CN110772536B - Application of FOXM1 gene inhibitor in treatment of osteoarthritis by mesenchymal stem cells - Google Patents

Application of FOXM1 gene inhibitor in treatment of osteoarthritis by mesenchymal stem cells Download PDF

Info

Publication number
CN110772536B
CN110772536B CN201910854257.6A CN201910854257A CN110772536B CN 110772536 B CN110772536 B CN 110772536B CN 201910854257 A CN201910854257 A CN 201910854257A CN 110772536 B CN110772536 B CN 110772536B
Authority
CN
China
Prior art keywords
osteoarthritis
mesenchymal stem
stem cells
foxm1
treatment
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910854257.6A
Other languages
Chinese (zh)
Other versions
CN110772536A (en
Inventor
蔡卫斌
李沅隆
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sun Yat Sen University
Original Assignee
Sun Yat Sen University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sun Yat Sen University filed Critical Sun Yat Sen University
Priority to CN201910854257.6A priority Critical patent/CN110772536B/en
Publication of CN110772536A publication Critical patent/CN110772536A/en
Application granted granted Critical
Publication of CN110772536B publication Critical patent/CN110772536B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0663—Bone marrow mesenchymal stem cells (BM-MSC)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2509/00—Methods for the dissociation of cells, e.g. specific use of enzymes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/10—Musculoskeletal or connective tissue disorders
    • G01N2800/105—Osteoarthritis, e.g. cartilage alteration, hypertrophy of bone

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biotechnology (AREA)
  • Public Health (AREA)
  • Zoology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Molecular Biology (AREA)
  • Cell Biology (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • Developmental Biology & Embryology (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Rheumatology (AREA)
  • Epidemiology (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Urology & Nephrology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Pain & Pain Management (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Biophysics (AREA)

Abstract

The invention discloses an application of FOXM1 gene inhibitor in bone marrow mesenchymal stem cell treatment of osteoarthritis. The invention firstly determines the effect of FOXM1 in the treatment of osteoarthritis by using the mesenchymal stem cells, accelerates the differentiation of chondrocytes after FOXM1 is inhibited, has good anti-inflammatory effect, can effectively enhance the curative effect of the mesenchymal stem cells on the treatment of osteoarthritis, and provides a new basic scientific research idea and clinical feasibility for improving the curative effect of the mesenchymal stem cells on the treatment of osteoarthritis at limited stem cell concentration. Therefore, it can be used as a drug target or a target gene in gene therapy to develop a novel drug or biological agent. The preparation is expected to improve the curative effect of the bone marrow mesenchymal stem cells on treating osteoarthritis and reduce the side effect of the bone marrow mesenchymal stem cells. And simultaneously, new strategies and directions are provided for basic research and clinical application of FOXM1 in osteoarthritis.

