CN114107370A - Method for gene editing in soybean by using Cas12i - Google Patents

Abstract

The invention provides a method for performing gene editing in soybean by using Cas12i, which comprises the step of performing gene editing in soybean by using Cas12i and a gRNA, wherein the gRNA comprises a framework region combined with Cas12i and a guide series hybridized with a target sequence, and the gRNA targets a GmFAD2-1A gene and a GmFAD2-1B gene of the soybean; the amino acid sequence of Cas12i is shown in SEQ ID No.1, and the guide sequence hybridized with the target sequence in the gRNA is shown in SEQ ID No. 2.

Description

Method for gene editing in soybean by using Cas12i

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method for performing gene editing in soybean, in particular to a method for performing gene editing in soybean by using Cas12 i.

Background

Soybean is the main source of human oil and protein, one of the world's most important commercial crops, and also the main source of human vegetable oil and vegetable protein. With the improvement of living standard and dietary structure, people's demand for high-quality soybean oil is increasing, and the cultivation of high-quality soybean becomes one of the important targets of soybean breeding.

The CRISPR/Cas9 system is the most commonly used type II CRISPR system, which recognizes the PAM motif of 3' -NGG, performing blunt-end cleavage of the target sequence. Targeted editing of the target gene is achieved by guide RNA-mediated and cleavage of the Cas9 protein. The technology provides a new idea for the research of gene functions, and is more widely applied to the fields of research and development of biological medicines, genetic improvement of crops and the like. At present, the CRISPR/Cas9 system has been successfully applied to plants such as Arabidopsis, rice, corn, wheat and soybean.

The CRISPR/Cas Type V system is a newly discovered Type of CRISPR system that has a motif of 5' -TTN, with sticky end cleavage of the target sequence, e.g. Cpf1, C2C1, CasX, CasY. However, the different CRISPRs/Cas currently available have different advantages and disadvantages. For example, Cas9, C2C1 and CasX all require two RNAs for guide RNA, whereas Cpf1 requires only one guide RNA and can be used for multiple gene editing. CasX has a size of 980 amino acids, while the common Cas9, C2C1, CasY and Cpf1 are typically around 1300 amino acids in size. In addition, the PAM sequences of Cas9, Cpf1, CasX, and CasY are complex and diverse, while C2C1 recognizes the stringent 5' -TTN, so its target site is easily predicted than other systems to reduce potential off-target effects.

Cas12i also belongs to the V-type CRISPR/Cas system, and Chinese patent (CN 111757889B, publication date: 20210525) discloses a V-type Cas enzyme (Cas12f.4), and in the present invention, Cas12f.4 is defined as Cas12 i. As described in CN111757889B, this Cas enzyme (cas12f.4) exhibits a certain editing activity on corn, a monocotyledonous plant, but soybean is different from corn and belongs to a dicotyledonous plant. When the inventors studied the editing activity of this enzyme in dicotyledonous plants (for example, plants such as Arabidopsis thaliana and soybean), it was found that the editing efficiency of this enzyme with respect to dicotyledonous plants is low, and even some sites cannot exhibit editing activity.

Disclosure of Invention

The invention aims to provide a method for gene editing in soybean by using Cas12 i.

In one aspect, the invention provides a method for gene editing in soybean using Cas12i, the method comprising the step of gene editing in soybean using Cas12i and a gRNA targeting the soybean's GmFAD2-1A gene and GmFAD2-1B gene in the region.

In one embodiment, the amino acid sequence of Cas12I is selected from any one of the following I-III:

I. cas12i has an amino acid sequence that has at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID No.1 and substantially retains the biological function of SEQ ID No. 1;

II. The amino acid sequence of Cas12i has a sequence with one or more amino acid substitutions, deletions or additions compared to SEQ ID No.1 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions, deletions or additions) and substantially retains the biological function of SEQ ID No. 1;

III, Cas12i comprises the amino acid sequence shown as SEQ ID No.1 or the amino acid sequence of Cas12i is shown as SEQ ID No. 1.

In one embodiment, the gRNA includes a first segment and a second segment; the first segment is also referred to as "framework region", "protein binding segment", "protein binding sequence", or "Direct Repeat (Direct Repeat) sequence"; the second segment is also referred to as a "targeting sequence for targeting nucleic acid" or a "targeting segment for targeting nucleic acid", or a "targeting sequence for targeting a target sequence".

The first segment of the gRNA, the "backbone region," the "protein-binding segment," the "protein-binding sequence," or the "direct repeat" is capable of interacting with the Cas12i protein of the present invention, thereby allowing the Cas12i protein and the gRNA to form a complex. The gRNA of the invention directs its interacting Cas12i protein to a specific nucleotide sequence within the target nucleic acid through the action of the targeting sequence of the targeting nucleic acid.

The targeting sequence of the targeting nucleic acid or the targeting segment of the targeting nucleic acid of the invention comprises a nucleotide sequence that is complementary to a sequence in the target nucleic acid. In other words, the targeting sequence of the targeting nucleic acid or the targeting segment of the targeting nucleic acid of the present invention interacts in a sequence-specific manner with the target nucleic acid upon hybridization (i.e., base pairing). Thus, the targeting sequence of the targeting nucleic acid or the targeting segment of the targeting nucleic acid may be altered or modified to hybridize to any desired sequence within the target nucleic acid.

Preferably, the gRNA comprises, in the 5 'to 3' direction, a first segment and a second segment.

In the context of the present invention, the second segment is also understood to be a leader sequence which hybridizes to the target sequence.

In one embodiment, the targeting sequence in the gRNA for the target sequence is ccucauugcauggccaaucuauu (SEQ ID No. 2); the direct repeat sequence in the gRNA is agagaaugug ugcauagucacac (SEQ ID No. 3) or cucugaccac cugagagaau gugugcauag ucacacggua uaacaacuuc gacgagcucu (SEQ ID No. 4).

In other embodiments, the gRNA has a direct repeat sequence based on SEQ ID No.3, which may have a base deletion, substitution, or addition, as long as it can ensure binding ability to Cas12i, for example, "agagaaugugugcauagucaacac", "agagaaugugugcauagucuacac", "agagaaugugugcauaguccacac", or "agagaaugugugcauagucgacac" as described in chinese patent application (CN 113337502A).

In one embodiment, the method of gene editing of the invention comprises the step of delivering Cas12i and a gRNA into a soybean plant cell, a soybean seed, a soybean plant tissue, or a soybean plant part.

The above-described delivery can be carried out by any method known in the art. Such methods include, but are not limited to, transformation, transfection, electroporation, lipofection, microinjection, sonoporation, gene gun, calcium phosphate-mediated transfection, cationic transfection, lipofection, dendritic transfection, heat shock transfection, nuclear transfection, magnetic transfection, lipofection, puncture transfection, optical transfection, agent-enhanced nucleic acid uptake, and delivery via liposomes, immunoliposomes, viral particles, vectors, viral vectors, artificial virosomes, and the like.

In some embodiments, one or more AAV vectors, lentiviral vectors, nanoparticles, or a combination thereof are used to deliver one or more components of Cas12i and a gRNA.

In one embodiment, Cas12i and the gRNA are delivered into a soybean plant cell, soybean seed, soybean plant tissue, or soybean plant part by agrobacterium transformation.

In another aspect, the invention provides an engineered non-naturally occurring vector system, or CRISPR-Cas system, comprising a Cas12i protein or a nucleic acid sequence encoding the Cas12i protein and a nucleic acid encoding the aforementioned guide rna (grna).

In one embodiment, the nucleic acid sequence encoding the Cas12i protein and the nucleic acid encoding the guide RNA are artificially synthesized.

The gRNA targets GmFAD2-1A gene and GmFAD2-1B gene in soybean cells. And directs Cas12i protein to the genomic locus to modify, edit, or cleave the target sequence, whereby expression of the GmFAD2-1A gene and GmFAD2-1B gene is altered or modified.

The present invention also provides an engineered non-naturally occurring vector system, which may include one or more vectors, the one or more vectors including:

a) a first regulatory element operably linked to the gRNA,

b) a second regulatory element operably linked to the Cas12i protein and Cas12i described above;

wherein components (a) and (b) are located on the same or different carriers of the system.

The first and second regulatory elements include promoters (e.g., constitutive promoters or inducible promoters), enhancers (e.g., 35S promoter or 35S enhanced promoter), Internal Ribosome Entry Sites (IRES), and other expression control elements (e.g., transcription termination signals such as polyadenylation signals and poly-U sequences).

In some embodiments, the vector in the system is a viral vector (e.g., retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated vectors and herpes simplex vectors), and may also be of the type of plasmid, virus, cosmid, phage, and the like, which are well known to those skilled in the art.

In some embodiments, the systems provided herein are in a delivery system. In some embodiments, the delivery system is a nanoparticle, a liposome, an exosome, a microbubble, and a gene gun.

In one embodiment, the Cas12i protein has one or more NLS sequences attached thereto. In one embodiment, the NLS sequence is linked to the N-terminus and/or C-terminus of the protein.

In another aspect, the invention relates to an engineered CRISPR system comprising the Cas12i protein described above and a guide RNA described above.

In another aspect, the present invention provides a complex or composition comprising:

(i) a protein component that is the Cas12i protein described above; and

(ii) a nucleic acid component which is the above gRNA.

The protein component and the nucleic acid component are combined with each other to form a complex.

In another aspect, the invention provides the use of the above vector system, CRISPR system, the above complex or composition in the gene editing of soybean or in the preparation of high oleic soybean plants.

In another aspect, the invention also provides a method of making a high oleic soybean plant, comprising the step of using Cas12i and a gRNA described above to perform gene editing in a soybean plant cell, soybean seed, soybean plant tissue, or soybean plant part, thereby obtaining an edited high oleic soybean plant.

Further, the gene editing is performed on soybean GmFAD2-1A gene and GmFAD2-1B gene.

In one embodiment, the nucleic acid sequence of the edited GmFAD2-1A gene is as shown in seq id No. 5; the nucleic acid sequence of the edited GmFAD2-1B gene is shown as SEQ ID No. 6.

On the other hand, the invention also provides a high oleic acid soybean plant, which is prepared by adopting the gene editing method or the method for preparing the high oleic acid soybean plant.

In another aspect, the present invention also provides a method of preparing high oleic soybean seed comprising the step of preparing high oleic soybean seed using the above high oleic soybean plant.

In another aspect, the present invention also provides a high oleic soybean seed prepared by the above method for preparing a high oleic soybean seed.

The high oleic soybean of the present invention refers to soybean seeds after editing which have an oleic acid content of at least 50%, at least 60%, at least 70%, or at least 80% based on total fatty acids.

The oleic acid content of the edited soybean seed of the present invention is increased by at least 1-fold, at least 2-fold, at least 3-fold, at least 4-fold, or at least 5-fold compared to wild-type soybean seed.

In another aspect, the present invention also provides a method for preparing a soybean plant, comprising the step of crossing the above-mentioned high oleic soybean seed or high oleic soybean plant with other soybeans to prepare a soybean plant.

Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

The terms "polynucleotide", "nucleotide sequence", "nucleic acid molecule" and "nucleic acid" are used interchangeably and include DNA, RNA or hybrids thereof, whether double-stranded or single-stranded.

As used herein, the term "identity" is used to refer to the match of sequences between two polypeptides or between two nucleic acids. When a position in both of the sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine), then the molecules are identical at that position. The "percent identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared x 100. For example, if 6 of 10 positions of two sequences match, then the two sequences have 60% identity. For example, the DNA sequences CTGACT and CAGGTT share 50% identity (3 of the total 6 positions match). Typically, the comparison is made when the two sequences are aligned to yield maximum identity. Such alignments can be performed by using, for example, Needleman et al (1970) j. mol. biol. 48: 443-453. The algorithm of E.Meyers and W.Miller (Compout. Appl biosci., 4:11-17 (1988)) which has been incorporated into the ALIGN program (version 2.0) can also be used to determine percent identity between two amino acid sequences using a PAM120 weight residue table (weight residue table), a gap length penalty of 12 and a gap penalty of 4. Furthermore, percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (J MoI biol. 48: 444-.

The term "encode" refers to the inherent property of a particular nucleotide sequence in a polynucleotide, such as a gene, cDNA or mRNA, as a template for the synthesis of other polymers and macromolecules in biological processes having defined nucleotide sequences (i.e., rRNA, tRNA and mRNA) or defined amino acid sequences and the biological properties that result. Thus, a gene encodes a protein if transcription and translation of the mRNA corresponding to the gene produces the protein in a cell or other biological system.

The term "regulatory element," also known as "regulatory element," as used herein, is intended to include promoters, terminator sequences, leader sequences, polyadenylation sequences, signal peptide coding regions, marker genes, enhancers, Internal Ribosome Entry Sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences), which are described in detail with reference to gordel (Goeddel), "gene expression technology: METHODS IN ENZYMOLOGY (GENE EXPRESSION TECHNOLOGY: METHOD IN ENZYMOLOGY)185, Academic Press, San Diego, Calif. (1990). In some cases, regulatory elements include those sequences that direct constitutive expression of a nucleotide sequence in many types of host cells as well as those sequences that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters may primarily direct expression in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, a particular organ (e.g., liver, pancreas), or a particular cell type (e.g., lymphocyte). In certain instances, the regulatory element may also direct expression in a time-dependent manner (e.g., in a cell cycle-dependent or developmental stage-dependent manner), which may or may not be tissue or cell type specific. In certain instances, the term "regulatory element" encompasses enhancer elements, such as WPRE; a CMV enhancer; the R-U5' fragment in the LTR of HTLV-I ((mol. cell. biol., Vol.8 (1), pp.466-472, 1988); the SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit β -globin (Proc. Natl. Acad. Sci. USA., Vol.78 (3), pp.1527-31, 1981).

As used herein, the term "promoter" has a meaning well known to those skilled in the art and refers to a non-coding nucleotide sequence located upstream of a gene that promotes expression of a downstream gene. Constitutive (constitutive) promoters are nucleotide sequences that: when operably linked to a polynucleotide that encodes or defines a gene product, it results in the production of the gene product in the cell under most or all physiological conditions of the cell. An inducible promoter is a nucleotide sequence that, when operably linked to a polynucleotide that encodes or defines a gene product, causes the gene product to be produced intracellularly substantially only when an inducer corresponding to the promoter is present in the cell. A tissue-specific promoter is a nucleotide sequence that: when operably linked to a polynucleotide that encodes or defines a gene product, it results in the production of the gene product in the cell substantially only when the cell is of the tissue type to which the promoter corresponds.

A "nuclear localization signal" or "nuclear localization sequence" (NLS) is an amino acid sequence that "tags" a protein for introduction into the nucleus by nuclear transport, i.e., a protein with NLS is transported to the nucleus. Typically, NLS contains positively charged Lys or Arg residues exposed at the surface of the protein. Exemplary nuclear localization sequences include, but are not limited to, NLS from: SV40 Large T antigen, EGL-13, c-Myc and TUS protein.

As used herein, the term "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the one or more regulatory elements in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).

The term "vector" is a vector that comprises elements that permit the vector to integrate into the host cell genome or to replicate autonomously within the cell, independent of the genome. The vector may contain any element which ensures self-replication. It usually carries genes that are not part of the central metabolism of the cell and is usually in the form of double-stranded DNA. The choice of vector will generally depend on the compatibility of the vector with the host cell into which the vector is to be introduced. If a vector is used, the choice of vector will depend on methods well known to those skilled in the art for transforming a host cell. For example, plasmid vectors can be used.

The term "plant tissue" or "plant part" includes plant cells, protoplasts, plant tissue cultures, plant calli, plant pieces, and plant embryos, pollen, ovules, seeds, leaves, stems, flowers, branches, seedlings, fruits, kernels, ears, roots, root tips, anthers, and the like.

The term "plant cell" is understood to mean any cell from or found in a plant, which is capable of forming, for example: undifferentiated tissue such as callus, differentiated tissue such as embryos, plant parts, plants or seeds.

The nucleic acid sequences, nucleic acid constructs or expression vectors of the invention can be introduced into a host cell by a variety of techniques, including transformation, transfection, transduction, viral infection, gene gun or Ti-plasmid mediated gene delivery, as well as calcium phosphate transfection, DEAE-dextran mediated transfection, lipofection, electroporation, and the like.

In the production methods of the invention, the cells are cultured on a nutrient medium suitable for production of the polypeptide using methods well known in the art. If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted into the culture medium, it can be recovered from the cell lysate.

As used herein, the terms "guide rna (guide rna)", "mature crRNA", "guide sequence" are used interchangeably and have the meaning commonly understood by those skilled in the art. In general, the guide RNA may comprise, consist essentially of, or consist of a direct repeat (direct repeat) and a guide sequence (also referred to as a spacer (spacer) in the context of an endogenous CRISPR system).

In certain instances, the guide sequence is any polynucleotide sequence that is sufficiently complementary to the target sequence to hybridize to the target sequence and guide specific binding of the CRISPR/Cas complex to the target sequence. In one embodiment, the degree of complementarity between a guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%, when optimally aligned. Determining the optimal alignment is within the ability of one of ordinary skill in the art. For example, there are published and commercially available alignment algorithms and programs such as, but not limited to, ClustalW, the Smith-Waterman algorithm in matlab (Smith-Waterman), Bowtie, Geneius, Biopython, and SeqMan.

The sequence related by the invention is as follows:

sequence No. (SEQ ID No.)	Description of sequences
		1	Cas12i amino acid sequence
2	gRNA guide sequence
		3	gRNA direct repeat sequence
4	gRNA direct repeat sequence
		5	Edited GmFAD2-1A gene sequence
6	Edited GmFAD2-1B gene sequence

The invention has the main advantages that:

according to the invention, through a CRISPR gene editing technology based on Cas12i, the gene editing of GmFAD2-1A/B in soybean is successfully realized, and the oleic acid content in the edited soybean seeds is remarkably improved.

Drawings

Figure 1. vector schematic comprising Cas12i and a gRNA.

FIG. 2 is a graph of the oleic acid content of the oleic acid seeds of plants and wild-type control soybeans.

Detailed Description

The present invention will be further described with reference to the following examples, which are intended to be illustrative only and not to be limiting of the invention in any way, and any person skilled in the art can modify the present invention by applying the teachings disclosed above and applying them to equivalent embodiments with equivalent modifications. Any simple modification or equivalent changes made to the following embodiments according to the technical essence of the present invention, without departing from the technical spirit of the present invention, fall within the scope of the present invention.

Example 1 Gene editing in Soybean by Cas12 i-based CRISPR Gene editing technology

1. Gene editing vector construction

In this embodiment, Cas12i (amino acid sequence shown in SEQ ID No. 1) is used for gene editing in soybean.

The gRNA for Cas12i is designed according to the coding sequences of GmFAD2-1A, GmFAD2-1B and GmFT5 alpha genes in soybean, and the designed gRNA sequence is as follows:

gRNA	guide sequence of gRNA (5 'to 3')	PAM	Target genes
				gRNA 1	cuguaccaauacacgcccuucuc	ttc	GmFAD2-1A/B
gRNA 2	ccucauugcauggccaaucuauu	ttc	GmFAD2-1A/B
				gRNA 3	ucuccacagugccuuguaaaaug	ttc	GmFAD2-1A/B
gRNA 4	caaacacaaagccaccauucacu	ttc	GmFAD2-1A/B
				gRNA 5	uggacggauugcauucauag	tta	GmFT5α

The direct repeat sequence of the gRNA was agagaaugugugcauagucacac (5 'to 3'). The gRNA1-gRNA5 includes the direct repeat sequence and the respective leader sequence in the order from 5 'to 3'.

Designing an annealing primer according to a target point, taking gRNA2 as an example: the upstream primer is 5' to 3acacgaatgcttccaagatctcca, the downstream primer is 5' to 3ggcctggagatcttggaagcattc are provided. After annealing of the primers, the gene editing backbone vector was ligated by the Golden Gate method to obtain a gene editing vector, a schematic diagram of which is shown in fig. 1. The gene editing vector comprises Cas12i protein and the gRNA, wherein a promoter for starting the Cas12i protein is an EF1 alpha promoter, and a promoter of the gRNA is a U6 promoter.

2. Obtaining the recombinant bacterium

1) Transformation of Escherichia coli

And (2) transforming the gene editing vector in the step (1) into escherichia coli, carrying out bacterial liquid PCR on the transformed escherichia coli, selecting an amplification product with a correct PCR strip size for sequencing, and sequencing the escherichia coli with a correct sequencing result, namely the recombinant escherichia coli containing the gene editing vector.

2) Transformation of Agrobacterium

Culturing the recombinant escherichia coli containing the gene editing vector in the step 1), then, improving plasmid DNA, adding the DNA into agrobacterium-infected cells, carrying out ice bath for 5min, carrying out liquid nitrogen for 5min, carrying out water bath at 37 ℃ for 5min, and standing on ice for 5 min;

taking out the centrifuge tube, adding 700 mul of culture solution (without antibiotics), and carrying out shake culture at 28 ℃ for 2-4 h;

taking out the bacterial liquid and coating the bacterial liquid and a culture medium plate containing corresponding antibiotics, carrying out inverted culture in an incubator, carrying out PCR on the bacterial colony for about 2 days according to the method in the step 1), sequencing the amplified product, and obtaining the agrobacterium with the correct sequencing result, namely the recombinant agrobacterium containing the gene editing vector.

3. Genetic transformation of plants

1) Soybean seed sterilization:

the selected soybean seeds are put in a culture dish in a dryer, 10 ml of concentrated hydrochloric acid is slowly added into a beaker filled with 150 ml of sodium hypochlorite in the dryer in an adherence manner, and the cover of the dryer is quickly closed. The solution was sterilized with chlorine generated from sodium hypochlorite and concentrated hydrochloric acid for 16 h.

2) Seed germination:

and (3) inoculating the sterilized seeds in the step 1) downwards into an MS culture medium, wherein the depth of the inoculated culture medium accounts for 1/3-1/2 of the width of the seeds, and culturing overnight at 25 ℃ in a dark place or under light.

3) Preparing agrobacterium liquid:

taking a bacterial solution stored in a refrigerator at the temperature of minus 80 ℃, scratching the recombinant agrobacterium containing a gene editing vector in a YEP plate containing antibiotics (step 2 of step 2), culturing for 2 days at the temperature of 28 ℃, selecting a bacterial colony, inoculating the bacterial colony in 5 ml of YEP liquid culture medium in a 50 ml centrifuge tube, and shaking overnight at the temperature of 28 ℃; adding 300 mu l of bacterial liquid into 250 ml of YEP liquid culture medium, culturing overnight until OD600=0.6, centrifuging at 4000 rpm for 10 min, and diluting again with infection liquid until OD600=0.6 for later use.

4) Scratching, infecting and co-culturing cotyledonary node:

and (3) after the seeds in the step 2) germinate for 1 day, transversely cutting a blade at the position of a hypocotyl close to 3-5 mm of a cotyledon node, longitudinally cutting along the middle of two cotyledons without damaging the cotyledons, longitudinally cutting the hypocotyl, removing terminal buds, slightly and longitudinally cutting the cotyledon node part for 1-5 blades respectively, quickly putting the hypocotyl into the agrobacterium infection solution prepared in advance in the step 3), infecting for about 1-4 hours, taking out and putting the hypocotyl on a co-culture medium paved with filter paper, and co-culturing for 3-5 days at 22 ℃.

5) And (3) recovery culture:

and (3) inserting the explants after co-culture into a recovery culture medium, sealing a culture dish by using 3M breathable adhesive tape, placing the culture dish in the light, and recovering and culturing for 5-7 days at about 25 ℃.

6) Screening and culturing:

and inserting the recovered explant wound into a screening culture medium, screening under the light of about 25 ℃, and subculturing once every 10 days for 3-5 times.

7) Bud elongation culture:

and (3) cutting off cotyledons of the screened explants, transferring the parts with the cluster buds to a bud elongation culture medium, subculturing once every 10 days, and carrying out screening culture under the same illumination and temperature.

8) Rooting and transplanting:

when the plant in the bud elongation culture medium is elongated to 3cm (or has two three compound leaves), the plant is cut along the base part and inserted into sterilized nutrient soil, and then the root culture solution is poured for rooting. And after the roots grow out, moving the roots to soil which is watered thoroughly in advance, covering the soil with a plastic film, cutting off the plastic film after one week to acclimatize the seedlings, and completely removing the plastic film if new leaves grow out after two weeks to obtain E0 generation transformed seedlings.

4. Soybean transformant detection and phenotype observation

Edited shoots were tested and screened by PCR and sequencing in transformed shoots at E0, planted in climatic chambers, and observed for phenotypic changes, with wild type as control. And increasing mutation type groups through 2-3 generations of self-breeding to obtain homozygous editing seedlings without exogenous gene insertion.

5. Results

In the case where soybean edited plants were detected for each of gRNA1-gRNA5, the results showed that no editing event was detected in soybean by gRNA1, gRNA3, gRNA4, and gRNA5, and only editing event was detected by gRNA2 targeting GmFAD 2-1A/B.

The gene types of GmFAD2-1A/B of soybean editing plants edited by gRNA2 are as follows:

compared with the wild GmFAD2-1A gene, the gene GmFAD2-1A of the edited plant lacks the 262-288 th base, and the gene sequence of the GmFAD2-1A of the edited plant is shown as SEQ ID No. 5.

Compared with the wild GmFAD2-1B gene, the gene GmFAD2-1B gene of the edited plant lacks partial bases and inserts partial bases at the 258-position and 286-position, and the gene sequence of the GmFAD2-1B gene of the edited plant is shown as SEQ ID No. 6.

Phenotypic identification of the above soybean editing plants:

2g of soybean seeds of the edited plant of E1 generation was pulverized and then the oleic acid content was measured by gas chromatography, and the results are shown in FIG. 2, in which the oleic acid content in the soybean seeds of the edited plant was 80% or more based on the total fatty acids, while the oleic acid content in the soybean seeds of the wild-type plant was only about 20% based on the total fatty acids.

While specific embodiments of the invention have been described in detail, those skilled in the art will understand that: various modifications and changes in detail can be made in light of the overall teachings of the disclosure, and such changes are intended to be within the scope of the present invention. A full appreciation of the invention is gained by taking the entire specification as a whole in the light of the appended claims and any equivalents thereof.

SEQUENCE LISTING

<110> Shunheng Biotech Co., Ltd

<120> method for gene editing in soybean using Cas12i

<130> SF097

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 1045

<212> PRT

<213> Artificial Sequence

<220>

<223> Cas12i

<400> 1

Met Lys Lys Val Glu Val Ser Arg Pro Tyr Gln Ser Leu Leu Leu Pro

1 5 10 15

Asn His Arg Lys Phe Lys Tyr Leu Asp Glu Thr Trp Asn Ala Tyr Lys

20 25 30

Ser Val Lys Ser Leu Leu His Arg Phe Leu Val Cys Ala Tyr Gly Ala

35 40 45

Val Pro Phe Asn Lys Phe Val Glu Val Val Glu Lys Val Asp Asn Asp

50 55 60

Gln Leu Val Leu Ala Phe Ala Val Arg Leu Phe Arg Leu Val Pro Val

65 70 75 80

Glu Ser Thr Ser Phe Ala Lys Val Asp Lys Ala Asn Leu Ala Lys Ser

85 90 95

Leu Ala Asn His Leu Pro Val Gly Thr Ala Ile Pro Ala Asn Val Gln

100 105 110

Ser Tyr Phe Asp Ser Asn Phe Asp Pro Lys Lys Tyr Met Trp Ile Asp

115 120 125

Cys Ala Trp Glu Ala Asp Arg Leu Ala Arg Glu Met Gly Leu Ser Ala

130 135 140

Ser Gln Phe Ser Glu Tyr Ala Thr Thr Met Leu Trp Glu Asp Trp Leu

145 150 155 160

Pro Leu Asn Lys Asp Asp Val Asn Gly Trp Gly Ser Val Ser Gly Leu

165 170 175

Phe Gly Glu Gly Lys Lys Glu Asp Arg Gln Gln Lys Val Lys Met Leu

180 185 190

Asn Asn Leu Leu Asn Gly Ile Lys Lys Asn Pro Pro Lys Asp Tyr Thr

195 200 205

Gln Tyr Leu Lys Ile Leu Leu Asn Ala Phe Asp Ala Lys Ser His Lys

210 215 220

Glu Ala Val Lys Asn Tyr Lys Gly Asp Ser Thr Gly Arg Thr Ala Ser

225 230 235 240

Tyr Leu Ser Glu Lys Ser Gly Glu Ile Thr Glu Leu Met Leu Glu Gln

245 250 255

Leu Met Ser Asn Ile Gln Arg Asp Ile Gly Asp Lys Gln Lys Glu Ile

260 265 270

Ser Leu Pro Lys Lys Asp Val Val Lys Lys Tyr Leu Glu Ser Glu Ser

275 280 285

Gly Val Pro Tyr Asp Gln Asn Leu Trp Ser Gln Ala Tyr Arg Asn Ala

290 295 300

Ala Ser Ser Ile Lys Lys Thr Asp Thr Arg Asn Phe Asn Ser Thr Leu

305 310 315 320

Glu Lys Phe Lys Asn Glu Val Glu Leu Arg Gly Leu Leu Ser Glu Gly

325 330 335

Asp Asp Val Glu Ile Leu Arg Ser Lys Phe Phe Ser Ser Glu Phe His

340 345 350

Lys Thr Pro Asp Lys Phe Val Ile Lys Pro Glu His Ile Gly Phe Asn

355 360 365

Asn Lys Tyr Asn Val Val Ala Glu Leu Tyr Lys Leu Lys Ala Glu Ala

370 375 380

Thr Asp Phe Glu Ser Ala Phe Ala Thr Val Lys Asp Glu Phe Glu Glu

385 390 395 400

Lys Gly Ile Lys His Pro Ile Lys Asn Ile Leu Glu Tyr Ile Trp Asn

405 410 415

Asn Glu Val Pro Val Glu Lys Trp Gly Arg Val Ala Arg Phe Asn Gln

420 425 430

Ser Glu Glu Lys Leu Leu Arg Ile Lys Ala Asn Pro Thr Val Glu Cys

435 440 445

Asn Gln Gly Met Thr Phe Gly Asn Ser Ala Met Val Gly Glu Val Leu

450 455 460

Arg Ser Asn Tyr Val Ser Lys Lys Gly Ala Leu Val Ser Gly Glu His

465 470 475 480

Gly Gly Arg Leu Ile Gly Gln Asn Asn Met Ile Trp Leu Glu Met Arg

485 490 495

Leu Leu Asn Lys Gly Lys Trp Glu Thr His His Val Pro Thr His Asn

500 505 510

Met Lys Phe Phe Glu Glu Val His Ala Tyr Asn Pro Ser Leu Ala Asp

515 520 525

Ser Val Asn Val Arg Asn Arg Leu Tyr Arg Ser Glu Asp Tyr Thr Gln

530 535 540

Leu Pro Ser Ser Ile Thr Asp Gly Leu Lys Gly Asn Pro Lys Ala Lys

545 550 555 560

Leu Leu Lys Arg Gln His Cys Ala Leu Asn Asn Met Thr Ala Asn Val

565 570 575

Leu Asn Pro Lys Leu Ser Phe Thr Ile Asn Lys Lys Asn Asp Asp Tyr

580 585 590

Thr Val Ile Ile Val His Ser Val Glu Val Ser Lys Pro Arg Arg Glu

595 600 605

Val Leu Val Gly Asp Tyr Leu Val Gly Met Asp Gln Asn Gln Thr Ala

610 615 620

Ser Asn Thr Tyr Ala Val Met Gln Val Val Lys Pro Lys Ser Thr Asp

625 630 635 640

Ala Ile Pro Phe Arg Asn Met Trp Val Arg Phe Val Glu Ser Gly Ser

645 650 655

Ile Glu Ser Arg Thr Leu Asn Ser Arg Gly Glu Tyr Val Asp Gln Leu

660 665 670

Asn His Asp Gly Val Asp Leu Phe Glu Ile Gly Asp Thr Glu Trp Val

675 680 685

Asp Ser Ala Arg Lys Phe Phe Asn Lys Leu Gly Val Lys His Lys Asp

690 695 700

Gly Thr Leu Val Asp Leu Ser Thr Ala Pro Arg Lys Ala Tyr Ala Phe

705 710 715 720

Asn Asn Phe Tyr Phe Lys Thr Met Leu Asn His Leu Arg Ser Asn Glu

725 730 735

Val Asp Leu Thr Leu Leu Arg Asn Glu Ile Leu Arg Val Ala Asn Gly

740 745 750

Arg Phe Ser Pro Met Arg Leu Gly Ser Leu Ser Trp Thr Thr Leu Lys

755 760 765

Ala Leu Gly Ser Phe Lys Ser Leu Val Leu Ser Tyr Phe Asp Arg Leu

770 775 780

Gly Ala Lys Glu Met Val Asp Lys Glu Ala Lys Asp Lys Ser Leu Phe

785 790 795 800

Asp Leu Leu Val Ala Ile Asn Asn Lys Arg Ser Asn Lys Arg Glu Glu

805 810 815

Arg Thr Ser Arg Ile Ala Ser Ser Leu Met Thr Val Ala Gln Lys Tyr

820 825 830

Lys Val Asp Asn Ala Val Val His Val Val Val Glu Gly Asn Leu Ser

835 840 845

Ser Thr Asp Arg Ser Ala Ser Lys Ala His Asn Arg Asn Thr Met Asp

850 855 860

Trp Cys Ser Arg Ala Val Val Lys Lys Leu Glu Asp Met Cys Asn Leu

865 870 875 880

Tyr Gly Phe Asn Ile Lys Gly Val Pro Ala Phe Tyr Thr Ser His Gln

885 890 895

Asp Pro Leu Val His Arg Ala Asp Tyr Asp Asp Pro Lys Pro Ala Leu

900 905 910

Arg Cys Arg Tyr Ser Ser Tyr Ser Arg Ala Asp Phe Ser Lys Trp Gly

915 920 925

Gln Asn Ala Leu Ala Ala Val Val Arg Trp Ala Ser Asn Lys Lys Ser

930 935 940

Asn Thr Cys Tyr Lys Val Gly Ala Val Glu Phe Leu Lys Gln His Gly

945 950 955 960

Leu Phe Ala Asp Lys Lys Leu Thr Val Glu Gln Phe Leu Ser Lys Val

965 970 975

Lys Asp Glu Glu Ile Leu Ile Pro Arg Arg Gly Gly Arg Val Phe Leu

980 985 990

Thr Thr His Arg Leu Leu Ala Glu Ser Thr Phe Val Tyr Leu Asn Gly

995 1000 1005

Val Lys Tyr His Ser Cys Asn Ala Asp Glu Val Ala Ala Val Asn

1010 1015 1020

Ile Cys Leu Asn Asp Trp Val Ile Pro Cys Lys Lys Lys Met Lys

1025 1030 1035

Glu Glu Ser Ser Ala Ser Gly

1040 1045

<210> 2

<211> 23

<212> RNA

<213> Artificial Sequence

<220>

<223> gRNA guide sequence

<400> 2

ccucauugca uggccaaucu auu 23

<210> 3

<211> 23

<212> RNA

<213> Artificial Sequence

<220>

<223> gRNA-DR1

<400> 3

agagaaugug ugcauaguca cac 23

<210> 4

<211> 60

<212> RNA

<213> Artificial Sequence

<220>

<223> gRNA-DR2

<400> 4

cucugaccac cugagagaau gugugcauag ucacacggua uaacaacuuc gacgagcucu 60

<210> 5

<211> 1137

<212> DNA

<213> Artificial Sequence

<220>

<223> GmFAD2-1A-GE

<400> 5

atgggtctag caaaggaaac aacaatggga ggtagaggtc gtgtggccaa agtggaagtt 60

caagggaaga agcctctctc aagggttcca aacacaaagc caccattcac tgttggccaa 120

ctcaagaaag caattccacc acactgcttt cagcgctccc tcctcacttc attctcctat 180

gttgtttatg acctttcatt tgccttcatt ttctacattg ccaccaccta cttccacctc 240

cttcctcaac ccttttccct ccaaggttgc cttctcactg gtgtgtgggt gattgctcac 300

gagtgtggtc accatgcctt cagcaagtac caatgggttg atgatgttgt gggtttgacc 360

cttcactcaa cacttttagt cccttatttc tcatggaaaa taagccatcg ccgccatcac 420

tccaacacag gttcccttga ccgtgatgaa gtgtttgtcc caaaaccaaa atccaaagtt 480

gcatggtttt ccaagtactt aaacaaccct ctaggaaggg ctgtttctct tctcgtcaca 540

ctcacaatag ggtggcctat gtatttagcc ttcaatgtct ctggtagacc ctatgatagt 600

tttgcaagcc actaccaccc ttatgctccc atatattcta accgtgagag gcttctgatc 660

tatgtctctg atgttgcttt gttttctgtg acttactctc tctaccgtgt tgcaaccctg 720

aaagggttgg tttggctgct atgtgtttat ggggtgcctt tgctcattgt gaacggtttt 780

cttgtgacta tcacatattt gcagcacaca cactttgcct tgcctcatta cgattcatca 840

gaatgggact ggctgaaggg agctttggca actatggaca gagattatgg gattctgaac 900

aaggtgtttc atcacataac tgatactcat gtggctcacc atctcttctc tacaatgcca 960

cattaccatg caatggaggc aaccaatgca atcaagccaa tattgggtga gtactaccaa 1020

tttgatgaca caccatttta caaggcactg tggagagaag cgagagagtg cctctatgtg 1080

gagccagatg aaggaacatc cgagaagggc gtgtattggt acaggaacaa gtattga 1137

<210> 6

<211> 1169

<212> DNA

<213> Artificial Sequence

<220>

<223> GmFAD2-1B-GE

<400> 6

atgggtctag caaaggaaac aataatggga ggtggaggcc gtgtggccaa agttgaaatt 60

cagcagaaga agcctctctc aagggttcca aacacaaagc caccattcac tgttggccaa 120

ctcaagaaag ccattccacc gcactgcttt cagcgttccc tcctcacttc attgtcctat 180

gttgtttatg acctttcatt ggctttcatt ttctacattg ccaccaccta cttccacctc 240

ctccctcacc ccttttctac attgccttca ttttctacat tgcctttttc ctccaaggtt 300

gcattcttac tggcgtgtgg gtgattgctc acgagtgtgg tcaccatgcc ttcagcaagt 360

acccatgggt tgatgatgtt atgggtttga ccgttcactc agcactttta gtcccttatt 420

tctcatggaa aataagccat cgccgccacc actccaacac gggttccctt gaccgtgatg 480

aagtgtttgt cccaaaacca aaatccaaag ttgcatggta caccaagtac ctgaacaacc 540

ctctaggaag ggctgcttct cttctcatca cactcacaat agggtggcct ttgtatttag 600

ccttcaatgt ctctggcaga ccctatgatg gttttgctag ccactaccac ccttatgctc 660

ccatatattc aaatcgtgag aggcttttga tctatgtctc tgatgttgct ttgttttctg 720

tgacttactt gctctaccgt gttgcaacta tgaaagggtt ggtttggctg ctatgtgttt 780

atggggtgcc attgctcatt gtgaacggtt ttcttgtgac catcacatat ctgcagcaca 840

cacactatgc cttgcctcac tatgattcat cagaatggga ttggctgagg ggtgctttgg 900

caactatgga cagagattat ggaattctga acaaggtgtt tcaccacata actgatactc 960

atgtggctca ccatcttttc tctacaatgc cacattacca tgcaacggag gcaaccaatg 1020

caatgaagcc aatattgggt gagtactacc gatttgatga cacaccattt tacaaggcac 1080

tgtggagaga agcaagagag tgcctctatg tggagccaga tgaaggaaca tccgagaagg 1140

gcgtgtattg gtacaggaac aagtattga 1169

Claims (10)

1. A method of gene editing in soybean using Cas12i, comprising the step of gene editing in soybean using Cas12i and a gRNA comprising a backbone region that binds Cas12i and a guide series that hybridizes to a target sequence, the gRNA targeting a GmFAD2-1A gene and a GmFAD2-1B gene in soybean; the amino acid sequence of Cas12i is shown in SEQ ID No.1, and the guide sequence hybridized with the target sequence in the gRNA is shown in SEQ ID No. 2.

2. The method of claim 1 wherein the gRNA has a framework region binding to Cas12i having a sequence as set forth in SEQ ID No.3 or SEQ ID No. 4.

3. The method of claim 1, comprising the step of delivering Cas12i and a gRNA into a soybean plant cell, a soybean seed, a soybean plant tissue, or a soybean plant part.

4. A CRISPR-Cas system, the system comprising:

(1) a Cas12i protein or a nucleic acid sequence encoding the Cas12i protein as claimed in any one of claims 1-3; and (2) a gRNA or a nucleic acid sequence encoding the gRNA of any one of claims 1-3.

5. A vector system comprising one or more vectors, the one or more vectors comprising:

a) a first regulatory element operably linked to the gRNA of any one of claims 1-3, and the gRNA,

b) a second regulatory element operably linked to the Cas12i, and a Cas12i as set forth in any one of claims 1-3;

wherein components (a) and (b) are located on the same or different carriers of the system.

6. A complex or composition comprising:

(i) a protein component which is a Cas12i protein of any one of claims 1-3; and

(ii) a nucleic acid component which is a gRNA according to any one of claims 1-3.

7. A method of making a high oleic soybean plant, the method comprising the step of using Cas12i and a gRNA of any one of claims 1-3 to perform gene editing in a soybean plant cell, soybean seed, soybean plant tissue, or soybean plant part, thereby obtaining an edited high oleic soybean plant.

8. A method of making high oleic soybean seed comprising the step of making said high oleic soybean seed using the high oleic soybean plant made by the method of claim 7.

9. A method of making a soybean plant, said method comprising the step of crossing a high oleic soybean plant produced by the method of claim 7 with another soybean plant to produce said soybean plant.

10. Use of the CRISPR-Cas system of claim 4, or the vector system of claim 5, or the complex or composition of claim 6 for gene editing of soybean, or for preparing a high oleic soybean plant.

Images