CN114106140A - Expression specific STING isomer, cell line, preparation method and application - Google Patents

Abstract

The invention belongs to the technical field of biomedicine, and discloses an expression specific STING isomer, a cell line, a preparation method and application, wherein the STING isomer comprises ercsting and pmSTING, and Pre-mRNA transcribed by STING gene has two transcripts with different splicing modes; longer transcripts are translated into classical ones that localize to the endoplasmic reticulum; the shorter transcript, lacking the transmembrane region due to exon skipping, was translationally processed into pmSTING localized to the cytoplasmic membrane. The invention constructs a mouse and human cell line expressing a specific STING isomer for the first time, namely a B16 cell line only expressing erssting and pmSTING and an HEK293T cell line only expressing erssting and pmSTING, and lays a foundation for the research and development of novel small molecule immunotherapy medicaments taking STING as a target.

Description

Expression specific STING isomer, cell line, preparation method and application

Technical Field

The invention belongs to the technical field of biomedicine, and particularly relates to a cell line for expressing a specific STING isomer, a preparation method and application thereof.

Background

At present, interferon gene stimulating factors (STING) are novel protein molecules that play an important role in the natural immune response process and are widely expressed in immune cells and tumor cells.

STING is used as a main regulator of anti-tumor immune circulation, regulates and controls each link in the cancer immune whole circulation, and type I IFN generated by STING activation can promote the activation of various immune cells, increase antigen presenting capability and activate anti-tumor immune response. Activation of STING has been shown to be effective in a variety of cancers, STING agonist-related clinical trials have been as many as 20, and a series of high-level studies around STING in tumors, compelling in vivo and in vitro data, and pharmaceutical enormous-invested research and development leads suggest that STING has become a new target for small-molecule tumor immunity.

The conventional thinking that STING resides in endoplasmic reticulum, however, the inventors found for the first time that Pre-mRNA transcribed from STING gene has two transcripts with different splicing modes; longer transcripts are translated into classical ones that localize to the endoplasmic reticulum; the shorter transcript had the same 3' terminal sequence as the longer transcript and was translationally processed to pmSTING localization on the cytoplasmic membrane due to the lack of a transmembrane region for exon skipping. The two transcription molecules differ in their sequence and cellular location and may also have inconsistent functions in humans. However, in the course of research, it is necessary to exclude interference with the expression of one of the molecules in order to accurately search for the mechanism of action of the other molecule. However, the technology for preparing and expressing specific STING isomers in the prior art is not reported, and the technology creates a barrier for studying STING mechanisms and developing novel small molecule immunotherapy drugs taking STING as a target.

Through the above analysis, the problems and defects of the prior art are as follows: the prior art does not report the technology for preparing the expression specific STING isomer, and a cell model for pmSTING molecular mechanism research and drug development is lacked.

The difficulty in solving the above problems and defects is:

to solve the above-mentioned cell line construction and fill the gap in such cell line models, at least a thorough understanding of the field of basic medical research is needed, especially in terms of experimental design. Familiarity with STING molecules is also required for understanding their properties and expression. Meanwhile, strong experimental technology reserve and theoretical knowledge reserve are required, a proper primer can be searched and designed, and the corresponding technical process of the cell line can be constructed.

The significance of solving the problems and the defects is as follows:

the invention of a cell line expressing a specific STING isomer is beneficial to better clear different functions of STING molecules and related upstream and downstream molecules, so that drugs can be developed in a targeted manner in the future. For example, the inventors have discovered that pmSTING can be stimulated by extracellular cGAMP, inducing phosphorylation of TBK1, and that phosphorylated TBK1 further mediates IRF3 activation and promotes type I interferon expression using this cell line. The mechanism is helpful for understanding the pathogenesis of various diseases such as tumors, autoimmune diseases and the like, and corresponding targeted drugs are developed on the basis of the pathogenesis.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a cell line for expressing a specific STING isomer, a preparation method and application thereof.

The invention is realized by that, the STING isoforms include ercsting and pmSTING, the Pre-mRNA transcribed by STING gene has two transcripts with different splicing modes; longer transcripts are translated into classical ones that localize to the endoplasmic reticulum; shorter transcripts lack a transmembrane region due to exon skipping; the invention constructs mouse and human cell lines expressing only one kind of STING transcript, namely a B16 cell line expressing only erssting and only pmSTING and a HEK293T cell line expressing only erssting and only pmSTING.

The mouse erssting sequence is SEQ ID NO: and 5, as follows:

the mouse pmSTING sequence is SEQ ID NO: 6, showing:

the human erssting sequence is SEQ ID NO: 7, and:

the human pmSTING sequence is SEQ ID NO: 8, showing:

further, pmSTING has the same C-terminal domain as classical erssting; pmSTING was stimulated by extracellular cGAMP, inducing phosphorylation of TBK1, phosphorylated TBK1 further mediated IRF3 activation, promoting type I interferon expression.

It is an object of the present invention to provide a cell line expressing a specific STING isoform, said cell line comprising: b16 cell line expressing erssting and pmSTING and HEK293T cell line expressing erssting only and pmSTING only.

Another object of the present invention is to provide a method for preparing a cell line, comprising:

step one, culturing mouse splenocytes and separating and culturing human peripheral blood mononuclear cells PBMCs;

step two, synthesizing Open Reading Frames (ORFs) of human pmSTING and erssting by taking PBMCs cDNA as a template; synthesizing ORF of mouse pmSTING and ercSTING by using mouse splenocyte cDNA as template;

cloning the ORF of the synthesized alternative splicing isomer into a pcDNA3.1-GFP vector respectively to construct pmSTING-GFP and ersSTING-GFP fusion gene plasmids;

step four, the constructed fusion gene plasmid is transfected to pre-cultured B16^Tmem173-/-Cells and HEK293T cells, B16 cell line expressing only ercsting and only pmSTING was obtainedAnd HEK293T cell line expressing only erssting and expressing pmSTING.

Further, in the first step, the culturing of the mouse spleen cells comprises: using RPMI1640 medium containing 10% fetal bovine serum and 0.1% penicillin-streptomycin solution at 37 deg.C and 5% CO₂Mouse splenocytes were cultured under ambient conditions.

Further, in the first step, the separation of human peripheral blood mononuclear cells comprises:

firstly, human blood is obtained and diluted; adding the diluted blood into a test tube with 5mL of lymphocyte layering liquid at the bottom, and centrifuging for 10 minutes at 1500 g;

secondly, the intermediate layer containing PBMC was separated into a new tube and centrifuged at 1500g for 5 minutes; removing the supernatant;

then, the cell pellet was resuspended in 1mL of erythrocyte lysis buffer and lysed for 3 minutes at room temperature to remove erythrocytes;

finally, the supernatant is removed, the cell sediment is resuspended by PBS, and 1500g is centrifuged for 5 minutes, thus obtaining the separated PBMCs of the human peripheral blood mononuclear cells.

Further, the diluting comprises: diluted with 6mL sterile PBS.

Further, the culturing of human peripheral blood mononuclear cells comprises:

using RPMI1640 medium containing 10% fetal bovine serum and 0.1% penicillin-streptomycin solution at 37 deg.C and 5% CO₂Human PBMC cells were cultured under ambient conditions.

Further, in step four, the B16^Tmem173-/-The culturing of the cells comprises: placing in RPMI1640 medium containing 10% fetal calf serum and 0.1% penicillin-streptomycin solution at 37 deg.C and 5% CO₂Culturing under ambient conditions. The culture of the HEK293T cell comprises: placing in DMEM medium containing 10% fetal calf serum and 0.1% penicillin-streptomycin solution at 37 deg.C and 5% CO₂Culturing under ambient conditions.

Further, the primer for constructing the STING isomer fusion gene plasmid comprises:

the sequence of mouse Tmem173 cell primer is shown in SEQ ID NO: 1 is shown in the specification;

the sequence of the human TMEM173 cell primer is shown as SEQ ID NO: 2 is shown in the specification;

the sequence of the mouse Tmem 173-ORF cell primer is shown as SEQ ID NO: 3 is shown in the specification;

the sequence of the human TMEM 173-ORF cell primer is shown as SEQ ID NO: 4, respectively.

Further, the constructed fusion gene plasmid was transfected into previously cultured B16^Tmem173-/-The cell line expressing the specific STING isoforms, namely B16 cell line expressing only erssting and only pmSTING and HEK293T cell line expressing only erssting and only pmSTING, were obtained with HEK293T cells.

By combining all the technical schemes, the invention has the advantages and positive effects that: the invention establishes a cell line expressing a specific STING isomer by using a mode of expressing only one isomer for the first time, establishes a model for clarifying a STING molecule action mechanism, and lays a foundation for the research and development of novel micromolecule immunotherapy medicaments taking STING as a target point. Using the present invention, the inventors have discovered that pmSTING can be stimulated by extracellular cGAMP, inducing phosphorylation of TBK1, and that phosphorylated TBK1 further mediates the activation of IRF3, promoting the expression of type I interferon. The preparation of the cell line only expressing pmSTING and erssting is beneficial to clearer action of various molecules of STING, provides deeper understanding for the action of signal molecules such as cGAMP and the like as an neurotransmitter, is very helpful for understanding pathogenesis of various diseases such as tumors and autoimmune diseases, and provides a new idea for development of novel targeted therapeutic drugs.

Drawings

FIG. 1 is a flow chart of a method for preparing a cell line expressing a particular STING isoform according to an embodiment of the present invention.

FIG. 2 is a graph of immunoprecipitation provided by an embodiment of the invention.

FIG. 3 is an immunofluorescence provided by an embodiment of the invention.

FIG. 4 is a schematic representation of the activation of the pmSTING subtype by extracellular cGAMP as provided by an embodiment of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

In view of the problems of the prior art, the present invention provides a method for preparing a cell line expressing a specific STING isoform, and the present invention is described in detail below with reference to the accompanying drawings.

The STING isoforms of the invention include erssting and pmSTING, where the Pre-mRNA transcribed from the STING gene has two transcripts with different splicing modes; longer transcripts are translated into classical ones that localize to the endoplasmic reticulum; the shorter transcript has the same 3' terminal sequence as the longer transcript, and is translationally processed to pmSTING localized to the cytoplasmic membrane due to the lack of a transmembrane region for exon skipping;

the mouse erssting sequence is SEQ ID NO: 5 is shown in the specification;

the mouse pmSTING sequence is SEQ ID NO: 6 is shown in the specification;

the human erssting sequence is SEQ ID NO: 7 is shown in the specification;

the human pmSTING sequence is SEQ ID NO: shown in fig. 8.

As shown in fig. 1, the preparation method of the cell line expressing a specific STING isoform provided in the embodiments of the present invention comprises:

s101, culturing mouse splenocytes and separating and culturing human peripheral blood mononuclear cells PBMCs;

s102, synthesizing Open Reading Frames (ORFs) of human pmSTING and erssting by taking PBMCs cDNA as a template; synthesizing ORF of mouse pmSTING and ercSTING by using mouse splenocyte cDNA as template;

s103, cloning the ORFs of the synthesized alternative splicing isomers into pcDNA3.1-GFP vectors respectively, and constructing pmSTING-GFP and ersSTING-GFP fusion gene plasmids;

s104, transfecting the constructed fusion gene plasmid to pre-cultured B16^Tmem173-/-Cells and HEK293T cells, B16 cell line expressing only erssting and only pmSTING and HEK293T cell expressing only erssting and only pmSTING can be obtainedIs described.

The culture of the mouse splenocytes provided by the embodiment of the invention comprises the following steps: using RPMI1640 medium containing 10% fetal bovine serum and 0.1% penicillin-streptomycin solution at 37 deg.C and 5% CO₂Mouse splenocytes were cultured under ambient conditions.

The separation of human peripheral blood mononuclear cells provided by the embodiment of the invention comprises the following steps:

firstly, human blood is obtained and diluted by 6mL sterile PBS; adding the diluted blood into a test tube with 5mL of lymphocyte layering liquid at the bottom, and centrifuging for 10 minutes at 1500 g;

secondly, the intermediate layer containing PBMC was separated into a new tube and centrifuged at 1500g for 5 minutes; removing the supernatant;

then, the cell pellet was resuspended in 1mL of erythrocyte lysis buffer and lysed for 3 minutes at room temperature to remove erythrocytes;

finally, the supernatant is removed, the cell sediment is resuspended by PBS, and 1500g is centrifuged for 5 minutes, thus obtaining the separated PBMCs of the human peripheral blood mononuclear cells.

The culture of the human peripheral blood mononuclear cells provided by the embodiment of the invention comprises the following steps:

using RPMI1640 medium containing 10% fetal bovine serum and 0.1% penicillin-streptomycin solution at 37 deg.C and 5% CO₂Human PBMC cells were cultured under ambient conditions.

B16 provided by the embodiment of the invention^Tmem173-/-The culturing of the cells comprises: placing in RPMI1640 medium containing 10% fetal calf serum and 0.1% penicillin-streptomycin solution at 37 deg.C and 5% CO₂Culturing under ambient conditions. The culture of HEK293T cells included: placing in DMEM medium containing 10% fetal calf serum and 0.1% penicillin-streptomycin solution at 37 deg.C and 5% CO₂Culturing under ambient conditions.

The primer for constructing the plasmid of the STING isomer fusion gene provided by the embodiment of the invention comprises the following components:

the sequence of mouse Tmem173 cell primer is shown in SEQ ID NO: 1: gctgtgccatgtccagtc (forward), caaccgcaagtacccaat (reverse).

The sequence of the human TMEM173 cell primer is shown as SEQ ID NO: 2: tctcctcgtcatcatccag (forward), aggaggatgttcagtgcc (reverse).

The sequence of the mouse Tmem 173-ORF cell primer is shown as SEQ ID NO: 3: ggtaccctcttctgctccaggaacac (forward), gatatcgatgaggtcagtgcggagtgg (reverse).

The sequence of the human TMEM 173-ORF cell primer is shown as SEQ ID NO: 4: gtgtggatccagagcagccagtgtcc (forward), tctagaagagaaatccgtgcggagag (reverse).

The technical solution of the present invention is further described with reference to the following specific embodiments.

Example 1:

1.C57BL/6^Tmem173wt/wtmice were purchased from the animal center, second Hospital, Harbin medical university, C57BL6^Tmem173gt/gtMice were purchased from Jackson Laboratory. Taking C57BL/6^Tmem173wt/wtAnd C57BL6^Tmem173gt/gtFresh spleens of mice were gently crushed in sterile PBS using a syringe plunger, and splenocytes suspended in PBS were filtered through a filter (100 μm) and placed in a centrifuge and centrifuged at 1500g for 5 minutes. The supernatant was removed, the cell pellet resuspended in 1mL of red blood cell lysis buffer and lysed at room temperature for 3 minutes to remove the red blood cells. Placed in a centrifuge and centrifuged at 1500g for 5 minutes. And removing the supernatant, resuspending the cell precipitate with PBS, and centrifuging for 5 minutes under the condition of 1500g to obtain the successfully separated mouse splenocytes.

2. Blood from healthy volunteers was collected in 5mL EDTA anticoagulation tubes and diluted with 6mL sterile PBS. The diluted blood was then added to a tube with 5mL of lymphocyte layering solution at the bottom and centrifuged at 1500g for 10 minutes. After centrifugation, the solution in the tube was divided into three layers, the middle layer containing PBMC was separated into a new tube and centrifuged at 1500g for 5 minutes. The supernatant was removed, the cell pellet resuspended in 1mL of red blood cell lysis buffer and lysed at room temperature for 3 minutes to remove the red blood cells. The supernatant was removed, the cell pellet resuspended in PBS and centrifuged at 1500g for 5 minutes, i.e., human Peripheral Blood Mononuclear Cells (PBMCs) were successfully isolated.

3.B16-Blue^TMISG-KO-STING cell line was purchased from Invivogen, and B16 cell line was purchased from Shanghai Life sciences research institute cell resource center of Chinese academy of sciences, and was placed in a 10% containing fetusBovine serum and 0.1% penicillin-streptomycin solution in RPMI1640 medium. Mouse splenocytes and human PBMC cells were cultured in RPMI1640 medium containing 10% fetal bovine serum and 0.1% penicillin-streptomycin solution. All cells were cultured at 37 ℃, 5% CO2 ambient conditions. The HEK293T cell line was purchased from cell resource center of Shanghai Life sciences research institute of Chinese academy of sciences, and placed in DMEM medium containing 10% fetal calf serum and 0.1% penicillin-streptomycin solution at 37 deg.C and 5% CO₂Culturing under ambient conditions.

2. Open Reading Frames (ORFs) for mouse pmSTING and ersSTING were synthesized using mouse splenocyte cDNA as a template. The human pmSTING and erssting ORFs were synthesized using PBMCs cDNA as a template. The ORFs of these alternative splice isoforms were cloned into pcDNA3.1-GFP vectors, respectively, to construct pmSTING-GFP and ercSTING-GFP fusion gene plasmids. The primers used to construct the STING isoform fusion gene plasmid are shown in the table below.

3. The constructed fusion gene plasmid was transfected into B16^Tmem173-/-The cell and HEK293T cell, namely, a B16 cell line expressing only erssting and only pmSTING and a HEK293T cell line expressing only erssting and only pmSTING were prepared.

The technical solution of the present invention will be further described with reference to specific tests.

Immunoprecipitation, mouse splenocytes or human PBMC were incubated with 5. mu.g/mL primary antibody (rabbit anti-STING antibody (ab92605, Abcam), rabbit anti-GAPDH antibody (60004-1-Ig, Proteintech), rabbit IgG isotype antibody (A0418, Sigma-Aldrich, USA)) at 4 ℃ for 1 hour. 8000 rpm, centrifuged for 5 minutes and then lysed on ice for 10 minutes with RIPA buffer containing PMSF. The rabbit IgG antibody bound to the cell membrane was detected with a diluted (1: 2000) HRP-labeled secondary goat anti-rabbit antibody (SA00001-2, Proteintech).

Immunofluorescence, mouse splenocyte smears and human PBMCs smear specimens were fixed with 2% PFA for 5 minutes and then blocked with 1% BSA for 30 minutes. After washing 2 times with pre-cooled PBST, primary antibody mixture composed of rabbit anti-TMEM 173 antibody (ab92605, abcam, 1:200) and fluorescent labeled antibody (Biolegend) against cell surface markers of different immunocyte types was stained in the dark at 4 ℃ for 30 minutes. After the smear specimens were rinsed 3 times with PBST, they were stained with Alex Fluo 594-labeled goat anti-rabbit secondary antibody (Proteintetech, 1: 100) at room temperature for 1 hour in the dark, and the transfected cells were fixed with 4% PFA for 15 minutes and blocked with 1% BSA for 30 minutes. The cells were incubated overnight at 4 ℃ with primary anti-green fluorescent protein antibody (sc-8334, Santa Cruze, USA, 1: 200). Goat anti-rabbit secondary antibody (Proteintetech, 1: 100) labeled with Alex Fluo 594 was stained at room temperature for 1 hour in the dark and then DAPI (Solarbio) was used for 10 minutes at room temperature. Thereafter, PBST was rinsed and then blocked with blocking reagent (Sigma).

Successful construction of the B16 cell line expressing only the pmSTING with the C-terminal outward on the cell membrane was demonstrated by immunoprecipitation (FIG. 2) and immunofluorescence (FIG. 3).

The pmSTING subtype specifically recognizes extracellular cGAMP and stably expresses alkaline phosphatase B16^Tmem173-/-The pmSTING and erssting subtypes were ectopically expressed in cells to monitor interferon activity, respectively, and only the pmSTING subtype was found to be activated by extracellular cGAMP (fig. 4). The interferon activity was measured by culturing 6 hours after transfection in a serum-free medium with or without cGAMP (35. mu.M). After 8 hours of cGAMP treatment, 20. mu.L of B16-Blue was added^TMISG-KO-STING cell supernatant and 180. mu.L of alkaline phosphatase substrate (Invitgen) were placed in 96-well plates. Then, the plate was incubated at 37 ℃ for 5 hours. By using

And reading the absorbance at 630nm by using a double-grating multifunctional micropore plate reading machine. For HEK293T cells, 10 μ L of culture supernatant was mixed with the substrate fluorescein (Invitrogen) in 1.5mL EP tubes and detected with a GloMax 20/20 chemiluminescence detector. All assays were repeated 3 times.

The above description is only for the purpose of illustrating the present invention and the appended claims are not to be construed as limiting the scope of the invention, which is intended to cover all modifications, equivalents and improvements that are within the spirit and scope of the invention as defined by the appended claims.

<110> Harbin university of medicine

<120> expression specific STING isomer, cell line, preparation method and application

<160> 8

<170> Patentin vesion 3.3

<210> 1

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gctgtgccatgtccagtc

caaccgcaagtacccaat

<210>2

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tctcctcgtcatcatccag

aggaggatgttcagtgcc

<210>3

<211>53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggtaccctcttctgctccaggaacac

gatatcgatgaggtcagtgcggagtgg

<210>4

<211>52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtgtggatccagagcagccagtgtcc

tctagaagagaaatccgtgcggagag

<210> 5

<211> 2302

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

1 tgaaactatt aaattccttg ctcagatttc aggaagtaaa gtgtgctgtt catctcaatc

61 tctcctgtct aacccctccc ctcccgattt ccgggggatc aatgatagta gagagctttg

121 gggcctctgg aaatcctgtg gggccctgtc acttttggtc cttgtatgga gtcctgctag

181 gtgtccactg gagtgtgtta catctcggga cctttagagg aattcggagt gcggggctgt

241 ggctgctgtc tccccattca gaagccactt gctagtagct actgaaaggc tcttcattgt

301 ctcttctgct ccaggaacac cggtctagga agcagaagat gccatactcc aacctgcatc

361 cagccatccc acggcccaga ggtcaccgct ccaaatatgt agccctcatc tttctggtgg

421 ccagcctgat gatcctttgg gtggcaaagg atccaccaaa tcacactctg aagtacctag

481 cacttcacct agcctcgcac gaacttggac tactgttgaa aaacctctgc tgtctggctg

541 aagagctgtg ccatgtccag tccaggtacc agggcagcta ctggaaggct gtgcgcgcct

601 gcctgggatg ccccatccac tgtatggcta tgattctact atcgtcttat ttctatttcc

661 tccaaaacac tgctgacata tacctcagtt ggatgtttgg ccttctggtc ctctataagt

721 ccctaagcat gctcctgggc cttcagagct tgactccagc ggaagtctct gcagtctgtg

781 aagaaaagaa gttaaatgtt gcccacgggc tggcctggtc atactacatt gggtacttgc

841 ggttgatctt accagggctc caggcccgga tccgaatgtt caatcagcta cataacaaca

901 tgctcagtgg tgcagggagc cgaagactgt acatcctctt tccattggac tgtggggtgc

961 ctgacaacct gagtgtagtt gaccccaaca ttcgattccg agatatgctg ccccagcaaa

1021 acatcgaccg tgctggcatc aagaatcggg tttattccaa cagcgtctac gagattctgg

1081 agaacggaca gccagcaggc gtctgtatcc tggagtacgc cacccccttg cagaccctgt

1141 ttgccatgtc acaggatgcc aaagctggct tcagtcggga ggatcggctt gagcaggcta

1201 aactcttctg ccggacactt gaggaaatcc tggaagatgt ccccgagtct cgaaataact

1261 gccgcctcat tgtctaccaa gaacccacag acggaaacag tttctcactg tctcaggagg

1321 tgctccggca cattcgtcag gaagaaaagg aggaggttac catgaatgcc cccatgacct

1381 cagtggcacc tcctccctcc gtactgtccc aagagccaag actcctcatc agtggtatgg

1441 atcagcctct cccactccgc actgacctca tctgaggcat gggacagcct tgtctgggct

1501 ctagtgatcc tttagcctcc tgactgagcc ttccttcaat ggttgggggc ctcagagact

1561 tcacatctcc agatgagtcc cacattcctg ggcaagccat ttatttcacc tctctgagcc

1621 tcaaccaacc ctactatgaa aggaggtcat aatgcgttcc ctgcccagcc aaaggatttt

1681 atatatgtag aagttggtgt caatgcctgg taaacttgag agaaaggcca agtacttccc

1741 gtggatgctg cagacattcc ctgctctctg ttgacctgtg tggatggtac cagcagactt

1801 ccaaccctcc agcttctggt cacgtgtgtt caatgggagc ttaagtagat ggcgagaggg

1861 agaaggaaca tttgttctgt tagctgtata caatcacagt gggctggcct gtcaactgcc

1921 ttcttaataa acatatctat tctcagattt ctagaatggc ctcttcccct tgtctctagc

1981 actggtattt gtgtgacact ggagtacttt ctgtctggtc tctttatatc atgtcccttg

2041 cacatggtgt tggcatcagg acgtcccaaa ctcatgacat cacataggcg acagcatgac

2101 ctgcaacctg cagaccggtt gccaagacaa caggcaccat attcccacct tccacttggc

2161 tcacctccca cctttacctg tgttacgtca tcttccatat cttccatacg tcttccatct

2221 tccatacgtc tctctcccct gcttctcttt ctgctgctac cttgtctctc ccttccaata

2281 aaacctcttc catgcggaac tg

<210> 5

<211> 2179

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

1 tgaaactatt aaattccttg ctcagatttc aggaagtaaa gtgtgctgtt catctcaatc

61 tctcctgtct aacccctccc ctcccgattt ccgggggatc aatgatagta gagagctttg

121 gggcctctgg aaatcctgtg gggccctgtc acttttggtc cttgtatgga gtcctgctag

181 gtgtccactg gagtgtgtta catctcggga cctttagagg aattcggagt gcggggctgt

241 ggctgctgtc tccccattca gaagccactt gctagtagct actgaaaggc tcttcattgt

301 ctcttctgct ccaggaacac cggtctagga agcagaagat gccatactcc aacctgcatc

361 cagccatccc acggcccaga ggtcaccgct ccaaatatgt agccctcatc tttctggtgg

421 ccagcctgat gatcctttgg gtggcaaagg atccaccaaa tcacactctg aagtacctag

481 cacttcacct agcctcgcac gaacttggac tactgttgaa aaacctctgc tgtctggctg

541 aagagctgtg ccatgtccag tccagttgga tgtttggcct tctggtcctc tataagtccc

601 taagcatgct cctgggcctt cagagcttga ctccagcgga agtctctgca gtctgtgaag

661 aaaagaagtt aaatgttgcc cacgggctgg cctggtcata ctacattggg tacttgcggt

721 tgatcttacc agggctccag gcccggatcc gaatgttcaa tcagctacat aacaacatgc

781 tcagtggtgc agggagccga agactgtaca tcctctttcc attggactgt ggggtgcctg

841 acaacctgag tgtagttgac cccaacattc gattccgaga tatgctgccc cagcaaaaca

901 tcgaccgtgc tggcatcaag aatcgggttt attccaacag cgtctacgag attctggaga

961 acggacagcc agcaggcgtc tgtatcctgg agtacgccac ccccttgcag accctgtttg

1021 ccatgtcaca ggatgccaaa gctggcttca gtcgggagga tcggcttgag caggctaaac

1081 tcttctgccg gacacttgag gaaatcctgg aagatgtccc cgagtctcga aataactgcc

1141 gcctcattgt ctaccaagaa cccacagacg gaaacagttt ctcactgtct caggaggtgc

1201 tccggcacat tcgtcaggaa gaaaaggagg aggttaccat gaatgccccc atgacctcag

1261 tggcacctcc tccctccgta ctgtcccaag agccaagact cctcatcagt ggtatggatc

1321 agcctctccc actccgcact gacctcatct gaggcatggg acagccttgt ctgggctcta

1381 gtgatccttt agcctcctga ctgagccttc cttcaatggt tgggggcctc agagacttca

1441 catctccaga tgagtcccac attcctgggc aagccattta tttcacctct ctgagcctca

1501 accaacccta ctatgaaagg aggtcataat gcgttccctg cccagccaaa ggattttata

1561 tatgtagaag ttggtgtcaa tgcctggtaa acttgagaga aaggccaagt acttcccgtg

1621 gatgctgcag acattccctg ctctctgttg acctgtgtgg atggtaccag cagacttcca

1681 accctccagc ttctggtcac gtgtgttcaa tgggagctta agtagatggc gagagggaga

1741 aggaacattt gttctgttag ctgtatacaa tcacagtggg ctggcctgtc aactgccttc

1801 ttaataaaca tatctattct cagatttcta gaatggcctc ttccccttgt ctctagcact

1861 ggtatttgtg tgacactgga gtactttctg tctggtctct ttatatcatg tcccttgcac

1921 atggtgttgg catcaggacg tcccaaactc atgacatcac ataggcgaca gcatgacctg

1981 caacctgcag accggttgcc aagacaacag gcaccatatt cccaccttcc acttggctca

2041 cctcccacct ttacctgtgt tacgtcatct tccatatctt ccatacgtct tccatcttcc

2101 atacgtctct ctcccctgct tctctttctg ctgctacctt gtctctccct tccaataaaa

2161 cctcttccat gcggaactg

<210> 7

<211> 2170

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

1 gttcattttt cactcctccc tcctaggtca cacttttcag aaaaagaatc tgcatcctgg

61 aaaccagaag aaaaatatga gacggggaat catcgtgtga tgtgtgtgct gcctttggct

121 gagtgtgtgg agtcctgctc aggtgttagg tacagtgtgt ttgatcgtgg tggcttgagg

181 ggaacccgct gttcagagct gtgactgcgg ctgcactcag agaagctgcc cttggctgct

241 cgtagcgccg ggccttctct cctcgtcatc atccagagca gccagtgtcc gggaggcaga

301 agatgcccca ctccagcctg catccatcca tcccgtgtcc caggggtcac ggggcccaga

361 aggcagcctt ggttctgctg agtgcctgcc tggtgaccct ttgggggcta ggagagccac

421 cagagcacac tctccggtac ctggtgctcc acctagcctc cctgcagctg ggactgctgt

481 taaacggggt ctgcagcctg gctgaggagc tgcgccacat ccactccagg taccggggca

541 gctactggag gactgtgcgg gcctgcctgg gctgccccct ccgccgtggg gccctgttgc

601 tgctgtccat ctatttctac tactccctcc caaatgcggt cggcccgccc ttcacttgga

661 tgcttgccct cctgggcctc tcgcaggcac tgaacatcct cctgggcctc aagggcctgg

721 ccccagctga gatctctgca gtgtgtgaaa aagggaattt caacgtggcc catgggctgg

781 catggtcata ttacatcgga tatctgcggc tgatcctgcc agagctccag gcccggattc

841 gaacttacaa tcagcattac aacaacctgc tacggggtgc agtgagccag cggctgtata

901 ttctcctccc attggactgt ggggtgcctg ataacctgag tatggctgac cccaacattc

961 gcttcctgga taaactgccc cagcagaccg gtgaccatgc tggcatcaag gatcgggttt

1021 acagcaacag catctatgag cttctggaga acgggcagcg ggcgggcacc tgtgtcctgg

1081 agtacgccac ccccttgcag actttgtttg ccatgtcaca atacagtcaa gctggcttta

1141 gccgggagga taggcttgag caggccaaac tcttctgccg gacacttgag gacatcctgg

1201 cagatgcccc tgagtctcag aacaactgcc gcctcattgc ctaccaggaa cctgcagatg

1261 acagcagctt ctcgctgtcc caggaggttc tccggcacct gcggcaggag gaaaaggaag

1321 aggttactgt gggcagcttg aagacctcag cggtgcccag tacctccacg atgtcccaag

1381 agcctgagct cctcatcagt ggaatggaaa agcccctccc tctccgcacg gatttctctt

1441 gagacccagg gtcaccaggc cagagcctcc agtggtctcc aagcctctgg actgggggct

1501 ctcttcagtg gctgaatgtc cagcagagct atttccttcc acagggggcc ttgcagggaa

1561 gggtccagga cttgacatct taagatgcgt cttgtcccct tgggccagtc atttcccctc

1621 tctgagcctc ggtgtcttca acctgtgaaa tgggatcata atcactgcct tacctccctc

1681 acggttgttg tgaggactga gtgtgtggaa gtttttcata aactttggat gctagtgtac

1741 ttagggggtg tgccaggtgt ctttcatggg gccttccaga cccactcccc acccttctcc

1801 ccttcctttg cccggggacg ccgaactctc tcaatggtat caacaggctc cttcgccctc

1861 tggctcctgg tcatgttcca ttattgggga gccccagcag aagaatggag aggaggagga

1921 ggctgagttt ggggtattga atcccccggc tcccaccctg cagcatcaag gttgctatgg

1981 actctcctgc cgggcaactc ttgcgtaatc atgactatct ctaggattct ggcaccactt

2041 ccttccctgg ccccttaagc ctagctgtgt atcggcaccc ccaccccact agagtactcc

2101 ctctcacttg cggtttcctt atactccacc cctttctcaa cggtcctttt ttaaagcaca

2161 tctcagatta

<210> 8

<211> 1943

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

1 gttcattttt cactcctccc tcctaggtca cacttttcag aaaaagaatc tgcatcctgg

61 aaaccagaag aaaaatatga gacggggaat catcgtgtga tgtgtgtgct gcctttggct

121 gagtgtgtgg agtcctgctc aggtgttagg tacagtgtgt ttgatcgtgg tggcttgagg

181 ggaacccgct gttcagagct gtgactgcgg ctgcactcag agaagctgcc cttggctgct

241 cgtagcgccg ggccttctct cctcgtcatc atccagagca gccagtgtcc gggaggcaga

301 aggtaccggg gcagctactg gaggactgtg cgggcctgcc tgggctgccc cctccgccgt

361 ggggccctgt tgctgctgtc catctatttc tactactccc tcccaaatgc ggtcggcccg

421 cccttcactt ggatgcttgc cctcctgggc ctctcgcagg cactgaacat cctcctgggc

481 ctcaagggcc tggccccagc tgagatctct gcagtgtgtg aaaaagggaa tttcaacgtg

541 gcccatgggc tggcatggtc atattacatc ggatatctgc ggctgatcct gccagagctc

601 caggcccgga ttcgaactta caatcagcat tacaacaacc tgctacgggg tgcagtgagc

661 cagcggctgt atattctcct cccattggac tgtggggtgc ctgataacct gagtatggct

721 gaccccaaca ttcgcttcct ggataaactg ccccagcaga ccggtgacca tgctggcatc

781 aaggatcggg tttacagcaa cagcatctat gagcttctgg agaacgggca gcgggcgggc

841 acctgtgtcc tggagtacgc cacccccttg cagactttgt ttgccatgtc acaatacagt

901 caagctggct ttagccggga ggataggctt gagcaggcca aactcttctg ccggacactt

961 gaggacatcc tggcagatgc ccctgagtct cagaacaact gccgcctcat tgcctaccag

1021 gaacctgcag atgacagcag cttctcgctg tcccaggagg ttctccggca cctgcggcag

1081 gaggaaaagg aagaggttac tgtgggcagc ttgaagacct cagcggtgcc cagtacctcc

1141 acgatgtccc aagagcctga gctcctcatc agtggaatgg aaaagcccct ccctctccgc

1201 acggatttct cttgagaccc agggtcacca ggccagagcc tccagtggtc tccaagcctc

1261 tggactgggg gctctcttca gtggctgaat gtccagcaga gctatttcct tccacagggg

1321 gccttgcagg gaagggtcca ggacttgaca tcttaagatg cgtcttgtcc ccttgggcca

1381 gtcatttccc ctctctgagc ctcggtgtct tcaacctgtg aaatgggatc ataatcactg

1441 ccttacctcc ctcacggttg ttgtgaggac tgagtgtgtg gaagtttttc ataaactttg

1501 gatgctagtg tacttagggg gtgtgccagg tgtctttcat ggggccttcc agacccactc

1561 cccacccttc tccccttcct ttgcccgggg acgccgaact ctctcaatgg tatcaacagg

1621 ctccttcgcc ctctggctcc tggtcatgtt ccattattgg ggagccccag cagaagaatg

1681 gagaggagga ggaggctgag tttggggtat tgaatccccc ggctcccacc ctgcagcatc

1741 aaggttgcta tggactctcc tgccgggcaa ctcttgcgta atcatgacta tctctaggat

1801 tctggcacca cttccttccc tggcccctta agcctagctg tgtatcggca cccccacccc

1861 actagagtac tccctctcac ttgcggtttc cttatactcc acccctttct caacggtcct

1921 tttttaaagc acatctcaga tta

Claims (9)

1. A specific STING isoform, wherein said STING isoform comprises erssting and pmSTING, wherein the Pre-mRNA transcribed from the STING gene has two transcripts with different splicing patterns; longer transcripts are translated into classical ones that localize to the endoplasmic reticulum; the shorter transcript had the same 3' terminal sequence as the longer transcript and was translationally processed to pmSTING localization on the cytoplasmic membrane due to the lack of a transmembrane region for exon skipping.

2. The STING isoform of claim 1, wherein the sequences erssting and pmSTING are, respectively:

the mouse erssting sequence is SEQ ID NO: 5 is shown in the specification;

the mouse pmSTING sequence is SEQ ID NO: 6 is shown in the specification;

the human erssting sequence is SEQ ID NO: 7 is shown in the specification;

the human pmSTING sequence is SEQ ID NO: shown in fig. 8.

3. The STING isoform of claim 1, wherein pmSTING has the same C-terminal domain as classical erssting; pmSTING was stimulated by extracellular cGAMP, inducing phosphorylation of TBK1, phosphorylated TBK1 further mediated IRF3 activation, promoting type I interferon expression.

4. A cell line for expressing a specific STING isoform according to any one of claims 1-3, wherein said cell line comprises: b16 cell line expressing only erssting and only pmSTING and HEK293T cell line expressing only erssting and only pmSTING.

5. A method of preparing the cell line of claim 4, comprising:

step one, culturing mouse splenocytes and separating and culturing human peripheral blood mononuclear cells PBMCs;

step two, synthesizing Open Reading Frames (ORFs) of human pmSTING and erssting by taking PBMCs cDNA as a template; synthesizing ORF of mouse pmSTING and ercSTING by using mouse splenocyte cDNA as template;

cloning the ORF of the synthesized alternative splicing isomer into a pcDNA3.1-GFP vector respectively to construct pmSTING-GFP and ersSTING-GFP fusion gene plasmids;

step four, the constructed fusion gene plasmid is transfected to pre-cultured B16^Tmem173-/-Cells and HEK293T cells, a B16 cell line expressing only erssting and only pmSTING and a HEK293T cell line expressing only erssting and only pmSTING were obtained.

6. The method of claim 5, wherein in step one, the mouse spleen cells are preparedThe culture of (a) comprises: using RPMI1640 medium containing 10% fetal bovine serum and 0.1% penicillin-streptomycin solution at 37 deg.C and 5% CO₂Mouse splenocytes were cultured under ambient conditions.

7. The method of claim 5, wherein in step one, the isolation of human peripheral blood mononuclear cells comprises:

firstly, human blood is obtained and diluted; adding the diluted blood into a test tube with 5mL of lymphocyte layering liquid at the bottom, and centrifuging for 10 minutes at 1500 g;

secondly, the intermediate layer containing PBMC was separated into a new tube and centrifuged at 1500g for 5 minutes; removing the supernatant;

then, the cell pellet was resuspended in 1mL of erythrocyte lysis buffer and lysed for 3 minutes at room temperature to remove erythrocytes;

finally, the supernatant is removed, the cell sediment is resuspended by PBS, and 1500g is centrifuged for 5 minutes, thus obtaining the separated PBMCs of the human peripheral blood mononuclear cells.

8. The method of claim 5, wherein the dilution comprises: diluted with 6mL sterile PBS;

the culturing of the human peripheral blood mononuclear cells comprises:

using RPMI1640 medium containing 10% fetal bovine serum and 0.1% penicillin-streptomycin solution at 37 deg.C and 5% CO₂Culturing human PBMC cells under ambient conditions;

in step four, the B16^Tmem173-/-The culturing of the cells comprises: placing in RPMI1640 medium containing 10% fetal calf serum and 0.1% penicillin-streptomycin solution at 37 deg.C and 5% CO₂Culturing under ambient conditions. The culture of the HEK293T cell comprises: placing in DMEM medium containing 10% fetal calf serum and 0.1% penicillin-streptomycin solution at 37 deg.C and 5% CO₂Culturing under ambient conditions.

9. The method of claim 5, wherein the primers for constructing the plasmid for the STING isoform fusion gene comprise:

the sequence of mouse Tmem173 cell primer is shown in SEQ ID NO: 1 is shown in the specification;

the sequence of the human TMEM173 cell primer is shown as SEQ ID NO: 2 is shown in the specification;

the sequence of the mouse Tmem 173-ORF cell primer is shown as SEQ ID NO: 3 is shown in the specification;

the sequence of the human TMEM 173-ORF cell primer is shown as SEQ ID NO: 4, respectively.

Images