Description

Application of FOXM1 gene inhibitor in treatment of osteoarthritis by mesenchymal stem cells
Technical Field
The invention relates to the technical field of biomedicine, in particular to application of a FOXM1 gene inhibitor in treatment of osteoarthritis by mesenchymal stem cells.
Background
Osteoarthritis is a disease of articular cartilage degeneration, is common in middle and old aged patients in China, and the occurrence of osteoarthritis seriously affects the life treatment of the middle and old aged patients in China, so that osteoarthritis is called immortal cancer. It is classified into primary and secondary osteoarthritis according to etiology, wherein the primary osteoarthritis has unknown etiology and may be related to factors such as occupational excessive consumption and obesity; secondary osteoarthritis is associated with trauma, inflammatory reactions, metabolic abnormalities and neurological deficits in young age. Clinically, the symptoms of pain, tenderness, swelling, joint deformation and the like are mainly presented, and the patient is usually only subjected to surgical joint replacement after the symptoms occur.
The bone marrow mesenchymal stem cells are a new idea for clinically treating osteoarthritis because of the pluripotency of the stem cells, namely, the stem cells have the effects of chondrogenesis, osteogenesis, anti-inflammation and the like. The mesenchymal stem cells are approved in batches at home and abroad to clinically treat osteoarthritis, but the molecular mechanism of treating osteoarthritis by the mesenchymal stem cells in basic research is not clear. Moreover, studies have found that the therapeutic effect of stem cells needs to be increased according to the condition of patients. However, increasing the stem cell concentration does not significantly enhance the therapeutic effect, and side reactions such as immunological rejection may occur. Therefore, it is imperative to find a method for enhancing the therapeutic effect of stem cells on osteoarthritis in the presence of a limited concentration of stem cells.
Forkhead Box M1(FOXM1) is a member of the Forkhead Box superfamily of transcription factors, is a transcription factor for regulating cell cycle and protein proliferation, and the research aiming at FOXM1 is mainly focused on the tumor field at present. It was found that FOXM1 is highly associated with stem cell self-renewal, stabilization and senescence, and can affect mesenchymal stem cell angiogenesis and bone function. However, whether FOXM1 participates in the bone marrow mesenchymal stem cell treatment of osteoarthritis has not been reported, and whether FOXM1 promotes cartilage neogenesis and differentiation has not been known.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provides application of an FOXM1 gene inhibitor in bone marrow mesenchymal stem cell treatment of osteoarthritis.
The first purpose of the invention is to provide a preparation method of bone marrow mesenchymal stem cells.
The second purpose of the invention is to provide the application of the mesenchymal stem cells in preparing the preparation for treating osteoarthritis.
The third purpose of the invention is to provide the application of the FOXM1 gene inhibitor and/or the FOXM1 protein inhibitor in the preparation of the medicine for treating osteoarthritis.
A fourth object of the present invention is to provide the use of FOXM1 gene inhibitor and/or FOXM1 protein inhibitor as an enhancer for the treatment of osteoarthritis in mesenchymal stem cells.
The fifth purpose of the invention is to provide the application of the FOXM1 gene and/or the FOXM1 protein in the target of screening the reinforcing agent of the curative effect of the mesenchymal stem cell for treating osteoarthritis.
A sixth object of the present invention is to provide the use of FOXM1 gene and/or FOXM1 protein as therapeutic targets for the treatment of osteoarthritis.
In order to achieve the purpose, the invention is realized by the following technical scheme:
the invention firstly determines the expression of FOXM1 gene and the function of the FOXM1 gene in bone marrow mesenchymal stem cells for treating osteoarthritis: 1. the bone marrow mesenchymal stem cells can be normally osteogenic, adipogenic and chondrogenic; 2. the bone marrow mesenchymal stem cells can effectively enhance the regeneration of articular cartilage after rabbit arthritis; 3. FOXM1 differential expression is found by extracting cartilage mRNA of the damaged part, and meanwhile, cartilage related genes and inflammation factor related genes are synchronously expressed; 4. interfering with FOXM1 siRNA in vitro finds that interfering with FOXM1 can effectively improve chondrocyte proliferation, chondrocyte division index and chondrocyte number; 5. the mRNA expression level of the inflammation-related factor is obviously reduced after FOXM1 is interfered.
Therefore, the extracted mesenchymal stem cells have reliable quality and can well promote cartilage repair after arthritis; FOXM1 was highly correlated with cartilage markers and was differentially expressed; FOXM1 was subjected to in vitro intervention, and it was found that chondrocytes were accelerated in differentiation and had good anti-inflammatory effects. Therefore, the interference of FOXM1 can effectively enhance the curative effect of bone mesenchymal stem cells on osteoarthritis, and provides a new basic scientific research idea and clinical feasibility for improving the curative effect of treating osteoarthritis at a limited stem cell concentration.
Therefore, the invention claims a preparation method of mesenchymal stem cells, which comprises the following steps:
s1, extracting bone marrow, washing with a serum-free IMDM culture medium, centrifuging and resuspending;
s2, fully mixing the solution with equal volume of Percoll solution, and centrifuging to absorb middle white powder floccules;
s3, washing by using a serum-free IMDM culture medium, and adding an IMDM culture medium containing 15% fetal calf serum for culture;
s4, after the cells are attached to the wall, performing first liquid change by using an IMDM culture medium containing 15% fetal calf serum, and then performing liquid change every 3 days by using an IMDM culture medium containing 10% fetal calf serum;
s5, the cells grow to fill the bottom of the bottle for subculture.
Preferably, patellar bone marrow is extracted.
The invention also claims the following:
application of mesenchymal stem cells in preparation of a preparation for treating osteoarthritis.
The application of the FOXM1 gene inhibitor and/or the FOXM1 protein inhibitor in preparing the medicament for treating osteoarthritis preferably further comprises pharmaceutically acceptable auxiliary materials.
Use of an FOXM1 gene inhibitor and/or an FOXM1 protein inhibitor as an enhancer for the treatment of osteoarthritis in mesenchymal stem cells.
The treatment of osteoarthritis is: one or more of increased proliferation, increased division index, increased cell count and decreased associated inflammatory factors of articular cartilage.
Preferably, the FOXM1 gene inhibitor is siRNA.
Preferably, the mesenchymal stem cell is a bone marrow mesenchymal stem cell.
More preferably, the mesenchymal stem cell is prepared by the preparation method.
Further, the invention also claims:
the FOXM1 gene and/or the FOXM1 protein are/is applied to the target point of screening the reinforcing agent for the curative effect of the mesenchymal stem cells on treating the osteoarthritis;
use of the FOXM1 gene and/or FOXM1 protein as therapeutic targets for the treatment of osteoarthritis.
Compared with the prior art, the invention has the following beneficial effects:
the invention firstly determines the effect of FOXM1 in the treatment of osteoarthritis by using the mesenchymal stem cells, accelerates the differentiation of chondrocytes after FOXM1 is inhibited, has good anti-inflammatory effect, can effectively enhance the curative effect of the mesenchymal stem cells on the treatment of osteoarthritis, and provides a new basic scientific research idea and clinical feasibility for improving the curative effect of the mesenchymal stem cells on the treatment of osteoarthritis at limited stem cell concentration. Therefore, it can be used as a drug target or a target gene in gene therapy to develop a novel drug or biological agent. The preparation is expected to improve the curative effect of the bone marrow mesenchymal stem cells on treating osteoarthritis and reduce the side effect of the bone marrow mesenchymal stem cells. And simultaneously, new strategies and directions are provided for basic research and clinical application of FOXM1 in osteoarthritis.
Drawings
Fig. 1 is a graph showing a bright field of mesenchymal stem cells, chondrogenic, osteogenic, and adipogenic pictures in this order from left to right.
FIG. 2 is a graph of the efficacy of mesenchymal stem cells in the treatment of osteoarthritis; a is an ALCT model CT detection picture; b is an ACLT model ink dyeing detection picture; and C is a gross detection picture of the CI model.
FIG. 3 shows the expression of key factors of osteoarthritis.
FIG. 4 is a graph of FOXM1 detected in rabbit primary chondrocytes in relation to cartilage repair; a is fluorescence staining and statistical picture of chondrocyte Ki 67; b is a picture of the number change of chondrocytes along with time; c is a picture of division index of chondrocytes.
FIG. 5 shows the Q-PCR assay of the expression of inflammatory factors associated with osteoarthritis after FOXM1 drying; graph A shows the mRNA level of IL-6; panel B shows the mRNA level of TNF- α; graph C shows the mRNA level of IL-1; graph D shows IL-1. beta. content.
Detailed Description
The invention is described in further detail below with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.
Animal for experiment and breeding
The experimental white rabbit background is New Zealand white rabbit, and is provided by Experimental animals center in Guangdong province. The experimental animals used in the invention are all raised in the disease model animal center of Zhongshan university. In the arthritis model manufacture, rabbits were both female in sex and both were 18 months old. During animal raising, the animals are fed with water freely, and are alternately illuminated every 12 hours at the temperature of 21 +/-2 ℃ and the humidity of 40-70 percent.
Example 1 extraction of bone marrow mesenchymal Stem cells from New Zealand white rabbits
First, experiment method
Extracting the bone marrow mesenchymal stem cells of the white rabbit: under aseptic conditions, 5ml of bone marrow of ilium of New Zealand white rabbits aged 4 weeks or less and weighing about 0.5kg was collected. Washing the obtained product in a centrifuge tube with serum-free IMDM, washing the surface of the obtained product with serum-free IMDM (the amount is about 4ml) to obtain a final volume of about 15ml, centrifuging for 1000r/min 5min, discarding the supernatant, resuspending with 3ml of serum-free IMDM, adding into another centrifuge tube containing 3ml of Percoll solution, mixing the two tubes of solution by blowing, centrifuging for 1000r/min 30 min, sucking the intermediate white floccule (only milky mononuclear cell layer), washing with serum-free IMDM for 2 times, centrifuging for 1000r/min10min with 10ml of solution each time, discarding the supernatant, adding 15ml of IMDM of 15% fetal calf serum, and inoculating to 25cm2Plastic culture bottles. The cells were cultured at 1X 106Inoculating at 25 cm/ml2Placing in a plastic culture bottle at 37 deg.C and 5% CO2And culturing under saturated humidity condition, wherein the cells can be seen to adhere to the wall in 24h, at the moment, the culture solution is changed for the first time (the culture solution is IMDM of 15% fetal calf serum), and then the culture solution is changed for 1 time every 3d (the culture solution is IMDM of 10% fetal calf serum). About 7d of cells were grown to fill the bottom of the flask, and at this time, subculture was performed, and after the subculture was performed for 5min by digestion with 0.25% trypsin, digestion of fetal bovine serum was stopped, and subculture was repeated for proliferation in this manner.
Inducing the extracted bone mesenchymal stem cells of the white rabbit by using an osteogenic induction culture medium (Seiko corporation) for 3 weeks, and staining the cells by using alizarin red; after 3 weeks of induction with chondrogenic medium (Seiko Co.), staining with Alisine blue; after 3 weeks of induction with adipogenic medium (Seiko), staining was performed with oil red O.
Second, experimental results
Alizarin red staining proves that the stem cells have good osteogenic capacity; the Alisine blue staining proves that the stem cells have good chondrogenic capacity; oil red O staining demonstrated that stem cells had good adipogenic capacity. The result is shown in figure 1, and the extracted rabbit bone marrow mesenchymal stem cells have good differentiation capacity and can be used for the next application test.
Example 2 therapeutic effects of mesenchymal Stem cells on osteoarthritis treatment
First, experiment method
1. Construction mode of animal arthritis model modeling
Two-leg osteoarthritis models were made using 18-month-old female New Zealand white rabbits, for a total of 25. The osteoarthritis model is a classic anterior and posterior cruciate ligament excision model (ACLT) which is relatively consistent with the course of osteoarthritis, and 20 models are adopted; then, an osteoarthritis model, i.e., articular cartilage drilling model (CI), which allows easier observation of cartilage repair, was used, and 5 of these models were used. In both models, propofol is used for inducing anesthesia, then isoflurane is used for maintaining anesthesia, and lidocaine is used for local anesthesia during skin cutting, so that smooth operation is guaranteed, and animal ethics is maintained. Then, molding of ACLT and CI is performed respectively.
ACLT: the skin is incised and the muscle is stripped outside the knee joint, the anterior cruciate ligament is found under direct vision, the posterior cruciate ligament is found after the incision, and the posterior cruciate ligament is cut. The joint cavity was flushed with saline and sutured.
CI: cutting connective tissues into a joint cavity with ACLT, observing a non-bearing area near the inner and outer condyles of the femur under direct vision, vertically drilling holes by using a drill bit with the diameter of 5mm, and paying attention to only drill the cartilage side without damaging bone substances, namely, without bleeding.
After the model building operation, the joint is bandaged, braked and changed with medicine, and the conventional antibiotics support 7 days.
2. Injection therapy of stem cells
After 8 weeks of molding operation, observe rabbit articular deformation and painful circumstances to CT detects, the molding animal that accords with the arthritis condition carries out stem cell joint chamber injection: the left leg of the rabbit is injected with stem cell articular cavity (stem cell treatment group), the right leg is injected with PBS without stem cells (simple injury group), and the injection amount of the stem cells is as follows: 3X 106Perml, 1ml was injected. The injection was performed once again under the same conditions 4 weeks after the injection, and the animals were further raised for 4 weeks.
3. Taking materials and detecting
After 8 weeks of bone marrow mesenchymal stem cells for treating osteoarthritis (4 weeks after the first injection and 4 weeks after the second injection), performing CT detection on knee joint articular surface scanning, and observing conditions such as bone defect and deformity (only an ACLT model); after CT scan, the rabbits were sacrificed by air embolism and the knee joint was removed.
The ACLT model was obtained by immersing the joint surface in ink for 2 minutes (5) after sampling, then taking out and washing 3 times in PBS (one pass for 5 minutes), and finally taking a picture in the open field (ink staining is the method). Namely, the part with the residual ink is a damaged area which is not repaired; in order to observe the repair condition of the cartilage more obviously, CI model detection is carried out, and the CI model only needs to carry out bright field shooting on the articular surface.
Second, experimental results
The results show that in the arthritis model, CT scanning of the right knee joint of a rabbit injected with PBS (phosphate buffered saline) into the joint cavity has the conditions of fuzzy structure, osteophyte generation on two sides of the joint, change of joint force lines, large amount of bone defects on the joint surface and the like. In the ACLT ink staining of fig. 2, the black stained area (i.e., the damaged area) was reduced in the stem cell treatment group compared to the damaged group alone. In the CI model, the damaged area of the stem cell-treated group was covered with a white layer of regenerated cartilage, compared to the damaged group, which was not. Lateral observation of the CI model revealed that no significant osteophyte formation was observed on either side of the joint in the BMSC group compared to the CI group. The result shows that the bone marrow mesenchymal stem cells can effectively promote cartilage repair of osteoarthritis.
Example 3 detection of key factors in the treatment of osteoarthritis by mesenchymal stem cells
First, experiment method
After 8 weeks of first injection of stem cell articular cavity (stem cell treatment group and simple injury group), articular surface chondrocytes (15 total) are taken, and the extraction method comprises the following steps: taking the osteoarthritis model, taking the white rabbit successfully, taking the knee joint after the air embolism is killed, soaking the knee joint with active iodine or 75% alcohol, and taking the knee joint into a super clean bench. Opening the disposable dressing bowl or nursing bag, spreading the sterile towel in a super clean bench, and putting into a sterile instrument. Aseptically opening the joint capsule, clamping the femoral head cartilage cap by a hemostatic forceps, cleaning with sterile saline, and placing in a sterile ampere bottle. The ophthalmic scissors cut the cartilage, then digest the cartilage for 6-12 h with more than 10 times of 0.5% collagenase type 2, centrifugate and can obtain cells, if there is tissue block, do not influence the cell culture, because the inside of tissue block will climb out the cell too.
After the articular surface chondrocyte mRNA was extracted, the expression of FOXM1 gene and the like in the stem cell treatment group and the simple injury group was analyzed.
Second, experimental results
The results are shown in fig. 3, in which FOXM1 gene was differentially expressed in the injury group and the treatment group, and cartilage-related gene was negatively expressed with FOXM1, inflammatory factor was positively expressed therewith, and finally negatively expressed with cell cycle-related factor. The results suggest that FOXM1 may be involved in inflammatory response, cell cycle and cartilage repair in the treatment of arthritis by mesenchymal stem cells.
Example 4 detection of FOXM1 in Rabbit primary chondrocytes in relation to cartilage repair
First, experiment method
The primary chondrocytes prepared in example 3 were co-cultured with the bone marrow mesenchymal stem cells prepared in example 1 at a cell ratio of about 5: 1. then FOXM1-siRNA (Sata, sc-43769) is used for intervention and inhibition, the specific operation mode is carried out according to the product instruction, the successful intervention group is an interference group, and the non-interference group is a control group.
EUD is a thymidine analog that is efficiently inserted into replicating DNA molecules, i.e., expressed on the nucleus, during cell proliferation. Thus, EDU staining can effectively and rapidly detect cell proliferation, i.e., can effectively detect the percentage of cells in S phase.
Ki67 staining was performed after 3 washes with PBS in the control group 24 hours after the interference group had been added siRNA. Placing the stained cells on a cell proliferation machine, and observing the proliferation condition of the cells along with the change of time; culturing another part of cells by coverslipping method, stably culturing for 24 hr, treating with colchicine for 1 hr (i.e. inhibiting mitosis of the cells at this time with colchicine, fixing cell division activity), and counting the number of onion root tip-like cells (i.e. mitotic phase cells) in 1000 cells, and finally expressing in percentage; after the two groups of cells were cultured stably for 24 hours, the cells were counted by a cell counter.
Second, experimental results
The results in FIG. 4 show that the number of chondrocyte proliferated cells in the interfering group was significantly increased compared to the cells in the control group, and the total number of chondrocytes was also significantly increased. This shows that after the FOXM1 gene is knocked out, the number of chondrocytes after bone marrow mesenchymal stem cells treat osteoarthritis can be obviously increased, i.e. interfering with FOXM1 can effectively assist bone marrow mesenchymal stem cells to treat osteoarthritis.
Example 5 expression of inflammation-related factor in the treatment of osteoarthritis by inhibitor of FOXM1 Gene in combination with mesenchymal Stem cells
First, experiment method
As in example 4, two groups of cells were cultured for 24 hours following the procedure of example 4, with siRNA (Sata, sc-43769) intervention, and then chondrocyte RNA was extracted. And performing Q-PCR detection to detect inflammation related factors.
In detail, total RNA was extracted from both groups of cells using an RNA extraction kit (Biyuntian). And after the RNA purity and the total RNA integrity are detected to be qualified, carrying out reverse transcription. After reverse transcription, 15. mu.l of reaction solution was prepared, diluted 20 times with pure water and shaken on the machine, and the results were examined.
The primer information involved is as follows:
IL-6，F：GAAGAGCGCCGCTGAGAAT，R：GTGCAGAGGGTTTAATGTCAACT；TNF-α：F：GGATCTCAAAGACAACCAAC，R：ACAGAGCAATGACTCCAAAG；IL-1：F：GAGCCCCAAAAGCAAGAGGAA，R：TGCGGGCATACGGTTTCATC；IL-1β：F：CCTTGTGCAAGTGTCTGAAGC，R：CCCAAGTCAAGGGCTTGGAA；
second, experimental results
The Q-PCR results showed that osteoarthritis-associated inflammatory factors: IL-6, IL-1 beta and IL-1 are all reduced, the difference has statistical significance, and TNF-alpha also has obvious reduction trend. This indicates that the level of inflammatory response of primary chondrocytes was reduced after interfering with FOXM1, indicating that inhibitors of FOXM1 gene synergize with mesenchymal stem cells of bone marrow to treat osteoarthritis and because FOXM1 gene intervenes in the inflammatory response locally in the joint.

Claims (1)

  1. Use of an FOXM1 gene inhibitor and/or an FOXM1 protein inhibitor as an enhancer for the treatment of osteoarthritis in mesenchymal stem cells, characterized in that the FOXM1 gene inhibitor and/or the FOXM1 protein inhibitor is an siRNA; the treatment of osteoarthritis is: proliferation of articular cartilage is increased, and one or more of inflammatory factors IL-1 beta and IL-1 are reduced; the medicament is an enhancer in the treatment of osteoarthritis by mesenchymal stem cells; the mesenchymal stem cells are bone marrow mesenchymal stem cells.
CN201910854257.6A 2019-09-10 2019-09-10 Application of FOXM1 gene inhibitor in treatment of osteoarthritis by mesenchymal stem cells Active CN110772536B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910854257.6A CN110772536B (en) 2019-09-10 2019-09-10 Application of FOXM1 gene inhibitor in treatment of osteoarthritis by mesenchymal stem cells

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910854257.6A CN110772536B (en) 2019-09-10 2019-09-10 Application of FOXM1 gene inhibitor in treatment of osteoarthritis by mesenchymal stem cells

Publications (2)

Publication Number Publication Date
CN110772536A CN110772536A (en) 2020-02-11
CN110772536B true CN110772536B (en) 2021-12-21

Family

ID=69383431

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910854257.6A Active CN110772536B (en) 2019-09-10 2019-09-10 Application of FOXM1 gene inhibitor in treatment of osteoarthritis by mesenchymal stem cells

Country Status (1)

Country Link
CN (1) CN110772536B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104958320A (en) * 2015-07-29 2015-10-07 西安芙金细胞科技有限公司 Cell preparation for treating osteoarthritis and preparation method thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104958320A (en) * 2015-07-29 2015-10-07 西安芙金细胞科技有限公司 Cell preparation for treating osteoarthritis and preparation method thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Knockdown of FOXM1 attenuates inflammatory response in human osteoarthritis chondrocytes;ZENG,R.M.等;《International Immunopharmacology》;20190104;摘要，第75页第2.4节 *
ZENG,R.M.等.Knockdown of FOXM1 attenuates inflammatory response in human osteoarthritis chondrocytes.《International Immunopharmacology》.2019,摘要，第75页第2.4节. *
骨髓间充质干细胞的分离培养与鉴定;胡彬 等;《中国组织工程研究与临床康复》;20110702;第15卷(第27期);第5109-5110跨页段 *

Also Published As

Publication number Publication date
CN110772536A (en) 2020-02-11

Similar Documents

Publication Publication Date Title
JP6577038B2 (en) Composition for inducing differentiation into chondrocytes containing exosomes derived from stem cells differentiated into chondrocytes or for regeneration of cartilage tissue
Wang et al. Extracellular matrix derived from allogenic decellularized bone marrow mesenchymal stem cell sheets for the reconstruction of osteochondral defects in rabbits
CN104958320A (en) Cell preparation for treating osteoarthritis and preparation method thereof
CN110237095A (en) For treating stem cell injection liquid and its preparation and the application of cartilage defect of osteoarthritis
CN108865986B (en) Mesenchymal stem cell preparation for repairing articular cartilage damage/defect and preparation method and application thereof
JP6993026B2 (en) Regenerative therapeutic composition
CN111849882A (en) Mesenchymal stem cell exosome and preparation method and application thereof
Fu et al. Tetrahedral framework nucleic acids promote the biological functions and related mechanism of synovium-derived mesenchymal stem cells and show improved articular cartilage regeneration activity in situ
RU2347579C1 (en) Method for production of cell culture for treatment of vascular demyelinating diseases of nervous system and cell culture produced by this method (versions)
Shan et al. An injectable nucleus pulposus cell-modified decellularized scaffold: biocompatible material for prevention of disc degeneration
Dang et al. Human Chondrocytes from Human Adipose Tissue‐Derived Mesenchymal Stem Cells Seeded on a Dermal‐Derived Collagen Matrix Sheet: Our Preliminary Results for a Ready to Go Biotechnological Cartilage Graft in Clinical Practice
CN110935010A (en) Stem cell preparation, growth factor composition, preparation method and application thereof
CN113846064A (en) FGF18 gene modified mesenchymal stem cell and preparation method and application thereof
Gültekin et al. Comparison of mesenchymal stem cell sheets and chondrocyte sheets in a rabbit growth plate injury model
CN111297901B (en) Preparation method and application of autologous fat glue and mesenchymal stem cells derived from autologous fat glue
KR20210040908A (en) Method of Preparing Pellets of Chondrocytes differentiated from human induced pluripotent stem cell and use of the same
CN106333965B (en) A kind of preparation that treating Osteoarthritis and treatment method
CN110772536B (en) Application of FOXM1 gene inhibitor in treatment of osteoarthritis by mesenchymal stem cells
CN115381856A (en) Application of adipose-derived mesenchymal stem cells in preparation of medicine or preparation for treating knee osteoarthritis
JP6958847B1 (en) Method for producing synovial membrane-derived mesenchymal stem cells and method for producing cell preparation for joint treatment
US20220331369A1 (en) Stem Cells Derived from Villi Adjacent to Chorionic Plate, and Tissue Regeneration Cellular Therapeutic Agent Comprising Same
KR20210067988A (en) Method for producing spheroid using matrilin-3 primed stem cells, and an substance for treating cartilage disease obtained thereof
US20230048106A1 (en) Composition for regenerating growth plate
Sadat-Ali et al. Autologous Bone Marrow-Derived Chondrocytes for Patients with Knee Osteoarthritis: A Randomized Controlled Trial
CN109939095B (en) Application of methyl stearate

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant