CN114107254A - Recombinant protein DspB-SNa5, and preparation method and application thereof - Google Patents
Recombinant protein DspB-SNa5, and preparation method and application thereof Download PDFInfo
- Publication number
- CN114107254A CN114107254A CN202111336749.XA CN202111336749A CN114107254A CN 114107254 A CN114107254 A CN 114107254A CN 202111336749 A CN202111336749 A CN 202111336749A CN 114107254 A CN114107254 A CN 114107254A
- Authority
- CN
- China
- Prior art keywords
- dspb
- sna5
- recombinant protein
- seconds
- follows
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/02—Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/02—Local antiseptics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/31—Fusion polypeptide fusions, other than Fc, for prolonged plasma life, e.g. albumin
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Biotechnology (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Animal Behavior & Ethology (AREA)
- Communicable Diseases (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Oncology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a recombinant protein DspB-SNa5 and a preparation method and application thereof, wherein a primer is firstly designed to carry out reverse PCR on a plasmid pET28a [ DspB ], and then the plasmid pET-28a [ DspB-SNa5] is constructed through digestion and purification, and after a competent cell is transformed, the recombinant protein DspB-SNa5 is obtained through induced expression. The recombinant protein can be expressed in large quantity, is easy to separate and extract, has better protein activity and simple construction method. The protein can degrade formed biomembranes, can slow down the mineralization process of brushite to hydroxyapatite, is expected to play a role from both organic and inorganic aspects, and is used for inhibiting the formation of dental calculus in the dental field.
Description
Technical Field
The invention relates to the fields of molecular biotechnology and mineralization, in particular to a recombinant protein DspB-SNa5, and a preparation method and application thereof.
Background
beta-N-acetylglucosaminidase DspB (Dispersing B, DspB) is a Glycoside hydrolase of the G20 (G20) family consisting of 361 amino acid residues with 8 beta/alpha-sheet domains with a relative molecular mass of 90 Kda. Functionally, DspB can specifically hydrolyze the beta- (1, 6) glycosidic bond of poly beta- (1, 6) -N acetyl D glucosamine (Polymeric beta-1, 6-N-acetyl-D-glucosamine, PNAG), which is a biofilm component of most pathogenic bacteria, so that DspB can effectively disperse and degrade polysaccharide components in the biofilm to change the bacterial community from the aggregated biological community to free cells.
The environment in the oral cavity can be kept stable all the time, generally, the deposition or crystallization of calcium phosphate salt is not formed, and the action of the casein is acted to a great extent. SNa5 is a polypeptide sequence of N-terminal casein-rich protein (rich in acidic residue: Asp-pSer-pSer-Glu-Glu), and can bind to free Ca due to high negative charge2+Or the surface of early calcium phosphate nuclei. 1 aspartic acid, 2 ortho phosphorylated serine and 2 glutamic acid residues, are important functional segments for inhibiting phosphate precipitation (DpSEE), and phosphorylated serines (positions 2 and 3) are replaced by aspartic acid (DDDEE), eliminating the need for post-translational modification and still maintaining calcium affinity.
The dental calculus consists of inorganic components and organic matrix, wherein the inorganic component is mainly calcium phosphate. The calcium phosphate phase is mainly brushite and hydroxyapatite. The maturation of the calcium phosphate phase in dental calculus is not uniform but gradually changes over time, tending to be kinetically favourable, i.e. brushite is gradually mineralized to hydroxyapatite. The closer to the teeth, the Ca/P of the calcium phosphate phase increases, with marked differences in old and new calculus, such as darker color, increased hardness, and increased adhesion to the tooth surface. The organic matrix comprises dental plaque biomembranes, and due to the flow of saliva, the dental plaque biomembranes capture a large amount of bacteria, proteins, food residues and mineral salts from the oral cavity, and due to microbial metabolism and other reasons, inorganic minerals start to deposit in a slightly alkaline environment, and after dental calculus is formed, a new biomembrane is deposited on the surface of the dental calculus again, so that the dental calculus is further mineralized and gradually increased. The existing physical method has short action duration and cannot achieve the expected clearing effect of certain parts; chemical methods can have adverse effects on teeth, such as staining and hypersensitivity.
Disclosure of Invention
The invention aims to provide a recombinant protein DspB-SNa5, and a preparation method and application thereof.
In order to achieve the purpose, the invention adopts the technical scheme that:
provides a preparation method of a recombinant protein DspB-SNa5, which comprises the following steps:
(a) firstly, designing a primer to carry out reverse PCR on a plasmid pET28a [ DspB ];
(b) digesting and purifying the product obtained in the step (a) to construct a recombinant plasmid pET-28a [ DspB-SNa5 ];
(c) after the recombinant plasmid pET-28a [ DspB-SNa5] transforms competent cells, the recombinant protein DspB-SNa5 is obtained after IPTG induction expression, purification and ultrafiltration.
According to the scheme, the step (a) is specifically as follows: the primers for the reverse PCR of plasmid pET28a [ DspB ] were SNa 5F 1, 5'-GATGAAGAAGATGATGATGAAGAACACCACCACCACCACCACTG-3', SNa 5R 1 and 5'-CATCATCATCTTCTTCATCATCATCTTTTTCAAACTGCGGATGGGACCACATC-3'.
According to the scheme, the reverse PCR conditions in the step (a) are as follows: the first stage is as follows: pre-denaturation at 99 ℃ for 3 min; and a second stage: denaturation at 99 ℃ for 30 seconds, annealing at 65 ℃ for 30 seconds, extension at 68 ℃ for 6 minutes and 90 seconds, 9 cycles, and decreasing annealing temperature by 1 ℃ per cycle; and a third stage: denaturation at 99 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, extension at 68 ℃ for 6 min 90 seconds, 9 cycles; a fourth stage: extension at 68 ℃ for 10 minutes.
According to the scheme, the digestion process in the step (b) is as follows: adding 3.9 mu l of Dpn I buffer and 1 mu l of Dpn I into the vector system after the reverse PCR, and digesting for 1h at 33 ℃; the purification process is carried out according to a PCR product purification digestion kit to obtain a recombinant plasmid pET-28a [ DspB-SNa5 ].
According to the scheme, the specific process in the step (c) is as follows: carrying out amplification culture on overnight bacterial liquid containing recombinant plasmid pET-28a [ DspB-SNa5] until OD600 is 0.9-0.8, carrying out IPTG induced expression culture, centrifugally collecting bacterial precipitates, then adding cell lysate for resuspension, carrying out ultrasonic cell disruption, separating supernatant, purifying and ultrafiltering to obtain recombinant protein DspB-SNa5
According to the scheme, the inducer is as follows: IPTG, final concentration of 0.2mmol/L, culture conditions: incubation at 33 ℃ for 3h, centrifugation conditions: 6000g, centrifugation at 9 ℃ for 10min, cell lysate: 20mM Tris, 300mM NaCl, pH 8.
According to the scheme, the inoculation ratio in the amplification culture is 1: 50.
according to the scheme, the ultrasonic cell disruption method comprises the following steps: the cell disruption solution was centrifuged at 9 ℃ for 20min at 10000 g.
According to the scheme, the purification ultrafiltration is as follows: the supernatant was purified by Ni-NTA agarose resin, washed with PB solution (sodium phosphate buffer) at pH 6, and ultrafiltered with a 30kDa ultrafiltration tube to obtain the recombinant protein DspB-SNa 5. The invention also aims to provide application of the recombinant protein DspB-SNa5 prepared according to the method in degradation of biological membranes.
According to the scheme, the application is as follows: adding recombinant protein DspB-SNa5 liquid into a biomembrane system formed by culturing bacillus subtilis, staphylococcus aureus or pseudomonas aeruginosa, treating for 1h at 33 ℃, and degrading the biomembrane.
The third purpose of the invention is to provide an application of the recombinant protein DspB-SNa5 in inhibiting mineralization of a calcium phosphate phase and further inhibiting generation of hydroxyapatite.
Specifically, free Ca was bound using the highly negatively charged property of SNa52+Or early calcium phosphate crystal nucleus surface, interfering with hydroxyapatite formation. The specific application process is as follows: the recombinant protein DspB-SNa5 was added to the mineralization System (100mM Ca (NO)3)2，60mMmol/L NH9H2PO9pH 3), simulated saliva (289mM Na)+，10mM K+，5mM Ca2+，3mM Mg2+，8.9mM HCO3 -，295.6mM Cl-，2mM HPO9 2-，1mM SO9 2-pH 3) can effectively slow down the mineralization process of the calcium phosphate phase.
The invention combines the activity of DspB (gene coding for DspB) expressed dispase DspB to degrade biomembranes and the highly negative property of SNa5 (gene coding for calcium phosphate binding polypeptide DDDEEDDDEE) expressed polypeptide sequence SNa5, and can degrade the formed biomembranes. The invention further provides application of the recombinant protein DspB-SNa5 obtained by the method in preparation of medicines for degrading dental plaque and inhibiting dental calculus. The dental plaque-inhibiting agent can degrade dental plaque and inhibit dental calculus by degrading dental plaque biomembranes and slowing down the mineralization process of brushite to hydroxyapatite. Specifically, the recombinant protein DspB-SNa5 of the invention can break beta- (1, 6) glycosidic bonds between biomembrane matrixes based on the existence of DspB, and degrade the formed biomembrane; at the same time, free Ca can be bound based on the existence of SNa52+Or the surface of the early calcium phosphate crystal nucleus inhibits the mineralization process of the calcium phosphate phase to a certain extent.
Compared with the prior art, the beneficial effects of the invention are embodied in the following aspects:
firstly, the recombinant protein DspB-SNa5 has simple construction method, can express a large amount of protein in a short time, has simple separation and extraction method, and is easy to obtain high-concentration protein.
Secondly, the protein DspB-SNa5 can effectively degrade a biological membrane and inhibit the mineralization process of a calcium phosphate phase based on DspB dispase characteristic and high negative charge characteristic of SNa5, and is expected to be used in the dental field to inhibit the formation of dental calculus.
Drawings
FIG. 1 shows the schematic diagram (a) of the recombinant plasmid pET-28a [ DspB-SNa5] of the present invention and the DspB-SNa5 fragment (b), the process (c) of extracting the recombinant protein DspB-SNa5 and the electrophoresis diagram (d) of the ultrafiltration result.
FIG. 2 is a graph of the results of the determination of the biofilm degradation efficiency of Bacillus subtilis, Staphylococcus aureus and Pseudomonas aeruginosa by the recombinant protein DspB-SNa5 prepared in the examples, together with SEM images (before (A1) and after (A2) the treatment of Bacillus subtilis, before (A1) and after (A2) the treatment of Staphylococcus aureus, before (A1) and after (A2) the treatment of Pseudomonas aeruginosa, respectively).
FIG. 3 is an XRD and SEM detection picture of the recombinant protein DspB-SNa5 added into a mineralization system and simulated saliva.
Detailed Description
In order to make those skilled in the art fully understand the technical solutions and advantages of the present invention, the following embodiments are further described.
Example 1
(1) Construction of recombinant plasmid pET-28a [ DspB-SNa5]
The plasmid pET28a [ DspB ] was subjected to inverse PCR according to the conventional molecular biology procedures, and the reaction system is shown in the following table:
TABLE 1 inverse PCR System
SNa5 gene sequence: CTACTACTACTTCTTCTACTACTACTTCTT, designing amplification primers:
SNa 5F 1 is
5’-GATGAAGAAGATGATGATGAAGAACACCACCACCACCACCACTG-3’，
SNa 5R 1 is
5'-CATCATCATCTTCTTCATCATCATCTTTTTCAAACTGCGGATGGGACCACATC-3' are provided. The PCR reaction conditions are as follows: the first stage is as follows: pre-denaturation at 99 ℃ for 3 min; and a second stage: denaturation at 99 ℃ for 30 seconds, annealing at 65 ℃ for 30 seconds, extension at 68 ℃ for 6 minutes and 90 seconds, 9 cycles, and decreasing annealing temperature by 1 ℃ per cycle; and a third stage: denaturation at 99 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, extension at 68 ℃ for 6 min 90 seconds, 9 cycles; a fourth stage: extension at 68 ℃ for 10 minutes.
The vector product was purified and recovered, digested as in the system of Table 2, digested in a incubator at a constant temperature of 33 ℃ for 1 hour, and purified and recovered to obtain a recombinant plasmid pET-28a [ DspB-SNa5 ]. The target fragment DspB-SNa5 is 1193 bp.
TABLE 2 vector digestion System
Construction of engineering bacteria:
(2) extraction of recombinant protein DspB-SNa5
Transferring the recombinant plasmid into DH5 alpha competent cells, transferring the recombinant plasmid into a strain BL21 after the recombinant plasmid is correctly identified to obtain engineering bacteria, fermenting the engineering bacteria, and mixing overnight bacteria liquid according to the proportion of 1: 50 expansion culture to OD600After 0.9 to 0.8, IPTG was added to a final concentration of 0.2mmol/L, and the mixture was cultured at 33 ℃ for 3 hours, and then 6000g was centrifuged at 9 ℃ for 10 minutes, and the resultant bacterial pellet was resuspended in a lysate (20mM Tris, 300mM NaCl, pH 8), and the cells were disrupted by sonication. Centrifuging cell disruption solution at 9 deg.C for 20min at 10000g, and separating supernatant; and purifying the supernatant by Ni-NTA agarose resin, washing by using a PB solution with the pH value of 6, and performing ultrafiltration by using a 30kDa ultrafiltration tube to obtain the recombinant protein DspB-SNa 5.
FIG. 1a shows recombinant plasmid pET-28a [ DspB-SNa5 ]; FIG. 1b shows the obtained DspB-SNa5 fragment, indicated by the red arrow; FIG. 1c shows the purification of the supernatant in (2) by Ni-NTA agarose resin to extract the recombinant protein DspB-SNa5, lane 9-3, red arrow; d corresponds to the recombinant protein DspB-SNa5 obtained after ultrafiltration.
EXAMPLE 2 determination of the efficacy of the recombinant protein DspB-SNa5 in degrading biofilm
Experimental groups: bacillus subtilis, staphylococcus aureus and pseudomonas aeruginosa were mixed in a 29-well plate at a ratio of 1: 50 was inoculated into LB medium containing 1% maltose, mixed well and cultured at 33 ℃ for 3 days. After the culture, the biofilm adsorbed on the bottom of the 29-well plate was washed 3 times with PBS, 1mL of 1mg/mL recombinant protein DspB-SNa5 was added, and the mixture was treated at 33 ℃ for 1 hour and washed 3 times with PBS. Adding methanol for fixing for 15 min, air drying at room temperature, staining with 0.1% crystal violet for 10min, washing with PBS for 3 times, air drying, dissolving the biological membrane with 1ml 30% acetic acid, and determining A590。
Blank group: without any treatment, the biofilm residue was 100%.
Control group: PBS buffer solution is used for replacing the recombinant protein DspB-SNa5 solution.
In this embodiment, the left diagram in FIG. 2 is corresponding to A590(ii) a The right image is the corresponding SEM inspection image. It is shown that 1mL of 1mg/mL of recombinant protein is effective in degrading biofilms of Bacillus subtilis, Staphylococcus aureus and Pseudomonas aeruginosa.
(3) Determination of efficacy of recombinant protein DspB-SNa5 in slowing mineralization of brushite to hydroxyapatite
To 25mL mineralizing System (100mM Ca (NO)3)2，60mMmol/L NH9H2PO9pH 3) to 10mL of simulated saliva (289mM Na)+，10mM K+，5mM Ca2+，3mM Mg2+，8.9mM HCO3 -，295.6mM Cl-，2mM HPO9 2-，1mM SO9 2-pH 3), 1mL of 1mg/mL recombinant protein DspB-SNa5 was added, and the reaction was performed for 10min, 30min, and 60min, respectively, and then sampling and freeze-drying were performed for 5 hours, followed by characterization by XRD and SEM.
FIG. 3 is an XRD and SEM of the control group and the experimental group, and it can be seen that the brushite (D peak) of the control group is converted into hydroxyapatite in 10min, and is in a rough block shape under an electron microscope; the brushite (peak D) of the experimental group is not completely mineralized in 30min, and part of the brushite still exists, and the appearance is smooth and flaky as shown by red arrows. Thus, the recombinant protein DspB-SNa5 in this example was shown to slow the mineralization of brushite into hydroxyapatite.
In the examples, plasmid pET28a [ DspB ] was synthesized from plasmid pET28a and the DspB Gene by conventional biosynthetic methods, the DspB Gene sequence being available from Genbank or, for example, Gene ID:69285835, by synthetic methods such as: designing an amplification primer to amplify genes, carrying out enzyme digestion connection on the amplified fragment and a plasmid pET28a to obtain the gene, wherein the plasmid pET28a can be purchased from the market, and the primer can be synthesized by entrusted biological engineering (Shanghai) GmbH.
The above description is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, many modifications and changes can be made without departing from the inventive concept of the present invention, and these modifications and changes are within the protection scope of the present invention.
Claims (10)
1. A preparation method of a recombinant protein DspB-SNa5 is characterized in that: the method comprises the following steps:
(a) firstly, designing a primer to carry out reverse PCR on a plasmid pET28a [ DspB ];
(b) digesting and purifying the product obtained in the step (a) to construct a recombinant plasmid pET-28a [ DspB-SNa5 ];
(c) the recombinant plasmid pET-28a [ DspB-SNa5] is subjected to IPTG induction expression, purification and ultrafiltration to obtain the recombinant protein DspB-SNa 5.
2. The method of claim 1, wherein: the step (a) is specifically as follows: the primers for the reverse PCR of plasmid pET28a [ DspB ] were SNa 5F 1, 5'-GATGAAGAAGATGATGATGAAGAACACCACCACCACCACCACTG-3', SNa 5R 1 and 5'-CATCATCATCTTCTTCATCATCATCTTTTTCAAACTGCGGATGGGACCACATC-3'.
3. The method of claim 1, wherein: the inverse PCR conditions of step (a) are as follows: the first stage is as follows: pre-denaturation at 94 ℃ for 3 min; and a second stage: denaturation at 94 ℃ for 30 seconds, annealing at 65 ℃ for 30 seconds, extension at 68 ℃ for 6 min 40 seconds, 9 cycles, with the annealing temperature decreasing by 1 ℃ per cycle; and a third stage: denaturation at 94 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, extension at 68 ℃ for 6 min 40 seconds, 9 cycles; a fourth stage: extension at 68 ℃ for 10 minutes.
4. The method of claim 1, wherein: the digestion process of the step (b) is as follows: adding 3.4 mu l of Dpn I buffer and 1 mu l of Dpn I into the vector system after the reverse PCR, and digesting for 1h at 37 ℃; the purification process is carried out according to a PCR product purification digestion kit to obtain a recombinant plasmid pET-28a [ DspB-SNa5 ].
5. The method of claim 1, wherein: the specific process in the step (c) is as follows: and carrying out amplification culture on the overnight bacterial liquid containing the recombinant plasmid pET-28a [ DspB-SNa5] until OD600 is 0.4-0.8, carrying out IPTG induced expression culture, centrifugally collecting bacterial precipitates, then adding cell lysate for resuspension, carrying out ultrasonic cell disruption, separating supernatant, purifying and ultrafiltering to obtain the recombinant protein DspB-SNa 5.
6. The method of claim 5, wherein: the final concentration of the inducer IPTG is 0.2mmol/L, and the culture conditions are as follows: incubation at 37 ℃ for 3h, centrifugation conditions: 6000g, centrifugation at 4 ℃ for 10min, cell lysate: 20mM Tris, 300mM NaCl, pH 8.
7. The method of claim 5, wherein: the inoculation ratio in the expanded culture is 1: 50; the ultrasonic cell disruption method comprises the following steps: centrifuging cell disruption solution at 4 deg.C for 20min at 10000 g; the purification ultrafiltration comprises the following steps: and purifying the supernatant by Ni-NTA agarose resin, washing by using a PB solution with the pH value of 6, and performing ultrafiltration by using a 30kDa ultrafiltration tube to obtain the recombinant protein DspB-SNa 5.
8. The application of the recombinant protein DspB-SNa5 prepared by the preparation method according to claim 1 in degrading biological membranes.
9. Use according to claim 8, characterized in that: adding recombinant protein DspB-SNa5 liquid into a biomembrane system formed by culturing bacillus subtilis, staphylococcus aureus or pseudomonas aeruginosa, treating for 1h at 37 ℃, and degrading the biomembrane.
