerate primer is RbcL-F, and the nucleotide sequence of the forward degenerate primer is shown in SEQ ID NO. 01; the reverse degenerate primer is RbcL-R, and the nucleotide sequence of the reverse degenerate primer is shown in SEQ ID NO. 02.
Even more preferably, the size of the plurality of first amplification products is 240-280 bp.
Further preferably, the barcode sequence is 6 bases in length.
The invention has the beneficial effects that: the invention uses chloroplast conserved gene RbcL as a molecular target to distinguish plant groups in a soil sample, and can be used for qualitative and quantitative analysis of different plant types in any ecological, geological, archaeological soil sample or biological metabolism residues.
Figure illustrates the drawings
Fig. 1 is a method principle and a flowchart in embodiment 1 of the present invention.
FIG. 2 is a diagram showing the results of electrophoresis of a sample in which a region of interest is amplified by PCR using degenerate primers RbcL-F and RbcL-R in example 1 of the present invention.
FIG. 3 is a diagram showing the results of electrophoresis of a sample in which a sequencing adapter was introduced using PCR amplification in example 1 of the present invention.
FIG. 4 is a sequencing quality map of the library constructed using example 1 of the present invention.
FIG. 5 is a top 10 plant map in abundance ranking obtained using example 1 of the present invention.
Detailed Description
The technical solution of the present invention will be further illustrated and described below with reference to the drawings by means of specific embodiments.
Example 1
The DNA genome of 10 soil samples was extracted according to the DNeasy Power Lyzer Power soil Kit (12855-100) from Qiagen, the detailed procedures of which are described in the specification. Then, as shown in fig. 1, the following steps are carried out:
first, PCR amplification of target region
1. Primer design
The primer design region is a part of a plant chloroplast conserved gene RbcL; the primer was named RbcL-F, RbcL-R, and the total amplification length was approximately 260 bp.
Specific primer information is shown in the following table:
| primer name | Sequences (5 'to 3') |
| RbcL-F | atgtcaccacaaacagagactaaagcaagt(SEQ ID NO.01) |
| RbcL-R | cgtcctttgtaacgatcaag(SEQ ID NO.02) |
PCR amplification
(1) 10 samples were subjected to PCR amplification using Taq polymerase (Vazyme; P212-01); 10 μ L of the reaction system;
(2) a PCR instrument: Bio-Rad S1000 type
PCR reaction parameters
A.1×(2min at 95℃)
B.30×(30s at 95℃；30s at 56℃；1min at 72℃)
C.10min at 72℃，keepin4℃
(3) The PCR product was detected by 2% gel electrophoresis, and 10. mu.L of the sample was loaded using DL2000 as Markers, and the results of the sample electrophoresis are shown in FIG. 2.
3. Adhesive recovery tape
(1) Performing 2% agar gel electrophoresis, performing 120V electrophoresis by using DL2000 as Markers, and performing gel cutting and recovery after electrophoresis for 30 min; (Note: one well is required to be placed between samples, and cross infection between samples is placed.)
(2) The sample band is 260bp, so the fragments about 260bp are cut, and a new blade is needed to be replaced when each sample is cut.
(3) The excised gel was placed in a sterilized 1.5mL centrifuge tube. And marking the sample.
(4) The gel was recovered using a ZYMO RESEARCH kit (D4008), and the gel was recovered by the method described in the kit.
(5) Final elution step 30. mu.L ddH was added2O。
(6) The DNA concentration was determined using a Qubit.
Secondly, introducing sample splitting and joint sequences through PCR amplification
1. Primer design (i.e., design of a first forward primer and a first reverse primer)
(1) The amplification region is the sequence in the first PCR product, so that a part of the designed primer sequence should be complementary to the RbcL-F and RbcL-R primers.
(2) The sequencing regions are FP1 and RP1
(3) A unique 6-base tag sequence (barcode) is designed at the 5 'end of the primer FP1-10 to distinguish libraries of different samples, and in addition, the 5' ends of the two sequences contain Adapter sequences
2. The specific primer sequence information is shown in the following table:
| Primer | sequences (5 'to 3') |
| FP1 | tctttccctacacgacgctcttccgatctatcacgatgtcaccacaaacagagactaaagcaagt(SEQ ID NO.03) |
| FP2 | tctttccctacacgacgctcttccgatctcgatgtatgtcaccacaaacagagactaaagcaagt(SEQ ID NO.04) |
| FP3 | tctttccctacacgacgctcttccgatctttaggcatgtcaccacaaacagagactaaagcaagt(SEQ ID NO.05) |
| FP4 | tctttccctacacgacgctcttccgatcttgaccaatgtcaccacaaacagagactaaagcaagt(SEQ ID NO.06) |
| FP5 | tctttccctacacgacgctcttccgatctacagtgatgtcaccacaaacagagactaaagcaagt(SEQ ID NO.07) |
| FP6 | tctttccctacacgacgctcttccgatctgccaatatgtcaccacaaacagagactaaagcaagt(SEQ ID NO.08) |
| FP7 | tctttccctacacgacgctcttccgatctcagatcatgtcaccacaaacagagactaaagcaagt(SEQ ID NO.09) |
| FP8 | tctttccctacacgacgctcttccgatctacttgaatgtcaccacaaacagagactaaagcaagt(SEQ ID NO.10) |
| FP9 | tctttccctacacgacgctcttccgatctgatcagatgtcaccacaaacagagactaaagcaagt(SEQ ID NO.11) |
| FP10 | tctttccctacacgacgctcttccgatcttagcttatgtcaccacaaacagagactaaagcaagt(SEQ ID NO.12) |
| RP1 | tggagttcagacgtgtgctcttccgatctcggcaccgtcctttgtaacgatcaag(SEQ ID NO.13) |
PCR amplification
(1) PCR amplification was performed on 10 samples using Taq polymerase (Vazyme, P212-01), 10. mu.L reaction;
(2) a PCR instrument: Bio-Rad S1000 type
PCR reaction parameters
A.1×(2min at 95℃)
B.5×(30s at 95℃；30s at 56℃；1min at 72℃)
C.10min at 72℃，keep in 4℃
Third, PCR amplification introduction sequencing joint
1. Primer design (i.e., design of the second Forward primer and the second reverse primer)
(1) The amplified region is the sequence between the adapters in the second PCR product, so the middle part of the designed primer is complementary with the Adapter sequence in the second PCR primer.
(2) The forward primer (PS1) has a P5 sequence at the 5' end, and the reverse primer (FS2) has a P7 and index sequence.
(3) The specific information of the primers is shown in the following table, wherein index is ctctcc (SEQ ID NO.16)
| Primer | Sequences (5 'to 3') |
| PS1 | aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccg(SEQ ID NO.14) |
| FS2 | caagcagaagacggcatacgagatctctccgtgactggagttcagacgtgtgctcttccg(SEQ ID NO.15) |
PCR amplification
(1) 10 samples were subjected to PCR amplification using 20. mu.L of Taq polymerase (Vazyme Co.; P212-01);
(2) a PCR instrument: Bio-Rad S1000 type
PCR reaction parameters
A.1×(2min at 95℃)
B.5×(30s at 95℃；30s at 56℃；1min at 72℃)
C.10min at 72℃，keep in 4℃
(3) The PCR product was detected by 2% gel electrophoresis, using DL2000 as Markers, and 20. mu.L of the sample was loaded, and the electrophoretogram of the sample is shown in FIG. 3.
3. Adhesive recovery tape
(1) Performing 2% agar gel electrophoresis, performing 120V electrophoresis by using DL2000 as Markers, and performing gel cutting and recovery after electrophoresis for 30 min; (one well needs to be spaced between samples to prevent cross-infection between samples.)
(2) The sample band is 320bp, so the fragments about 320bp are cut, and a new blade is needed to be replaced when each sample is cut.
(3) The excised gel was placed in a sterilized 1.5mL centrifuge tube. And marking the sample.
(4) The gel recovery was carried out by using a gel recovery kit ZYMO RESEARCH kit (D4008) according to the method used in the kit.
(5) Final elution step 20. mu.L ddH was added2O。
Purification of PCR products by Ampread magnetic bead method
(1) 1.0X Ampbeads (New England Biolabs) was added to a 1.5mL centrifuge tube in the following 1: 1 was added to the gum recovered product from step 3.
(2) Blowing, beating, mixing, turning over for 8min, placing the centrifugal tube on a magnetic frame for at least 6min, and carefully discarding the supernatant.
(3) 200mL of freshly prepared 80% ethanol was added, held for 30 seconds, and the supernatant removed.
(4) Repeat step 3
(5) Drying at room temperature for 10min
(6) Add 21. mu.L ddH2And O, blowing, beating and mixing uniformly, and standing at room temperature for 3 min.
(7) The tube was replaced on the magnetic rack for 3min and 20. mu.L of the supernatant was pipetted into a fresh 1.5mL tube. The clear solution was the sequencing library.
5. Sample mixing
The concentration of the 10 sequencing library samples was quantified using Qubit.
The concentration of the mixed DNA is 500ng, 10 sequencing library samples are subjected to equal-amount mixing, and the specific mixing information is shown in the following table:
fourthly, sequencing and bioinformatics analysis of sequencing data
1. Sequencing
The DNA library obtained above was sent to Novaseq platform of Nuo Seco for sequencing of PE150 amplicon, with a data size of 1G, and the sequencing quality obtained is shown in FIG. 4.
2. Chloroplast RbcL gene database construction method
(1) Downloading RbcL genes of all plants in an NCBI database;
(2) downloading a mapping file from the NCBI for the gi number to the species ID;
(3) when the index of the local chloroplast RbcL gene database is constructed, the mapping file is included, and the ID of the species can be output when the mapping file is output;
(4) downloading a mapping file of the species ID to the species name from the NCBI;
(5) the file format with the species name is exported using blastn.
3. The data processing method comprises the following steps:
(1) using Flash double-end data merging software, wherein the allowed minimum matching number m is 20;
(2) using fastq-multx data splitting software to split data according to the barcode, wherein the allowed maximum error m is 1;
(3) performing quality detection on the split data by using fastqc;
(4) deleting the primer and the low-quality sequence by using cutatapter and trimmanafic;
(5) importing the split data into Qiime2 to form a qza data format;
(6) OTU clustering is carried out on the imported qza data by using qiime dada 2;
(7) quality control is carried out on the generated OTU clustering file by using a qiime dada2 dense-single command, chimera deletion and the like are deleted;
(8) deleting the low abundance OTU by using a qi feature-table filter-features parameter to obtain final processing data;
(9) and converting the data into a txt file format by using a qi tools export parameter and a biocovert parameter, so as to facilitate subsequent processing.
4. Database using method
(1) Performing sequence retrieval on the txt sequence file obtained by using blastn according to the chloroplast RbcL gene database established in the manner, wherein the retrieval condition is that-evalue is 0.00001; and the output format is '6 qseqiidq 1 ensseqiidsgisgislenpidentlength mismatch ch gapopenqtartqstartsstanstartsend evaluubiscorestexidsciname'; setting the max _ target _ seqs parameter as 1 to ensure that the most accurate species is obtained;
(2) after obtaining the NCBI species table, species sequences with identification < 98% are deleted artificially, further ensuring the accuracy of the obtained species.
5. Conclusion
(1) It can be seen from the table below that the data resolution is high using the method, and that chimeras can be effectively removed after clustering using dada 2.
(2) OTU generated after DADA2 clustering is compared to NCBI database, species classification information can be effectively obtained,
among them, 75 kinds of plants are available. The species with abundance of top 10 are shown in fig. 5, and the species are: avicenna alba, Kandelia candel, Sonneratia alba, Oryza _ sativa _ Japonica _ Group, Bruguiera _ gynorhiza, Arabidopsis _ thalana, Heritiera _ fomes, Excoecia _ aggrechocha, Nypa _ fractions, Aegiceras _ cornifica
The above description is only a preferred embodiment of the present invention, and therefore should not be taken as limiting the scope of the invention, which is defined by the appended claims.
Sequence listing
<110> university of mansion
<120> qualitative and quantitative analysis method for detecting different plants in soil
<160> 15
<170> SIPOSequenceListing 1.0
<210> 1
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atgtcaccac aaacagagac taaagcaagt 30
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 65
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tctttcccta cacgacgctc ttccgatcta tcacgatgtc accacaaaca gagactaaag 60
caagt 65
<210> 4
<211> 65
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tctttcccta cacgacgctc ttccgatctc gatgtatgtc accacaaaca gagactaaag 60
caagt 65
<210> 5
<211> 65
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
tctttcccta cacgacgctc ttccgatctt taggcatgtc accacaaaca gagactaaag 60
caagt 65
<210> 6
<211> 65
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tctttcccta cacgacgctc ttccgatctt gaccaatgtc accacaaaca gagactaaag 60
caagt 65
<210> 7
<211> 65
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
tctttcccta cacgacgctc ttccgatcta cagtgatgtc accacaaaca gagactaaag 60
caagt 65
<210> 8
<211> 65
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tctttcccta cacgacgctc ttccgatctg ccaatatgtc accacaaaca gagactaaag 60
caagt 65
<210> 9
<211> 65
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
tctttcccta cacgacgctc ttccgatctc agatcatgtc accacaaaca gagactaaag 60
caagt 65
<210> 10
<211> 65
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
tctttcccta cacgacgctc ttccgatcta cttgaatgtc accacaaaca gagactaaag 60
caagt 65
<210> 11
<211> 65
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
tctttcccta cacgacgctc ttccgatctg atcagatgtc accacaaaca gagactaaag 60
caagt 65
<210> 12
<211> 65
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
tctttcccta cacgacgctc ttccgatctt agcttatgtc accacaaaca gagactaaag 60
caagt 65
<210> 13
<211> 55
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
tggagttcag acgtgtgctc ttccgatctc ggcaccgtcc tttgtaacga tcaag 55
<210> 14
<211> 54
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccg 54
<210> 15
<211> 60
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
caagcagaag acggcatacg agatctctcc gtgactggag ttcagacgtg tgctcttccg 60
Claims (10)
1. A qualitative and quantitative analysis method for detecting different plants in soil is characterized in that: the method comprises the following steps:
(1) designing a degenerate primer group aiming at a plant chloroplast conserved gene RbcL region, and carrying out PCR amplification on DNA in a plurality of soil samples by using the degenerate primer group to obtain a plurality of first amplification products;
(2) designing a plurality of first forward primers and a first reverse primer, wherein the first forward primers respectively correspond to a plurality of soil samples, the 5 'ends of the first forward primers and the first reverse primer have different barcode sequences so as to distinguish different soil samples, the 5' ends of the first forward primers and the first reverse primer both contain Adapter sequences, the first forward primers are partially complementary to the forward degenerate primers of the degenerate primer group, and the first reverse primers are partially complementary to the reverse degenerate primers of the degenerate primer group; taking the first amplification products as templates, and carrying out PCR amplification on the first amplification products by using a plurality of first forward primers and a first reverse primer to obtain a plurality of second amplification products;
(3) designing a second forward primer and a second reverse primer, wherein the second forward primer and the second reverse primer are partially complementary to the Adapter sequence of the second amplification product, the 5 'end of the second forward primer is provided with a P5 sequence, and the 5' end of the second reverse primer is provided with a P7 sequence and an index sequence; performing PCR amplification on the plurality of second amplification products by using a second forward primer and a second forward primer by using the plurality of second amplification products as templates to obtain a plurality of third amplification products, namely a DNA amplicon library for sequencing amplicons;
(4) performing high-throughput sequencing on the DNA amplicon library obtained in the step (3) to obtain sequencing data;
(5) and performing bioinformatics analysis on the obtained sequencing data, wherein the bioinformatics analysis comprises establishing a chloroplast RbcL gene database, splitting the data according to the barcode sequence, performing quality control on the data, and then performing operation classification unit clustering to distinguish various different plants to belong to or species.
2. A qualitative and quantitative analysis method according to claim 1, characterized in that: the forward degenerate primer is RbcL-F, and the nucleotide sequence of the forward degenerate primer is shown in SEQ ID NO. 01; the reverse degenerate primer is RbcL-R, and the nucleotide sequence of the reverse degenerate primer is shown in SEQ ID NO. 02.
3. A qualitative and quantitative analysis method according to claim 2, characterized in that: the size of the several first amplification products is 240-280 bp.
4.A qualitative and quantitative analysis method according to claim 1, characterized in that: the barcode sequence is 6 bases in length.
5. The qualitative/quantitative analysis method according to any one of claims 1 to 4, characterized in that: DNA in the Soil sample was extracted using the Power Soil Kit.
6. The application of the chloroplast conserved gene RbcL in detecting different plants in soil.
7. The use of claim 6, wherein: the method comprises the following steps:
(1) designing a degenerate primer group aiming at a plant chloroplast conserved gene RbcL region, and carrying out PCR amplification on DNA in a plurality of soil samples by using the degenerate primer group to obtain a plurality of first amplification products;
(2) designing a plurality of first forward primers and a first reverse primer, wherein the first forward primers respectively correspond to a plurality of soil samples, the 5 'ends of the first forward primers and the first reverse primer have different barcode sequences so as to distinguish different soil samples, the 5' ends of the first forward primers and the first reverse primer both contain Adapter sequences, the first forward primers are partially complementary to the forward degenerate primers of the degenerate primer group, and the first reverse primers are partially complementary to the reverse degenerate primers of the degenerate primer group; taking the first amplification products as templates, and carrying out PCR amplification on the first amplification products by using a plurality of first forward primers and a first reverse primer to obtain a plurality of second amplification products;
(3) designing a second forward primer and a second reverse primer, wherein the second forward primer and the second reverse primer are partially complementary to the Adapter sequence of the second amplification product, the 5 'end of the second forward primer is provided with a P5 sequence, and the 5' end of the second reverse primer is provided with a P7 sequence and an index sequence; performing PCR amplification on the plurality of second amplification products by using a second forward primer and a second forward primer by using the plurality of second amplification products as templates to obtain a plurality of third amplification products, namely a DNA amplicon library for sequencing amplicons;
(4) performing high-throughput sequencing on the DNA amplicon library obtained in the step (3) to obtain sequencing data;
(5) and performing bioinformatics analysis on the obtained sequencing data, wherein the bioinformatics analysis comprises establishing a chloroplast RbcL gene database, splitting the data according to the barcode sequence, performing quality control on the data, and then performing operation classification unit clustering to distinguish various different plants to belong to or species.
8. The use of claim 7, wherein: the forward degenerate primer is RbcL-R, and the nucleotide sequence of the forward degenerate primer is shown in SEQ ID NO. 01; the reverse degenerate primer is RbcL-F, and the nucleotide sequence of the reverse degenerate primer is shown in SEQ ID NO. 02.
9. The use of claim 8, wherein: the size of the several first amplification products is 240-280 bp.
10. The use of claim 7, wherein: the barcode sequence is 6 bases in length.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111330099.8A CN114107540A (en) | 2021-11-10 | 2021-11-10 | Qualitative and quantitative analysis method for detecting different plants in soil |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111330099.8A CN114107540A (en) | 2021-11-10 | 2021-11-10 | Qualitative and quantitative analysis method for detecting different plants in soil |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114107540A true CN114107540A (en) | 2022-03-01 |
Family
ID=80378293
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111330099.8A Pending CN114107540A (en) | 2021-11-10 | 2021-11-10 | Qualitative and quantitative analysis method for detecting different plants in soil |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114107540A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090081646A1 (en) * | 2004-10-08 | 2009-03-26 | Universite Joseph Fourier | Universal primers and their use for detecting and identifying plant materials in complex mixtures |
| CN104153004A (en) * | 2014-08-11 | 2014-11-19 | 上海美吉生物医药科技有限公司 | Database-building method for amplicon sequencing |
| CN112029896A (en) * | 2020-09-29 | 2020-12-04 | 中国科学院生态环境研究中心 | Method for detecting diversity of macrophytes based on environmental DNA technology |
| CN113186338A (en) * | 2020-09-14 | 2021-07-30 | 中国科学院植物研究所 | Universal primer for identifying angiosperm plant species and application thereof |
-
2021
- 2021-11-10 CN CN202111330099.8A patent/CN114107540A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090081646A1 (en) * | 2004-10-08 | 2009-03-26 | Universite Joseph Fourier | Universal primers and their use for detecting and identifying plant materials in complex mixtures |
| CN104153004A (en) * | 2014-08-11 | 2014-11-19 | 上海美吉生物医药科技有限公司 | Database-building method for amplicon sequencing |
| CN113186338A (en) * | 2020-09-14 | 2021-07-30 | 中国科学院植物研究所 | Universal primer for identifying angiosperm plant species and application thereof |
| CN112029896A (en) * | 2020-09-29 | 2020-12-04 | 中国科学院生态环境研究中心 | Method for detecting diversity of macrophytes based on environmental DNA technology |
Non-Patent Citations (1)
| Title |
|---|
| 高连明;刘杰;蔡杰;杨俊波;张挺;李德铢;: "关于植物DNA条形码研究技术规范", 植物分类与资源学报, vol. 34, no. 06, pages 592 - 606 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107345256B (en) | Transcriptome sequencing-based EST-SSR primer group for developing mucuna pruriens, method and application | |
| CN104293778B (en) | Establishing method of cymbidium microsatellite labels, core fingerprint label database and kit | |
| CN109411014A (en) | A kind of cyclic method of plant chloroplast full-length genome assembling based on the sequencing of two generations | |
| CN111471775A (en) | Specific DNA fragment SSM2 for sturgeon gender identification and application | |
| CN108517368B (en) | Method and system for analyzing interaction relation of LncRNA Pto-CRTG and target gene Pto-CAD5 of Chinese white poplar by using epistasis | |
| CN106399496B (en) | Library building kit for high-throughput detection of STR genetic markers | |
| CN112695124B (en) | Phalaenopsis SSR molecular marker primer composition and application thereof | |
| CN107058494B (en) | Method for simplifying purity identification of common vetch variety by adopting SCoT molecular marker | |
| CN114107540A (en) | Qualitative and quantitative analysis method for detecting different plants in soil | |
| CN109943644A (en) | The method for identifying molecules of mouse kind | |
| CN108018339B (en) | Detection primer for highly degrading plant DNA in sample | |
| CN111235303B (en) | Method for identifying cord-grass and spartina alterniflora | |
| CN105631245A (en) | Dedicated primer used for identifying superior clones of Populus deltoides Marsh. and identification method for superior clone of Populus deltoides Marsh. | |
| CN106967791B (en) | Method for identifying genetic relationship of gall and pepper trees | |
| CN112680542B (en) | Universal SSR molecular marker primer composition for orchidaceae plants and application of universal SSR molecular marker primer composition | |
| CN104212897A (en) | Method for large-scale development of ramie genome SSR (simple sequence repeat) markers and primers developed by method | |
| CN116287172B (en) | Male and female sex identification primer and method for physcomitrella spinosa | |
| CN113403413B (en) | cPPSSR (cyclic shift keying) marker primer developed based on peony chloroplast genome sequence and application | |
| CN112941151B (en) | Method for constructing EST-SSR (expressed sequence tag-simple sequence repeat) marker by using RNA-seq technology and application | |
| CN113151535B (en) | Chloroplast SSR (simple sequence repeat) marker primers for molecular identification of compositae plants and acquisition method thereof | |
| CN114525363B (en) | Molecular marker primer related to color of rape flower and method for identifying color of rape flower | |
| CN113957167B (en) | Cherry rootstock specific molecular marker and screening method and application thereof | |
| US11788154B2 (en) | Method for identifying racehorse using microsatellite marker | |
| CN117568511A (en) | SNP locus and CAPS molecular marker for identifying early-growth traits of tea trees and application of SNP locus and CAPS molecular marker | |
| CN116622699A (en) | High-efficiency plankton eDNA macro-bar code monitoring primer set |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |