CN114107297A

CN114107297A - MiRNA (micro ribonucleic acid) mimic and application thereof

Info

Publication number: CN114107297A
Application number: CN202111410269.3A
Authority: CN
Inventors: 任力; 孙晓敏; 宋文婧
Original assignee: South China University of Technology SCUT
Current assignee: South China University of Technology SCUT
Priority date: 2021-11-25
Filing date: 2021-11-25
Publication date: 2022-03-01

Abstract

The invention provides a miRNA (micro ribonucleic acid) mimic and application thereof, belonging to the technical field of regenerative medicine. The miRNA mimic is an miRNA24-3p mimic, and the nucleotide sequence of the miRNA mimic is shown in SEQ ID NO 1. The miRNA mimics promote corneal epithelial cell migration by up-regulating expression of cell migration related genes (CDC42, FRS2, CTGF, EGFR and MMP9) so as to accelerate epithelial wound healing, are good medicines suitable for corneal epithelial defect repair, and provide a new direction for clinical medicine transformation.

Description

MiRNA (micro ribonucleic acid) mimic and application thereof

Technical Field

The invention belongs to the technical field of regenerative medicine, and particularly relates to a miRNA mimic and application thereof.

Background

The corneal epithelium is positioned at the forefront of the eyeball and is directly exposed to the external environment, and the corneal epithelium defect can be caused by eye trauma, bacterial or viral infection, and the corneal epithelium defect causes the visual deterioration and even causes the formation of corneal nebula. Thus, the corneal epithelium is a tissue that we need to focus on protection. Normally, corneal epithelial defects can heal in 7-14 days after a latent period, a lag period, a migration period, a proliferation period and a re-epithelialization period, but recurrent corneal erosion can occur in trauma or certain malnutrition, easily causes damage to a basement membrane, can generate difficult healing and repeated epithelial defect phenomena, and even can cause corneal scarring to influence normal vision. This is mainly due to the fact that the surrounding epithelial cells secrete inflammatory and activating factors that lead to the production of stromal cell fibrosis. Current methods for the treatment of corneal epithelial defects are oral tetracycline, the use of topical steroids or autologous serum eye drops, and amniotic membrane repair or transplantation. Although these drug therapies show certain effects, they have problems of tolerance, side effects, low success rate of treatment, and the like. What is important is the amnion, which shows excellent treatment effect clinically, but the treatment mechanism is unknown, and the problem of easy carrying virus brings potential risk for clinical treatment. The healing of corneal epithelial lesions has been studied in a large body of literature, and great progress has been made in many different kinds of experimental animals and different methods of lesions, improving the quality of life of patients, but many cases of blindness and decreased quality of life due to the formation of corneal scars still occur. There is still a need for more effective drugs or other treatments to save tragedies from happening.

mirnas are a group of endogenous, non-protein-coding RNAs, about 20-22 nucleotides in length, whose primary function is to participate in the post-transcriptional regulation of genes. mirnas can bind to the 3' untranslated region (UTR) of their messenger RNAs (mRNA), causing inhibition of expression of the target mRNA at the protein level (incomplete complement match) or degradation of the target mRNA (complete complement match), regulating multiple signaling pathways by negatively regulating mRNA transcription post-inhibition and affecting gene expression. At present, the application of miRNA24-3p mimics in preparing medicines for promoting corneal epithelial wound healing is not found.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provide a miRNA mimic.

The second purpose of the invention is to provide the application of the miRNA mimics.

The purpose of the invention is realized by the following technical scheme:

a miRNA mimic is a miRNA24-3p mimic, and has a nucleotide sequence of TGGCTCAGTTCAGCAGGAACAG (SEQ ID NO: 1).

The nucleotide sequence of the forward primer for synthesizing the miRNA mimics is as follows: UGGCUCAGUUCAGCAGGAACAG (SEQ ID NO:2), the nucleotide sequence of the reverse primer for synthesizing the miRNA mimic is: CUGUUCCUGCUGAACUGAGCCA (SEQ ID NO: 3).

The miRNA mimic is applied to the preparation of a medicine for promoting wound healing.

The wound is preferably a corneal epithelial wound.

The miRNA mimics promote corneal epithelial cell migration by up-regulating expression of CDC42, FRS2, CTGF, EGFR and MMP9 genes, and further achieve the effect of promoting wound healing.

A medicament for promoting wound healing comprises the miRNA mimics serving as active ingredients, wherein the nucleotide sequence of the miRNA mimics is shown as SEQ ID NO: 1. The nucleotide sequence of the forward primer for synthesizing the miRNA mimics is as follows: UGGCUCAGUUCAGCAGGAACAG (SEQ ID NO:2), the nucleotide sequence of the reverse primer for synthesizing the miRNA mimic is: CUGUUCCUGCUGAACUGAGCCA (SEQ ID NO: 3).

A method for preparing a medicament for promoting wound healing by using miRNA mimics comprises the following steps: mixing the miRNA24-3p simulant with exosome and buffer solution to obtain mixed solution, and carrying out transfection and centrifugation to obtain the drug for promoting wound healing.

In the method for preparing the medicine for promoting wound healing by using the miRNA mimics, the concentration of the miRNA mimics in the mixed solution is preferably 0.5-0.7 mu mol/L; more preferably 0.625. mu. mol/L.

In the method for preparing the drug for promoting wound healing by using the miRNA mimics, the concentration of the exosome in the mixed solution is preferably 0.05-0.07 g/L; more preferably 0.0625 g/L.

The exosome is preferably an adipose mesenchymal stem cell-derived exosome.

The buffer solution is preferably PBS buffer solution; more preferably a buffer at pH 7.4.

The transfection is preferably carried out by electroporation.

Compared with the prior art, the invention has the following advantages and effects:

(1) the invention provides a miRNA (micro ribonucleic acid) mimic, which can up-regulate the expression of cell migration related genes (CDC42, FRS2, CTGF, EGFR (epidermal growth factor receptor) and MMP9), promote the migration of corneal epithelial cells and further accelerate the healing of epithelial wounds, is a better medicament suitable for repairing corneal epithelial defects, and provides a new direction for clinical medicament transformation.

(2) The miRNA24-3p simulant has an obvious promotion effect on corneal epithelial cell migration in vitro, can also accelerate corneal re-epithelization in vivo, and has extremely high commercialization potential and transformation application prospect in corneal epithelial wound healing.

Drawings

Fig. 1 is a graph of loss of adipose mesenchymal stem cells.

Fig. 2 is a transmission electron microscope image of the adipose-derived exosomes of the mesenchymal stem cell obtained in example 1.

FIG. 3 is a graph showing the results of migration of rabbit corneal epithelial cells transfected with miRNA24-3p mimic.

FIG. 4 is a graph showing chemotaxis results of rabbit corneal epithelial cells transfected with miRNA24-3p mimic.

FIG. 5 is a graph showing the result of miRNA24-3p transfection on the regulation of rabbit corneal epithelial cell migration-related gene expression.

Fig. 6 is a graph of the healing effect of engineered exosomes and adipose-derived exosomes on corneal epithelium over different times.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.

Example 1:

(1) selecting fat mesenchymal stem cells from a New Zealand white rabbit (purchased from Guangdong province medical experiment animal center) inguinal subcutaneous adipose tissue source for isolated culture and passage

a) New Zealand white rabbits were sacrificed by the Anle method, subcutaneous adipose tissues of the groin of the rabbits were taken under aseptic conditions, and were treated with 4 ℃ pre-cooled PBS buffer (pH 7.4) containing diabase (penicillin-streptomycin, 10000U/mL), purchased from Gibco Corp, the same below; ) Repeatedly washing for 3 times;

b) using an ophthalmic scissors and an ophthalmic forceps to remove fascia and blood vessels, washing 3 times by using precooled PBS (phosphate buffer solution), taking fat globules, gently transferring the fat globules into a sterile plate, adding 2 times of 1% collagenase II (purchased from SIGMA (phosphate buffer solution) in volume dissolved in the PBS, placing the plate in an incubator at 37 ℃, taking out the plate every 10min, and gently shaking the plate, wherein the total digestion time is 120 min;

c) transferring the digested content in the plate into a 50mL centrifuge tube, adding DMEM/F12 culture medium (purchased from Gibco, USA) containing 10% FBS in equal volume, centrifuging at 1000r/min for 5min, discarding the upper fat, collecting the lower suspension with a 100-mesh cell filter sieve, centrifuging again at 1500r/min for 10min, and collecting the lower precipitate;

d) adding the lower layer precipitate into fresh DMEM/F12 medium containing 10% FBS for resuspension, and inoculating to 25cm²In a culture flask of (1), placed at 37 ℃ and 5% CO₂Culturing in a constant temperature incubator to obtain adipose mesenchymal stem cells;

e) the adipose-derived mesenchymal stem cells were identified by a cell flow cytometer to determine the quality of adipose-derived mesenchymal stem cells, as shown in fig. 1.

(2) Extraction and preparation of exosome derived from adipose-derived mesenchymal stem cells

a) When the adipose-derived mesenchymal stem cells obtained in the step (1) overgrow 50% of the cell culture bottle, changing a DMEM/F12 culture medium containing 10% of FBS (non-exosome) to culture, and collecting the supernatant of the adipose-derived mesenchymal stem cells every 2 days;

b) centrifuging the 240mL supernatant at 4 ℃ for 10min at 300 Xg to remove cells; centrifuging at 4 deg.C and 3000 Xg for 10min to remove dead cells; centrifuging at 4 deg.C and 10000 Xg for 30min to remove cell debris; ultracentrifuging at 4 deg.C for 70min at 100000 Xg to obtain exosome precipitate; adding 6mL of PBS buffer solution, performing ultracentrifugation at 4 ℃, 100000 Xg for 70min, discarding the supernatant, adding 100 mu L of PBS buffer solution, and performing heavy suspension to obtain the exosome (the result of a transmission electron microscope is shown in figure 2) derived from the purified adipose-derived mesenchymal stem cell, wherein the final concentration of the exosome derived from the adipose-derived mesenchymal stem cell can be 300-500 mu g/mL; the concentration of adipose-derived exosomes of this example was 400 μ g/mL.

Example 2:

performing second-generation sequencing on the extracted exosome derived from the adipose-derived mesenchymal stem cell, the rabbit corneal epithelial cell and the rabbit adipose-derived mesenchymal stem cell (sequencing is completed by Guangzhou Huayinkang medical group GmbH). Then analyzing and screening the data according to the principle that the selected miRNA is expressed and the adipose tissue-derived mesenchymal stem cells are highly expressed, and finally screening 1 miRNA and synthesizing a double-stranded miRNA analogue (namely miRNA24-3p analogue) for functional experiments; wherein the content of the first and second substances,

the nucleotide sequence of the miRNA24-3p mimic is as follows: TGGCTCAGTTCAGCAGGAACAG (SEQ ID NO: 1);

miRNA24-3p mimetics:

a forward primer: UGGCUCAGUUCAGCAGGAACAG (SEQ ID NO: 2);

reverse primer: CUGUUCCUGCUGAACUGAGCCA (SEQ ID NO: 3).

Example 3:

according to Lipofectamine^TMRNAiMAX transfection reagent (available from Invitrogen) instructions for transfection of rabbit corneal epithelial cells, i.e.: inoculating 0.25-1X 10⁶Rabbit corneal epithelial cells (purchased from northern biol) were plated in 6-well plates and incubated for 4 hours; ② 9 mu L of Lipofectamine^TMRNAimax transfection reagent was added to 150. mu.L

Uniformly mixing a culture medium (purchased from Saimer Feishale science and technology (China) Co., Ltd.) to obtain a mixed solution 1; ③ simultaneously taking 30pmol of miRNA24-3p simulant of example 2 and adding 150 uL

Uniformly mixing the culture medium to obtain a mixed solution 2; fourthly, fully mixing the mixed solution 1 obtained in the step III with the mixed solution 2 obtained in the step III according to the volume ratio of 1:1, and standing and incubating for 5 minutes at room temperature to obtain a mixed solution 3; fifthly, adding 250 mu L of the mixed solution 3 obtained in the step (iv) into the 6-well plate obtained in the step (iv), adding 1mL of complete culture medium, and placing the complete culture medium in an incubator with 5% CO₂The rabbit corneal epithelial cells transfected with miRNA24-3p mimics (miRNA 24-3p group) are obtained after 1-3 days of incubation at 37 ℃. Replacing miRNA24-3p simulant with miRNA simulant negative control (namely miRNA NC provided by Guangzhou Aiji Biotechnology Co., Ltd.) to perform the above test to obtain rabbit corneal epithelial cells of a negative control group;

the forward primers for the miRNA mimic negative control were:

UCACAACCUCCUAGAAAGAGUAGA；

the reverse primers for the miRNA mimic negative control were:

UCUACUCUUUCUAGGAGGUUGUGA。

using PBS buffer as solvent, mixing 1 × 10⁶Preparing rabbit corneal epithelial cells of a negative control group and rabbit corneal epithelial cells transfected with miRNA24-3p mimics into rabbit corneal epithelial cell suspensions of the negative control group and rabbit corneal epithelial cell suspensions transfected with miRNA24-3p mimics respectively, and mixing the rabbit corneal epithelial cell suspensions of the negative control group and the rabbit corneal epithelial cell suspensions transfected with miRNA24-3p mimics according to the proportion of 3 multiplied by 10⁵Each cell/well was seeded in 2 inserts (ibidi, of Germany) and 70. mu.L of complete medium was added to each well, incubated for 24 hours in a carbon dioxide incubator, the 2 inserts were gently removed and then gently rinsed with PBS buffer in order to wash off excess and dead cells. After removal of the 2-insert, the medium was changed to serum-free medium. Rabbit corneal epithelial cell migration was observed at each of the 0 day, 1 day, 3 day, and 5 day time points and photographed.

The results are shown in fig. 3, and it can be seen from fig. 3 that the migration of rabbit corneal epithelial cells transfected with miRNA24-3p mimic is more significant compared to the rabbit corneal epithelial cells of the negative control group; the miRNA24-3p mimics can obviously promote the migration of rabbit corneal epithelial cells and accelerate the closure of corneal epithelial wounds. On the fifth day, wound closure of corneal epithelial cells treated with miRNA24-3p mimic may reach around 50%.

Example 4:

the rabbit corneal epithelial cells of the negative control group and the rabbit corneal epithelial cells transfected with the miRNA24-3p mimic of example 3 were digested with 0.25% pancreatin, the digestion was terminated with complete medium, and after centrifugation, the rabbit corneal epithelial cells were resuspended in serum-free medium and counted to obtain rabbit corneal epithelial cell suspensions transfected with the miRNA mimic negative control (i.e., miRNA NC) and rabbit corneal epithelial cell suspensions transfected with the miRNA24-3p mimic. The Transwell chamber was filled with a solution containing 2X 10 molecules⁴Rabbit corneal epithelial cell suspension transfected with miRNA mimic negative control (namely miRNA NC) and rabbit corneal epithelial cell suspension transfected with miRNA24-3p mimic; respectively adding 200 mu L of serum-free culture medium; complete medium 500. mu.L was added to 24-well plates. The cells were gently placed into a 24-well plate to avoid air bubbles. After 12 hours of incubation in a carbon dioxide incubator, the inside and outside of the chamber were washed with PBS buffer to ensure serum-free residue. The cell was placed in a 24-well plate containing 0.1% crystal violet and stained for 30 minutes at room temperature. The chamber was removed, carefully wiped off with a cotton swab to remove rabbit corneal epithelial cells, and then rinsed several times with PBS buffer. The chamber was placed on a cover glass and observed under a microscope and photographed, then counted using imageJ and analyzed, and finally a cell chemotaxis map was obtained.

The results are shown in FIG. 4, from which it can be seen that the number of rabbit corneal epithelial cells transfected with the miRNA24-3p mimic passed through the chamber was significantly greater than the rabbit corneal epithelial cells transfected with the miRNA mimic negative control (i.e., miRNA NC), indicating that the rabbit corneal epithelial cells transfected with the miRNA24-3p mimic are more chemotactic.

Example 5:

rabbit corneal epithelial cells transfected with miRNA24-3p mimic of example 3 were placed in complete medium at 5% CO₂The cell culture chamber (2) was incubated at 37 ℃ for 1 day. The supernatant was aspirated off, and the collected rabbit corneal epithelial cells transfected with miRNA24-3p mimic were tested for RNA extractionTotal RNA was extracted from a Kit (HiPure Total RNA Micro Kit, available from McTokame, Beijing) and the concentration and purity of the extracted RNA were determined using Nanodrop. After the RNA concentration and purity reached the standard, the extracted mRNA was reverse-transcribed into cDNA using a reverse transcription Kit (PrimeScript RT reagent Kit, available from Baozi medical technology, Beijing, Ltd.). The reverse transcriptase program was set as follows: system 1: keeping the temperature at 42 ℃ for 2min → 4 ℃; system 2: 15min at 37 ℃ → 5s at 85 ℃ → 4 ℃. A reaction system is prepared according to a PCR kit (All-in-OneTM qPCR Mix, purchased from Guangzhou multifunctional Gene Co., Ltd.), and a PCR plate is placed into a PCR instrument to start reaction for about 1.5 h. The internal reference gene used in the PCR amplification reaction is a beta-Actin gene. Meanwhile, the normal rabbit corneal epithelial cells are used as a blank control (Ctr) group, and the rabbit corneal epithelial cells transfected with the miRNA24-3p mimics are replaced by the rabbit corneal epithelial cells of the negative control group obtained in the example 3 (namely, the miRNA-NC group). The primers used in the PCR amplification reaction are shown in Table 1.

Table 1:

after the reaction was complete, the data were processed using LightCycler 96SW 1.1 software associated with the instrument. Calculated by the 2- Δ Ct method.

The obtained data are processed to obtain a figure 5, namely an expression diagram of rabbit corneal epithelial cell migration related genes (CDC42, FRS2, CTGF, EGFR and MMP9) transfected with miRNA24-3p mimics.

As can be seen from fig. 5, the miRNA24-3p mimetics up-regulate the expression of rabbit corneal epithelial cell-associated genes (CDC42, FRS2, CTGF, EGFR, and MMP9 genes) compared to the blank control group (normal rabbit corneal epithelial cells) or the miRNA-NC group, thereby accelerating rapid healing of corneal epithelium.

Example 6:

in order to allow the synthesized miRNA24-3p mimic to successfully enter a target cell, the miRNA24-3p mimic is transferred into the adipose mesenchymal stem cell-derived exosome prepared in example 1 in an electroporation mode, and then the exosome is acted on an animal experiment. The method specifically comprises the following steps: add 50. mu.L adipose mesenchymal stem cell-derived exosomes (400. mu.g/mL) into a sterile 2mL centrifuge tube, then add 0.2nmol miRNA24-3p mimic (100. mu.M) diluted with EDPC water (ex Invitrogen) into the upper centrifuge tube and mix well; PBS buffer was added to the upper centrifuge tube to make a total volume of 320. mu.L. After 10 minutes of standing, electroporation was performed using a Neon transfection device (Invitrogen, MPK5000, USA). The electrotransfer conditions were: 0.5kV, 10ms, 5 pulses. The electroporated mixture was centrifuged in an ultracentrifuge (Beckman, optima XPN-100, USA) to remove free miRNA24-3p mimic, the engineered exosome (Exos-miRAN24-3p) obtained. Resuspend with PBS buffer to a concentration of 20. mu.g/mL of engineered exosomes.

New Zealand white rabbits (single body weight: 2.2-2.7 kg) were randomly divided into 3 groups, namely a PBS buffer group (3), an adipose-derived mesenchymal stem cell-derived exosome (Exos) group (3) and an engineered exosome (Exos-miRAN24-3p) group (3). The rabbit corneal epithelium wound model comprises the following specific steps:

injecting 0.4mL of fast-sleep New II injection (SANDA ANIMAL MEDICINE, Town, Jilin province) via cervical subcutaneous injection to induce anesthesia; then using a 1mL syringe to extract 2 percent of the currently prepared pentobarbital solution, and slowly injecting 1mL of the solution through the ear edge vein; observing the respiratory reaction of the rabbit, injecting 1mL of 2% pentobarbital solution into the muscle after 5 minutes, slightly massaging local muscle tissue after injection, and promoting the absorption of the drug, wherein the dosage of the anesthetic is only suitable for 2.2-2.7 kg of New Zealand white rabbits;

after general anesthesia, placing on an operating table, locally using proparacaine hydrochloride eye drops for surface anesthesia, using povidone iodine to disinfect hair and eyelids around eyes, using physiological saline to wash conjunctival sac, disinfecting and paving a sterile towel, and selecting a proper eyelid retractor for eyelid opening;

the corneal epithelium is scraped off under a surgical microscope using a spatula after marking on the cornea of the surgical eye using a corneal trephine of 10mm diameter. Injecting PBS buffer solution (200. mu.L), adipose-derived exosome suspension (200. mu.L, 20. mu.g/mL) and engineered exosome suspension (200. mu.L, 20. mu.g/mL) under conjunctiva respectively; wherein, the solvents of the adipose tissue mesenchymal stem cell-derived exosome suspension and the engineered exosome suspension are PBS buffer solution.

Corneal epithelial closure was followed and photographed within 7 days using sodium fluorescein staining.

The results are shown in fig. 6, and show that at day 2, the adipose mesenchymal stem cell-derived exosome (Exos) group and the engineered exosome (Exos-miRAN24-3p) group both have a better effect on corneal epithelial healing, but the engineered exosome is more effective, mainly because the miRAN24-3p mimetic can promote corneal epithelial cell migration, thereby accelerating corneal epithelial healing. At day 3, the engineered exosome (Exos-miRAN24-3p) group had been completely re-epithelialized, while the adipose mesenchymal stem cell-derived exosome (Exos) group still had a small range of non-re-epithelialization. Compared with the PBS buffer group, the adipose mesenchymal stem cell-derived exosome (Exos) group and the engineered exosome (Exos-miRAN24-3p) group consistently had an excellent effect within 7 days.

The exosome concentration of the adipose-derived mesenchymal stem cell prepared in the embodiment 1 is controllable, and the miRNA24-3p mimic can enter rabbit corneal epithelial cells through a transfection reagent, and then the expression of rabbit corneal epithelial cell related genes (CDC42, FRS2, CTGF, EGFR and MMP9) is regulated, so that the rapid migration of the corneal epithelial cells is accelerated. In an in vivo animal experiment, the miRNA24-3p simulant enters a target cell (rabbit corneal epithelial cell) through the entrapment of an exosome derived from adipose-derived mesenchymal stem cells, and acts on the rabbit corneal epithelial cell to promote the migration of the corneal epithelial cell, so that the aim of promoting the healing of the corneal epithelium is fulfilled. The experimental results of the PBS buffer solution group and the adipose mesenchymal stem cell-derived exosome (Exos) group of example 6 are combined, which indicates that the screened miRNA24-3p mimetic not only has a significant promoting effect on corneal epithelial cell migration in vitro, but also can accelerate corneal re-epithelialization in vivo. The miRNA mimic (miRAN 24-3p mimic) capable of accelerating corneal epithelial cell migration is screened for the first time, and has extremely high commercialization potential and transformation application prospect in corneal epithelial wound healing.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> university of southern China's science

<120> miRNA mimics and application thereof

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> miRNA mimetic nucleotide sequences

<400> 1

tggctcagtt cagcaggaac ag 22

<210> 2

<211> 22

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<223> Forward primer of miRNA mimetics

<400> 2

uggcucaguu cagcaggaac ag 22

<210> 3

<211> 22

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<223> reverse primer of miRNA mimetics

<400> 3

cuguuccugc ugaacugagc ca 22

<210> 4

<211> 24

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<223> forward primer of miRNA mimic negative control

<400> 4

ucacaaccuc cuagaaagag uaga 24

<210> 5

<211> 24

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<223> reverse primer of miRNA mimic negative control

<400> 5

ucuacucuuu cuaggagguu guga 24

<210> 6

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<223> sense chain of beta-actin gene

<400> 6

tggctctaac agtccgccta g 21

<210> 7

<211> 19

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<223> beta-actin gene antisense chain

<400> 7

agtgcgacgt ggacatccg 19

<210> 8

<211> 22

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<223> sense chain of CTGF Gene

<400> 8

ccaaccatga tgcgagccaa ct 22

<210> 9

<211> 25

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<223> CTGF Gene antisense chain

<400> 9

aatgttctct tccaggtcag cttcg 25

<210> 10

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<223> CDC42 Gene sense chain

<400> 10

aagtgggtgc ctgagataac 20

<210> 11

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<223> CDC42 gene antisense strand

<400> 11

cttgacagcc ttcagatcac 20

<210> 12

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<223> sense strand of FRS2 Gene

<400> 12

gtcaaatggc actacctctg 20

<210> 13

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<223> FRS2 Gene antisense strand

<400> 13

gcacgggcac acttaaaggc 20

<210> 14

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<223> sense chain of EGFR Gene

<400> 14

cacttcctga gcctgcagag 20

<210> 15

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<223> EGFR Gene antisense chain

<400> 15

cggatgattt gcaggctctc 20

<210> 16

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<223> sense strand of MMP9 gene

<400> 16

gcgagtttcc gttcatcttc 20

<210> 17

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<223> MMP9 gene antisense strand

<400> 17

ctttgcccag gaagacgaag 20

Claims

1. A miRNA mimic is a miRNA24-3p mimic, and is characterized in that the nucleotide sequence of the miRNA mimic is shown in SEQ ID NO 1.

2. The miRNA mimic of claim 1, wherein the nucleotide sequence of the forward primer used to synthesize the miRNA mimic of claim 1 is shown in SEQ ID NO. 2, and the nucleotide sequence of the reverse primer used to synthesize the miRNA mimic is shown in SEQ ID NO. 3.

3. Use of a miRNA mimic according to claim 1 or 2 in the manufacture of a medicament for promoting wound healing.

4. The use of claim 3, wherein the wound is a corneal epithelial wound.

5. A medicine for promoting wound healing is characterized by comprising a miRNA mimic with a nucleotide sequence shown as SEQ ID NO 1; the nucleotide sequence of the forward primer for synthesizing the miRNA mimic is shown as SEQ ID NO. 2, and the nucleotide sequence of the reverse primer for synthesizing the miRNA mimic is shown as SEQ ID NO. 3.

6. The process for preparing a medicament for promoting wound healing according to claim 5, comprising the steps of: mixing the miRNA24-3p simulant with exosome and buffer solution to obtain mixed solution, and carrying out transfection and centrifugation to obtain the drug for promoting wound healing.

7. The method according to claim 6, wherein the concentration of the miRNA mimic in the mixture is 0.5-0.7 μmol/L.

8. The method according to claim 6, wherein the concentration of the exosome in the mixed solution is 0.5-0.7 g/L.

9. The method according to claim 6, wherein the exosome is an adipose-derived exosome derived from a mesenchymal stem cell.

10. The method of claim 6, wherein the buffer is PBS buffer.