CN114107310B

CN114107310B - Phosphatidylserine aptamer and application thereof

Info

Publication number: CN114107310B
Application number: CN202111410703.8A
Authority: CN
Inventors: 王赛; 毛相朝; 马蕊
Original assignee: Ocean University of China
Current assignee: Ocean University of China
Priority date: 2021-11-25
Filing date: 2021-11-25
Publication date: 2024-05-24
Anticipated expiration: 2041-11-25
Also published as: CN114107310A

Abstract

The invention discloses a plurality of phosphatidylserine nucleic acid aptamers, belonging to the technical field of biology, wherein the nucleotide sequence of each nucleic acid aptamer is shown in any one of SEQ ID NO. 1-9, and the nucleic acid aptamer is obtained by a chimeric synergistic end locking modification mode and a key base overlapping modification mode. The invention also discloses application of the aptamer in detection, separation and enrichment of phosphatidylserine, application in preparation of a detection reagent, a kit or a sensor of phosphatidylserine, and application in monitoring, diagnosing, preventing and treating related diseases and researching mechanisms in real time for identifying and monitoring phosphatidylserine. According to the characteristics of the secondary structure of the original aptamer, the aptamer is reasonably modified and optimized, so that the modified aptamer has better affinity to a target, and the obtained nucleic acid aptamer has a wide application prospect and can be used for rapid identification of phosphatidylserine, monitoring detection of phosphatidylserine in a biological processing system and the like.

Description

Phosphatidylserine aptamer and application thereof

Technical Field

The invention relates to a nucleic acid aptamer with high affinity for phosphatidylserine and application thereof, belonging to the technical field of biology.

Background

Phosphatidylserine (Phosphatidylserine, PS) is a rare natural phospholipid, and Jordi Folch was first isolated from bovine brain in 1942 by extraction, and is the only phospholipid that can regulate the functional state of key proteins of cell membranes. PS can improve brain function and help to improve the cognitive ability of the senile dementia patient; the stress hormone level in the body of a person with work tension can be obviously reduced, the pressure is lightened, the concentration is promoted, and the alertness and the memory are improved; can be used for regulating neurotransmitter hormone such as norepinephrine, etc. for controlling emotion, and relieving adverse emotion. In terms of PS production, the conversion of phosphatidylcholine to produce PS by means of enzymatic-based bioprocessing techniques, in addition to extraction from natural sources, is becoming a research hotspot. PS is increasingly demanded as a new resource food and a formulation food for special medical use, and therefore it is important to monitor and detect the quality, yield, etc. of PS obtained. In addition, the externalization of PS on the surface of apoptotic cell membranes is considered as an early event in the apoptotic pathway, and the real-time identification and monitoring of the externalization of PS on cell membranes is of great research significance for the prevention, diagnosis and treatment of programmed cell death and diseases, etc. At present, the detection technology for PS is mainly high performance liquid chromatography, the method uses a large amount of organic solvent, the operation steps are complicated, the pretreatment requirement on analysis samples is high, and professional personnel operation is needed, so that the time consumption is long. Therefore, a new and convenient detection method is urgently needed to realize rapid detection and quantification of PS.

The aptamer is an oligonucleotide fragment obtained by in vitro screening through an exponential enrichment ligand evolution technology, has the biological characteristics of low cost, easiness in synthesis, modification, small batch difference, low immunogenicity and the like, can be rapidly and specifically combined with a corresponding target, and specifically recognizes various targets. At present, the aptamer has been successfully applied to various fields such as food safety analysis and biomedical research as a chemical and biological sensing recognition molecule, but no report on the aptamer sequence and application thereof aiming at monitoring detection of phosphatidylserine in the biological processing process exists at present.

Disclosure of Invention

Aiming at the prior art, the invention provides a plurality of nucleic acid aptamers with high affinity to phosphatidylserine, and provides application of the nucleic acid aptamers in various aspects of detection, separation and enrichment of phosphatidylserine, preparation of detection reagents, kits or sensors of phosphatidylserine, detection and monitoring of phosphatidylserine in actual biological processing processes, and the like. The invention provides a new transformation method by taking the PS original aptamer with certain affinity as an initial chain to optimally transform the aptamer, and the transformed aptamer has better affinity to a target by a transformation mode of performing chimeric collaborative joint end locking on the PS aptamer sequence and a transformation mode of overlapping key bases of the PS aptamer sequence.

The invention is realized by the following technical scheme:

the nucleotide sequence of the nucleic acid aptamer of phosphatidylserine is one of the following, as shown in any one of SEQ ID NOs.1-9:

PS-LC2:5'-AAAGACAAAGAC-3' as shown in SEQ ID NO. 1;

PS-LC3:5'-AAAGACAAAGACAAAGAC-3' as shown in SEQ ID NO. 2;

PS-LC2-TF:5'-GGCGGGAAAGACAAAGACCCCGCC-3' as shown in SEQ ID NO. 3;

PS-LC3-TF:5'-GGCGGGAAAGACAAAGACAAAGACCCCGCC-3' as shown in SEQ ID NO. 4;

PS-LC4-TF:5'-GGCGGGAAAGACAAAGACAAAGACAAAGACCCCGCC-3' as shown in SEQ ID NO. 5;

PS-LC5-TF:5'-GGCGGGAAAGACAAAGACAAAGACAAAGACAAAGACCCCGCC-3' as shown in SEQ ID NO. 6;

PS-RKB1:5'-AAAGACAG-3' as shown in SEQ ID NO. 7;

PS-RKB2:5'-AAAGACAGAG-3' as shown in SEQ ID NO. 8;

PS-RKB3:5'-AAAGACAGAGAG-3' as shown in SEQ ID NO. 9.

The nucleic acid aptamer shown in SEQ ID NO.1 and SEQ ID NO.2 is obtained by chimeric collaborative transformation of an original PS aptamer sequence 5 '-AAAGAC-3'; the nucleic acid aptamer shown in SEQ ID NO. 3-6 is obtained by a modification mode of chimeric collaborative joint end locking of an original PS aptamer sequence 5 '-AAAGAC-3'; the nucleic acid aptamer shown in SEQ ID No. 7-9 is obtained by modifying the key base stack (AG stack 1 time, 2 times or 3 times) of the original PS aptamer sequence 5 '-AAAGAC-3'.

The use of said aptamer to phosphatidylserine in the detection (non-diagnostic or therapeutic purposes), isolation and/or enrichment of phosphatidylserine.

Application of the phosphatidylserine aptamer in preparing detection probes, detection reagents, detection kits and/or sensors for detecting phosphatidylserine.

The phosphatidylserine aptamer is applied to detection and/or monitoring of the biological processing process of phosphatidylserine.

The application of the phosphatidylserine aptamer in monitoring, diagnosing, preventing and treating related diseases and researching mechanisms in real time is provided.

According to the invention, the PS aptamer is modified, and the end of the aptamer is further locked on the basis of optimizing and modifying the aptamer in a chimeric cooperative mode according to the characteristics of the secondary structure of the original aptamer; and optimizing and modifying the mode of overlapping key bases of the aptamer sequence, so that the modified aptamer has better affinity for a target. The invention provides a brand-new aptamer reconstruction method, which opens up a new way for detecting phosphatidylserine, can be used for detecting, separating and enriching phosphatidylserine, preparing a phosphatidylserine detection reagent, a kit or a sensor, detecting and monitoring phosphatidylserine in the actual biological processing process, identifying and monitoring the outward appearance of phosphatidylserine on cell membranes in real time in monitoring and preventing related diseases, and the like. The nucleic acid aptamer has great potential for practical application.

The various terms and phrases used herein have the ordinary meaning known to those skilled in the art.

Drawings

Fig. 1: the simulation result of the butt joint of the PS-Original aptamer and the PS molecule is shown in the schematic diagram, and the secondary structure of the PS aptamer is shown in the schematic diagram after the modification of the chimeric synergistic joint end locking and the modification of the PS aptamer and the superposition modification of key bases of the PS aptamer sequence.

Fig. 2: the nucleic acid aptamer affinity detection result is schematically shown, wherein A, B, C, D, E, F, G is as follows: PS-Original, PS-LC2, PS-LC3, PS-LC2-TF, PS-LC3-TF, PS-LC4-TF, PS-LC5-TF.

Fig. 3: schematic of the affinity assay results for the aptamer PS-RKB 1.

Fig. 4: the detection result of the affinity of the aptamer is schematically shown, wherein A, B is PS-RKB2 and PS-RKB3 in sequence.

Fig. 5: cuNPs fluorescence spectra at different PS concentrations.

Fig. 6: PS-RKB 1-based standard curves for detection of PS by non-labeled fluorescent CuNPs-aptamer sensors.

Detailed Description

The invention is further illustrated below with reference to examples. However, the scope of the present invention is not limited to the following examples. Those skilled in the art will appreciate that various changes and modifications can be made to the invention without departing from the spirit and scope thereof.

The instruments, reagents, materials, etc. used in the examples described below are conventional instruments, reagents, materials, etc. known in the art, and are commercially available. The experimental methods, detection methods, and the like in the examples described below are conventional experimental methods, detection methods, and the like that are known in the prior art unless otherwise specified.

Optimization of the Proaptamer PS-Original of example 1 PS

The affinity of the aptamer sequence for the target was determined in this example using a biofilm interference molecular interaction instrument. A biological membrane interference molecular interaction instrument is a common analysis instrument used for quantitatively describing interaction strength between molecules. The method can rapidly determine the affinity by utilizing a biological membrane interference technology, more quantitatively characterize the molecular interaction, and plays an important role in researching the interaction among biological molecules at present.

The aptamer is immobilized on the sensor surface by binding biotin to streptavidin. The buffer solution of the reaction, the biotin-labeled aptamer and targets with different concentrations are added into a 96-well plate, the program set by the instrument is sensor balance 120 s, aptamer fixation 180 s, sensor balance 180 s, target binding 300 s, target dissociation 300 s, temperature 25 ℃ and frequency 2 Hz. Fitting the obtained binding-dissociation curve can obtain dissociation equilibrium constant KD value.

The DNA sequence of the PS pro-aptamer PS-Original has been reported to be: 5'-AAAGAC-3', 6 bases in total.

Experimental results of a biological membrane interference molecular interaction instrument show that the dissociation equilibrium constant (KD) between PS-Original aptamer and PS is 6.53E-06M, wherein the smaller the KD value is, the higher the affinity is.

In order to obtain a more optimized aptamer, the aptamer sequence is subjected to chimeric collaborative joint end locking transformation, specifically:

Two kinds of nucleic acid aptamer are obtained by the chimeric synergistic modification mode of the original PS aptamer sequence 5'-AAAGAC-3', as shown in Table 1; by modifying the original PS aptamer sequence 5'-AAAGAC-3' in a chimeric synergistic joint end locking manner, 4 kinds of nucleic acid aptamers are obtained, as shown in Table 1.

Simulating the combination of the aptamer and the target by using molecular docking simulation software Autodock, and predicting key sites of interaction between the aptamer PS-Original and the target based on a clustering result and an energy minimum principle; and (3) performing chimeric collaborative joint end locking transformation on the PS-Original by using an online tool 'the UNAFold web server', and predicting a secondary structure after superposition transformation on key bases of the PS aptamer sequence, as shown in figure 1.

Experimental results of the biofilm interference molecular interaction instrument (as shown in table 1) indicate that: the affinity of PS-LC2 to PS is improved to some extent compared with PS-Original, while the affinity of PS-LC3 to PS is slightly reduced compared with PS-LC2 (comparative values, the dissociation equilibrium constant of PS-Original aptamer PS-Original is 6.53E-06M, PS-LC2 is 2.01E-06M, PS-LC3 is 4.97E-06M, all of which are lower than those of Original aptamer, and PS-LC2 is better than PS-LC 3), which indicates that double chimeric synergy of PS Original aptamer is helpful for improving affinity, and triple chimeric synergy may make aptamer sequence redundant, affecting interaction with PS. On the basis, the end locking transformation is carried out on the chimeric and synergistically transformed aptamer, and experimental results of a biomembrane interference molecular interaction instrument show that the affinities of PS-LC2-TF, PS-LC3-TF, PS-LC4-TF and PS-LC5-TF for PS are obviously improved, wherein the affinity of PS-LC3-TF for PS is the highest, and the KD value is 1.66E-07M, as shown in figure 2. It is inferred that end-locked engineering limits the over-folding of the aptamer, promotes the participation of critical bases in folding into stable sites, and increases affinity for the target.

TABLE 1

Name of the name	Sequence (5 '-3')	KD (M)
			PS-LC2	AAAGACAAAGAC (SEQ ID NO.1)	2.01E-06
PS-LC3	AAAGACAAAGACAAAGAC (SEQ ID NO.2)	4.97E-06
			PS-LC2-TF	GGCGGGAAAGACAAAGACCCCGCC (SEQ ID NO.3)	1.78E-07
PS-LC3-TF	GGCGGGAAAGACAAAGACAAAGACCCCGCC (SEQ ID NO.4)	1.66E-07
			PS-LC4-TF	GGCGGGAAAGACAAAGACAAAGACAAAGACCCCGCC (SEQ ID NO.5)	2.18E-07
PS-LC5-TF	GGCGGGAAAGACAAAGACAAAGACAAAGACAAAGACCCCGCC (SEQ ID NO.6)	2.31E-07

The key sites of interaction of PS-Original and target are analyzed, on the basis of the key base pair aptamer is overlapped and modified (3 kinds of nucleic acid aptamers are obtained by modifying the key base overlapping of the Original PS aptamer sequence 5'-AAAGAC-3', as shown in table 2), and the affinity of the modified aptamer and PS is measured by using a biological film interference molecular interaction instrument. Experimental results show that the KD value of PS-RKB1 to PS in FIG. 3 is 9.34E-07M, and the affinity is improved. As shown in the results of the measurement of the biological membrane interference molecular interaction instrument in FIG. 4, compared with the PS-RKB2 overlapped with the PS-RKB3 overlapped with the PS-RKB2 overlapped with the PS 3 times, the affinity of the PS is reduced, which indicates that the affinity is not infinitely improved along with the increase of the times of overlapping key bases.

TABLE 2

Name of the name	Sequence (5 '-3')	KD (M)
			PS-RKB1	AAAGACAG (SEQ ID NO.7)	9.34E-07
PS-RKB2	AAAGACAGAG (SEQ ID NO.8)	2.21E-07
			PS-RKB3	AAAGACAGAGAG (SEQ ID NO.9)	2.32E-07

The affinity of the aptamer modified by the method to phosphatidylserine is better than that of the reported PS initial aptamer (PS-Original).

Example 2 application of aptamer PS-RKB1 to detection of PS in products and feedstocks of different conversion during bioprocessing

(1) Construction of unlabeled fluorescent CuNPs-aptamer sensor

TdT induces the formation of the aptamer PS-RKB1 terminal polyT:

Firstly, mixing an aptamer with a certain concentration, a binding buffer (150 mM NaCl and 50 mM K ₂HPO₄, pH 7.6）、0.25 mM CoCl₂, 4mM dTTP, 0.3U/mu L TdT and TdT buffer, reacting at 37 ℃ for 30min, and inactivating the TdT at 75 ℃ for 20 min to generate the polyT.

Preparation of CuNPs:

And directly taking the generated polyT-aptamer polymer as a template generated by CuNPs, directly adding CuSO ₄ and NaVc with certain concentrations into the system, and mixing for a few minutes at room temperature to generate the CuNPs. Then, photographing was performed under ultraviolet irradiation, and fluorescence intensity in the range of 540-650 nm emitted light was measured with an F-4600 fluorescence spectrophotometer under excitation light 345 nm.

(2) Determination of a Standard Curve

And detecting PS standard substances with different concentration gradients by using the constructed non-labeled fluorescent CuNPs-aptamer sensor. 300 nM PS aptamer PS-RKB1 was first incubated with different concentrations of PS (0, 15.625, 31.25, 62.5, 125, 250, 500, 1000, 2000 ng/mL) at room temperature for 30 min, respectively. Generating CuNPs fluorescence signal according to the method, and obtaining fluorescence spectrum chart as shown in figure 5. As the concentration of the target increases, the aptamer binds to the target, the aptamer conformation changes, resulting in 3' inward folding of the aptamer, less polyT formation, and thus less CuNPs formation, and reduced fluorescence intensity. The fluorescence intensity at 620 nm was taken as the signal change inhibition rate to obtain the signal response curve shown in fig. 6. The fluorescence signal inhibition rate of CuNPs increases with increasing PS concentration.

(3) Detection of PS in products and feedstocks of different conversion in bioprocesses

PS in products and raw materials with different conversion rates in the biological processing process are diluted and measured according to standard concentrations (250, 500 and 1000 ng/mL), and the constructed adaptive sensor is adopted for analysis, as shown in a table 3, the aptamer sensor based on PS-RKB1 has good recovery rate, between 82.19% and 113.6%, RSD is lower than 8%, and the non-labeled fluorescent CuNPs-aptamer sensor constructed based on PSRKB1 has high accuracy and repeatability, and has wide application prospect in monitoring and detecting PS in the actual biological processing process.

The information on the recovery rate of the products and raw materials at different conversion rates during the biological processing in this example is shown in Table 3.

TABLE 3 information on recovery of different conversion products and raw materials during biological processing

Sample 1 the bioprocessed product contained 36.08% PS;

Sample 2 the bioprocessed product contained 75.09% PS;

sample 3 the bioprocessed product contained 91.40% PS;

Sample 4. Raw materials contained 50% PS.

The foregoing examples are provided to fully disclose and describe how to make and use the claimed embodiments by those skilled in the art, and are not intended to limit the scope of the disclosure herein. Modifications that are obvious to a person skilled in the art will be within the scope of the appended claims.

Sequence listing

<110> University of ocean in China

<120> Aptamer of phosphatidylserine and application thereof

<141> 2021-11-17

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 12

<212> DNA

<213> Artificial Sequence

<400> 1

aaagacaaag ac 12

<210> 2

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 2

aaagacaaag acaaagac 18

<210> 3

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 3

ggcgggaaag acaaagaccc cgcc 24

<210> 4

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 4

ggcgggaaag acaaagacaa agaccccgcc 30

<210> 5

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 5

ggcgggaaag acaaagacaa agacaaagac cccgcc 36

<210> 6

<211> 42

<212> DNA

<213> Artificial Sequence

<400> 6

ggcgggaaag acaaagacaa agacaaagac aaagaccccg cc 42

<210> 7

<211> 8

<212> DNA

<213> Artificial Sequence

<400> 7

aaagacag 8

<210> 8

<211> 10

<212> DNA

<213> Artificial Sequence

<400> 8

aaagacagag 10

<210> 9

<211> 12

<212> DNA

<213> Artificial Sequence

<400> 9

aaagacagag ag 12

Claims

1. A phosphatidylserine aptamer characterized by the nucleotide sequence as follows:

PS-RKB2:5'-AAAGACAGAG-3' as shown in SEQ ID NO. 8.

2. Use of a phosphatidylserine aptamer according to claim 1 for the preparation of a detection probe, detection reagent, detection kit and/or sensor for detecting phosphatidylserine.

3. Use of a phosphatidylserine aptamer according to claim 1 for detecting and/or monitoring the bio-processing of phosphatidylserine.