10. The application of the recombinant protein DspB-SNa5 prepared by the preparation method of claim 1 in inhibiting mineralization of calcium phosphate phase and further inhibiting generation of hydroxyapatite.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111336749.XA CN114107254A (en) | 2021-11-12 | 2021-11-12 | Recombinant protein DspB-SNa5, and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111336749.XA CN114107254A (en) | 2021-11-12 | 2021-11-12 | Recombinant protein DspB-SNa5, and preparation method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114107254A true CN114107254A (en) | 2022-03-01 |
Family
ID=80378906
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111336749.XA Pending CN114107254A (en) | 2021-11-12 | 2021-11-12 | Recombinant protein DspB-SNa5, and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114107254A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7132393B2 (en) * | 2005-02-28 | 2006-11-07 | Gene Tools. Llc | Transporter compositions and methods for detecting and killing cells in acidic areas of tumors |
| EP2108654A1 (en) * | 2008-04-07 | 2009-10-14 | Koninklijke Philips Electronics N.V. | Selective enrichment of n-terminally modified peptides from complex samples |
| US8785390B2 (en) * | 2009-01-30 | 2014-07-22 | Alphabeta Ab | Methods for treatment of Alzheimer's disease |
| CN110709093A (en) * | 2017-04-17 | 2020-01-17 | 加利福尼亚大学董事会 | Engineered bacteria and methods of use |
| US10660970B2 (en) * | 2013-07-30 | 2020-05-26 | Genevant Sciences Gmbh | Nucleic acid constructs and methods of using the same |
-
2021
- 2021-11-12 CN CN202111336749.XA patent/CN114107254A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7132393B2 (en) * | 2005-02-28 | 2006-11-07 | Gene Tools. Llc | Transporter compositions and methods for detecting and killing cells in acidic areas of tumors |
| EP2108654A1 (en) * | 2008-04-07 | 2009-10-14 | Koninklijke Philips Electronics N.V. | Selective enrichment of n-terminally modified peptides from complex samples |
| US8785390B2 (en) * | 2009-01-30 | 2014-07-22 | Alphabeta Ab | Methods for treatment of Alzheimer's disease |
| US10660970B2 (en) * | 2013-07-30 | 2020-05-26 | Genevant Sciences Gmbh | Nucleic acid constructs and methods of using the same |
| CN110709093A (en) * | 2017-04-17 | 2020-01-17 | 加利福尼亚大学董事会 | Engineered bacteria and methods of use |
Non-Patent Citations (1)
| Title |
|---|
| ZX LIU ET AL.: "Analysis of proteins that interact with nucleocapsid protein of SARS-CoV using 15-mer phage-displayed library", CHINESE SCIENCE BULLETIN, vol. 52, no. 15, pages 2072 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103436514B (en) | Heat-resistant lyase TSPpgh and polynucleotide coding same | |
| Abdul-Gani et al. | Purification and characterization of chondroitinase ABC from Proteus vulgaris, an Iraqi clinically isolate | |
| WO2005098014A1 (en) | Microbe method for producing valienamine and validamine | |
| CN113151050A (en) | Sphingomonas and application thereof | |
| CN114540252B (en) | Microbacterium P6 for converting livestock and poultry breeding waste and application | |
| CN114107254A (en) | Recombinant protein DspB-SNa5, and preparation method and application thereof | |
| CN107557314B (en) | Protease-producing strain LS20-2-2 and method for producing low-temperature protease by using same | |
| JPS6176420A (en) | Membrane polysaccharide and manufacture | |
| EP1740707A1 (en) | Enzyme and template-controlled synthesis of silica from non-organic silicon compounds as well as aminosilanes and silazanes and use thereof | |
| CN102040667B (en) | Method for biologically removing protein from sea cucumber polysaccharide | |
| JPH03175984A (en) | N-acyl-l-prolineacylase produced from microorganism, its acquisition, acquisition of l-proline, l-pipecolinic acid, l-thiazolidine-4-carboxylic acid and l-thiazolidine-2-carboxylic acid and preparation of n-acetyl- l-proline, n-propionyl-l-proline and n- butyryl-l-proline | |
| CN113025599B (en) | Recombinant clostridium histolyticum type I collagenase as well as preparation method and application thereof | |
| CN111295450A (en) | Polysaccharide purification for vaccine production using lytic enzymes, tangential flow filtration and multimodal chromatography | |
| CN111202940B (en) | Application of zearalenone lactone hydrolase RmZHD in degradation of macrolide antibiotics | |
| CN115029337A (en) | Additive compounded by keratinase mutant and eucommia ulmoides leaf extract and application thereof | |
| CZ2017537A3 (en) | The strain of Clostridium histolyticum, collagenase prepared using this strain and its use | |
| EP4028513A1 (en) | A new, non-specific thermolabile nuclease active at low temperature, in wide ph range and high concentration in salts | |
| JPS5939294A (en) | Preparation of optical active 2-amino-1-butanol | |
| CN116178521B (en) | Fish-source peptidoglycan recognition protein mutant, preparation method and application thereof | |
| CN1346407A (en) | Production of pancreatic procarboxy-peptidease B, isoforms and nuteins thereof, and their use | |
| CN100542602C (en) | A kind of preparation method of injection of hydrolyzed peptide of liver | |
| CN111424023B (en) | Blue algae engineering bacteria for producing amidase lysozyme and application thereof | |
| US7150985B2 (en) | Bacteriolytic complex, method for producing said complex and strain for carrying out said method | |
| CN112280774B (en) | Method for combined preparation of DNA sodium salt and antibacterial peptide | |
| CN114634891B (en) | Bacillus bailii ZH3 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |