CN114085904A

CN114085904A - Colorectal cancer gene methylation detection primer probe combination, kit and application thereof

Info

Publication number: CN114085904A
Application number: CN202010856649.9A
Authority: CN
Inventors: 邵琦
Original assignee: Anhui Dajian Medical Technology Co ltd; GUANGZHOU TARGENE BIOTECH CO Ltd
Current assignee: Anhui Dajian Medical Technology Co ltd; GUANGZHOU TARGENE BIOTECH CO Ltd
Priority date: 2020-08-24
Filing date: 2020-08-24
Publication date: 2022-02-25
Anticipated expiration: 2040-08-24
Also published as: CN114085904B

Abstract

The invention provides a colorectal cancer gene methylation detection primer probe combination, a kit and application thereof, the kit takes DNA methylation abnormality which is an important biological index of cancer diagnosis, early screening and prognosis as a detection object, utilizes a fluorescent quantitative PCR technology, combines TCGA data to obtain methylation chip data related to colorectal cancer for analysis, screens out 4 gene methylation detection sites such as NDRG4, SPG20, 3OST2 and ING1, and obtains the colorectal cancer detection kit with higher sensitivity and better specificity by establishing colorectal cancer methylation detection based on the fluorescent quantitative PCR, thereby realizing the early screening and diagnosis of colorectal cancer and being beneficial to early diagnosis and early treatment of colorectal cancer.

Description

Colorectal cancer gene methylation detection primer probe combination, kit and application thereof

Technical Field

The invention belongs to the technical field of biology, relates to a composition and application thereof in disease detection, and particularly relates to a colorectal cancer gene methylation detection primer probe combination, a kit and application thereof.

Background

Colorectal cancer (CRC) causes about 600000 deaths each year, and despite major advances in treatment options for colorectal cancer, the survival probability of CRC patients remains low due to the lack of effective early diagnostic tools, while the ability for optimal treatment decision-making is limited. According to the data of the national cancer center, 42.92 new cases of colorectal cancer in the mainland area of China in 2015, 28.14 deaths caused by colorectal cancer in the same year, and 11759 cases and 7710 cases of daily morbidity and mortality respectively. Colorectal cancer is better developed in men over 40 years old, the onset of the colorectal cancer is related to factors such as age, region and sex, the early clinical manifestation is not obvious, most tumors grow slowly, and the symptoms such as defecation habit change, hematochezia, abdominal distension, diarrhea, local abdominal pain and the like are not shown until the tumors grow to a certain size or develop stage. According to research and analysis, the 5-year survival rates of colorectal cancers I, II, III and IV are respectively 90.1%, 72.6%, 53.8% and 10.4%, the 5-year survival rate of early colorectal cancer patients can reach 90% after endoscopic submucosal resection or mucosa dissection, and the 5-year survival rate of late colorectal cancer patients is only 10%. However, only about 20% of colorectal cancer patients who are diagnosed in hospitals in China are in the early stage, and nearly 80% of patients are found to belong to the middle and late stages, so that the death rate is high due to missing of the optimal treatment period, and great harm is brought to the treatment effect and the public health of the colorectal cancer, so that a colorectal cancer early warning and early screening method is established, the prevention and the treatment of the colorectal cancer are very important, and early discovery, early diagnosis, early treatment and early operation are effective means for preventing and controlling the colorectal cancer.

The detection technology of colorectal cancer mainly comprises the following steps: 1) stool occult blood test: the simple and feasible early diagnosis and preliminary screening method has low specificity, and early tumors are easy to miss detection; 2) imaging technology: x-ray radiography examination and CT examination are not sensitive to superficial lesions, and clear diagnosis cannot be carried out; 3) digital rectal examination: the index finger head is directly stretched into the anus of a patient to check whether the rectum has the tumor or not, the method needs a certain experience value of a doctor, the judgment is subjective, and misdiagnosis is easy; 4) endoscope: the state of the mucosa of the whole colon and rectum is directly observed, the biopsy is taken from the suspicious focus, but a complex intestinal tract preparation process is needed, certain invasiveness is realized, professional technicians are needed, and the popularization rate of the general population is not high. Therefore, there is a need to develop a novel sensitive and specific colorectal cancer marker and detection technology, to improve the detection rate of early cancer, the treatment effect and the death rate of colorectal cancer.

Epigenetics is a hot field of tumor research in recent years, epigenetic changes such as DNA methylation, histone modification, chromatin remodeling, and non-coding RNA regulation are considered to be closely related to tumor occurrence, wherein DNA methylation is the most common epigenetic change that can regulate cell proliferation, apoptosis, and differentiation, and the level is closely related to the biological characteristics of tumors. Various researches prove that the pathological process of colorectal cancer is a complex process of multi-gene variation accumulation, and relates to abnormal methylation of various oncogenes and cancer suppressor genes, wherein most abnormal methylation is hypermethylation of the cancer suppressor genes, and the hypermethylation is often used for leading the transcriptional silencing of the cancer suppressor genes. DNA methylation abnormality usually occurs in early cancer, and the methylation state of the DNA methylation abnormality changes once the DNA methylation abnormality is formed and needs to be continuously stimulated by external environment for a long time through the occurrence and development processes of the cancer, so that the detection of the DNA methylation index can be used as an important biological index for cancer diagnosis, early screening and prognosis.

The main detection methods for DNA methylation are numerous and can be roughly divided into two types from the application: whole genome methylation analysis and specific site methylation detection. The whole genome methylation analysis has higher detection cost and is often used as a high-throughput means for screening and discovering target genes; the specific site methylation detection method comprises a sodium bisulfite-combined restriction endonuclease analysis method (COBRA), a methylation specificity PCR Method (MSP), a methylation sensitivity high-resolution melting curve analysis method (MethyLight), and the like, wherein the restriction endonuclease analysis method can only obtain the methylation condition of a special enzyme cutting site, the methylation specificity PCR method is based on common PCR and electrophoresis analysis, has complicated operation and is easy to cause sample pollution, the methylation sensitivity high-resolution melting curve analysis method has higher requirements on the instrument, a fluorescence quantitative PCR instrument with a high-resolution melting (HRM) module is required, and the methylation fluorescence quantitative method is based on high flux and high sensitivity, does not need electrophoresis, hybridization and other operations after PCR, reduces pollution and operation errors, and is widely applied to DNA methylation detection. At present, methods for detecting DNA methylation of colorectal cancer based on a methylation fluorescence quantitative method are few, and related detection is only directed at a single gene, so that the detection accuracy is not ideal, and the diagnosis effect is limited.

In view of the above, the invention establishes the multiple-gene joint detection based on methylation fluorescence quantification by screening DNA methylation genes of colorectal cancer and combining multiple genes, obtains a detection reagent with higher sensitivity, specificity and accuracy, and realizes early screening and diagnosis of colorectal cancer.

Disclosure of Invention

In order to achieve the aim, the invention provides a primer probe combination for detecting methylation of colorectal cancer genes, a kit and application thereof, wherein a nucleic acid sample of the colorectal cancer to be detected is subjected to bisulfite conversion by a bisulfite modification method, a fluorescent quantitative PCR technology is combined, a literature research result, a TCGA methylation chip database and a transcriptome sequencing expression profile are comprehensively analyzed, a colorectal cancer hypermethylation candidate gene is screened through multiple data filtration analysis, specific gene methylation detection primers and probes are designed aiming at a plurality of methylation detection sites on the colorectal cancer hypermethylation candidate gene, more than 30 methylation CpG sites are covered, a DNA sample to be detected modified by bisulfite is amplified through multiple fluorescent quantitative PCR, the methylation condition of a target gene in the sample to be detected is detected, and the sensitivity and the specificity of the kit are improved through multiple ways, early screening and diagnosis of colorectal cancer are realized.

The invention provides detection sites for colorectal cancer gene methylation detection, which comprise one or more of NDRG4, SPG20, 3OST2 and ING 1.

The second aspect of the invention provides a PCR primer probe combination for detecting the methylation of colorectal cancer genes, which comprises one or more of the following nucleic acid sequence combinations shown in 1) to 4):

1) the PCR primer and probe for NDRG4 methylation detection comprise one of a primer probe combination 1 and a primer probe combination 2, wherein the primer probe combination 1 comprises an upstream primer shown as SEQ ID No.1, a downstream primer shown as SEQ ID No.2 and a fluorescent probe shown as SEQ ID No.3, and the primer probe combination 2 comprises an upstream primer shown as SEQ ID No.4, a downstream primer shown as SEQ ID No.5 and a fluorescent probe shown as SEQ ID No. 6;

2) PCR primers and probes for detecting the methylation of SPG20, which comprise one of a primer probe combination 5 and a primer probe combination 6, wherein the primer probe combination 5 comprises an upstream primer shown as SEQ ID NO.13, a downstream primer shown as SEQ ID NO.14 and a fluorescent probe shown as SEQ ID NO.15, and the primer probe combination 6 comprises an upstream primer shown as SEQ ID NO.16, a downstream primer shown as SEQ ID NO.17 and a fluorescent probe shown as SEQ ID NO. 18;

3)3OST2 methylation detection PCR primer and probe, comprising one of a primer probe combination 7 and a primer probe combination 9, wherein the primer probe combination 7 comprises an upstream primer shown as SEQ ID NO.19, a downstream primer shown as SEQ ID NO.20 and a fluorescent probe shown as SEQ ID NO.21, and the primer probe combination 9 comprises an upstream primer shown as SEQ ID NO.25, a downstream primer shown as SEQ ID NO.26 and a fluorescent probe shown as SEQ ID NO. 27;

4) the primer and probe for methylation detection of ING1 comprises one of a primer and probe combination 10 and a primer and probe combination 12, wherein the primer and probe combination 10 comprises an upstream primer shown as SEQ ID No.28, a downstream primer shown as SEQ ID No.29 and a fluorescent probe shown as SEQ ID No.30, and the primer and probe combination 12 comprises an upstream primer shown as SEQ ID No.34, a downstream primer shown as SEQ ID No.35 and a fluorescent probe shown as SEQ ID No. 36.

In an embodiment of the present invention, the PCR primer probe combination for detecting methylation of a colorectal cancer gene further includes a PCR primer and a probe for detecting an internal reference gene GAPDH, including an upstream primer shown in SEQ ID No.37, a downstream primer shown in SEQ ID No.38, and a fluorescent probe shown in SEQ ID No. 39.

In one embodiment of the invention, the 5' end of the fluorescent probe comprises a fluorescent reporter group, including any one of FAM, HEX, NED, ROX, TET, JOE, TAMRA, CY3, CY 5.

In one embodiment of the invention, the 3' end of the fluorescent probe comprises a fluorescence quenching group, including any one of MGB, BHQ-1, BHQ-2 and BHQ-3.

In a preferred embodiment of the present invention, the fluorescence quenching group is MGB.

In a third aspect, the invention provides a kit for detecting colorectal cancer gene methylation, which comprises the PCR primer probe combination according to the first aspect of the invention, and further comprises a positive quality control product and a negative quality control product.

In an embodiment of the invention, the positive quality control material is human colorectal cancer cell strain DNA.

In one embodiment of the present invention, the negative quality control material is normal human leukocyte DNA.

In an embodiment of the present invention, the final concentration composition of the reaction system of the colorectal cancer gene methylation detection kit comprises: 0.1-1 μ M PCR primer, 0.1-1 μ M probe.

In a preferred embodiment of the present invention, the final concentration composition of the reaction system of the colorectal cancer gene methylation detection kit comprises: 0.1-0.5. mu.M PCR primer, 0.1-0.5. mu.M probe.

In an embodiment of the invention, the fluorescence quantitative PCR reaction conditions of the kit for detecting colorectal cancer gene methylation are as follows:

in a preferred embodiment of the present invention, the fluorescence quantitative PCR reaction conditions of the kit for detecting colorectal cancer gene methylation are as follows:

in a fourth aspect, the present invention provides a method for detecting methylation of colorectal cancer genes, comprising the steps of:

1) separating nucleic acid of a target gene in a biological sample to be detected;

2) subjecting the nucleic acid obtained in the step 1) to bisulfite conversion treatment to obtain bisulfite converted DNA, namely Bis-DNA;

3) detecting the methylation state of the Bis-DNA obtained in the step 2) by adopting a PCR technology.

In an embodiment of the present invention, the biological sample in step 1) includes one of a tissue sample, a blood sample, a cell sample, or a stool sample.

In a preferred embodiment of the invention, the biological sample is a stool sample.

In a fifth aspect, the present invention provides a colorectal cancer gene methylation detection site according to the first aspect of the present invention, a PCR primer probe combination for colorectal cancer gene methylation detection according to the second aspect of the present invention, a colorectal cancer gene methylation detection kit according to the third aspect of the present invention, or a colorectal cancer gene methylation detection method according to the fourth aspect of the present invention, for use in preparing a kit for detecting colorectal cancer.

The invention has the following beneficial effects:

1) can be used as an important index for early screening, process monitoring and prognosis evaluation of colorectal cancer: the kit for detecting the colorectal cancer gene methylation takes DNA methylation abnormality as a detection object, the DNA methylation abnormality usually occurs in the early stage of cancer and runs through the occurrence and development processes of the cancer, and the methylation state of the DNA methylation abnormality changes once the DNA methylation abnormality is formed and needs to be continuously stimulated by the external environment for a long time, so that the detection of the DNA methylation index can be used as an important biological index for early screening, process monitoring and prognosis evaluation of the colorectal cancer;

2) the noninvasive detection can be realized: the colorectal cancer gene methylation detection kit provided by the invention can detect various samples, and can realize noninvasive detection by detecting the gene methylation state in a stool sample;

3) the accuracy is high: the colorectal cancer gene methylation detection kit provided by the invention is based on a fluorescent quantitative PCR technology, establishes multiple-gene combined detection based on methylation fluorescence quantification by screening colorectal cancer related methylation genes and combining multiple genes to cover more than 30 methylation CpG sites, and obtains a detection reagent with higher sensitivity, specificity and accuracy through system optimization and experimental verification, so that early screening and diagnosis of colorectal cancer are realized.

Drawings

FIG. 1 is a diagram showing the screening results of a single PCR primer probe combination for colorectal cancer gene methylation detection provided in the embodiment of the present invention;

FIG. 2 is a diagram of the screening results of the multiplex PCR primer probe combination for colorectal cancer gene methylation detection provided by the embodiment of the invention.

Detailed Description

The present invention is described in detail below with reference to specific examples so that those skilled in the art can easily practice the present invention in light of the disclosure of the present specification. The embodiments described below are only a part of the embodiments of the present invention, and not all of them. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention. Unless otherwise indicated, the reagents, methods and apparatus used in the present invention are conventional in the art, and experimental methods without specific conditions being indicated are generally performed according to conventional conditions or conditions recommended by the manufacturer.

According to the invention, a bisulfite modification method is adopted to carry out bisulfite conversion on a colorectal cancer nucleic acid sample to be detected, a fluorescence quantitative PCR technology is combined, a literature research result, a TCGA methylation chip database and a transcriptome sequencing expression profile are comprehensively analyzed, a colorectal cancer hypermethylation candidate gene is screened through multiple data filtering analysis, a specific gene methylation detection primer and a specific probe are designed, a DNA sample to be detected modified by bisulfite is amplified, the methylation condition of a target gene in the sample to be detected is determined according to a PCR amplification result, and early screening and diagnosis of colorectal cancer are realized.

The gene methylation detection site of the colorectal cancer gene methylation detection kit provided by the invention comprises one or more of NDRG4, SPG20, 3OST2 and ING 1.

The PCR primer probe combination of the colorectal cancer gene methylation detection kit provided by the invention is one or more of the following nucleic acid sequence combinations shown in 1) -4):

The PCR primer probe combination of the colorectal cancer gene methylation detection kit further comprises a PCR primer and a probe for detecting an internal reference gene GAPDH, wherein the PCR primer and the probe comprise an upstream primer shown as SEQ ID NO.37, a downstream primer shown as SEQ ID NO.38 and a fluorescent probe shown as SEQ ID NO. 39.

Preferably, the 5' end of the fluorescent probe comprises a fluorescent reporter group, including any one of FAM, HEX, NED, ROX, TET, JOE, TAMRA, CY3 and CY 5.

Preferably, the 3' end of the fluorescent probe comprises a fluorescence quenching group, including any one of MGB, BHQ-1, BHQ-2 and BHQ-3.

Further preferably, the fluorescence quenching group is MGB.

The detection sample of the colorectal cancer gene methylation detection kit provided by the invention comprises one of a tissue sample, a blood sample, a cell sample or a stool sample.

The detection result of the colorectal cancer gene methylation detection kit provided by the invention is interpreted as follows:

1) threshold setting

The baseline can be adjusted either automatically per instrument or manually according to the instructions for use of the instrument, the threshold is set in the linear portion of the log plot of fluorescence values, data is derived from the software and CT values are read.

2) Kit validity determination

The negative quality control product has the reference gene amplified and the CT value is less than or equal to 25, and the gene methylation detection site is not amplified; the reference gene and the gene methylation detection site of the positive quality control product are amplified, and the CT value is less than or equal to 25.

3) Sample validity determination

a) If the internal reference gene is amplified and the CT value is less than or equal to 25, the analysis can be continued;

b) if the CT value of the reference gene is more than or equal to 25 or no amplification exists, but the methylation detection site of the gene is amplified and the CT value is less than or equal to 20, the analysis can be continued;

c) if the CT value of the internal reference gene is greater than 25 or no amplification, and the CT value of the gene methylation detection site is greater than 20 or no amplification, the analysis cannot be continued, repeated detection is needed, and if the CT value of the internal reference gene is greater than 20 or no amplification, the sampling detection is needed again.

4) Determination of methylation detection result

The interpretation standard of each gene due to methylation index is as follows: Δ CT is the CT value of the target gene-the CT value of the reference gene. The calculation result of the methylation index EI of each sample to be detected is shown in the following table:

and calculating the methylation index EI of each gene methylation detection site of the sample to be detected according to the table, then counting the sum Sigma EI of the multiple gene methylation indexes, judging that the gene methylation detection of the sample to be detected is positive when the Sigma EI is more than or equal to 5, and judging that the gene methylation detection of the sample to be detected is negative when the Sigma EI is less than 5.

In order to show the technical scheme of the invention more clearly, the invention is further illustrated by combining specific examples.

Example 1: sample DNA extraction and bisulfite conversion

1. Sample processing and DNA extraction

Extracting by adopting a nucleic acid extraction kit of Guangzhou Dajian biological technology limited company, and operating as follows:

1) preprocessing a sample to be detected:

(a) fecal sample pretreatment was performed as follows: taking 15mL of fresh excrement and putting the fresh excrement into a 50mL centrifuge tube filled with excrement preservation solution, and putting the 50mL excrement preservation tube filled with the sample into a rotary blending instrument to be uniformly mixed for 0.5 hour; placing the fully and uniformly mixed sample in a centrifuge at 4200rpm for 30min, taking supernatant, and subpackaging into 3 frozen tubes with 5mL, and subpackaging 3mL for each tube; adding 1mL of fecal cell suspension and 100 mu L of digestive juice LP into a 1.5mL centrifuge tube, fully mixing, digesting for 20 minutes at 37 ℃, centrifuging at 4000rpm for 10min, and transferring supernatant into a 2mL centrifuge tube for later use.

(b) The blood sample pretreatment operation is as follows: taking venous blood of a subject, extracting 2mL by using a sterile syringe needle, collecting in a sterile collection tube, standing at room temperature for 30min, and after a blood sample can spontaneously and completely coagulate to separate out serum, or directly using a horizontal centrifuge, centrifuging at 3000rpm for 5min, and sucking the serum and transferring into a 1.5mL centrifuge tube for later use.

(c) And (3) pretreating the cell and tissue samples according to a conventional nucleic acid extraction process.

2) DNA extraction:

(a) transferring 1mL of the sample to be detected pretreated in the step 1) to a new 2mL centrifuge tube, adding 500 μ L of lysis buffer (BufferA) and 60 μ L of proteinase K, shaking and mixing uniformly, and performing lysis at 70 ℃ for 40 min;

(b) adding 500 mu L of isopropanol, fully shaking and uniformly mixing, and standing for 10min in an ice bath;

(c) centrifuging at 12000rpm for 1min, and adding supernatant into adsorption column;

(d) centrifuging at 12000rpm for 2min until the residual liquid is thrown clean;

(e) adding 800 μ L of rinsing liquid I for rinsing (precooling), centrifuging at 13000rpm for 1min, and discarding the waste liquid;

(f) adding 800 μ L of rinsing liquid II for rinsing (precooling), centrifuging at 13000rpm for 1min, and discarding the waste liquid;

(g) centrifuging at 12000rpm for 2min at room temperature, discarding the collecting tube, and placing the adsorption column into a 1.5mL sterile centrifuge tube;

(h) adding 60 μ L of preheated (90 deg.C) EB solution, standing at room temperature for 5min, centrifuging at 12000rpm for 3 min; the DNA concentration and purity were measured. Storing in a refrigerator of-20 deg.C.

2. Bisulfite conversion

The transformation is carried out by adopting a transformation kit of Guangzhou Dajian biological technology limited company, and the operation is as follows:

(a) taking 45 mu L of DNA sample to be detected, putting the sample into a new 1.5mL centrifuge tube, adding 5 mu L of transformation buffer solution, and placing the sample in a metal bath for incubation for 15min at the constant temperature of 37 ℃;

(b) after the incubation is finished, adding 100 mu L of the prepared transformation liquid into each sample, uniformly mixing, centrifuging for a short time, and incubating for 12-16 hours in a metal bath at 50 ℃ in a dark place;

(c) placing the sample on ice (0-4 ℃) and incubating for 10 min;

(d) placing the adsorption column in a collecting tube, and adding 400 μ L binding solution into the adsorption column;

(e) c, adding the sample in the step c into an adsorption column (containing binding liquid), covering a tube cover tightly, turning upside down, uniformly mixing for a plurality of times, centrifuging for 30s at full speed (14000rpm), and discarding waste liquid;

(f) adding 100 mu L of rinsing liquid into the adsorption column, centrifuging at full speed for 30s, and discarding the waste liquid;

(g) adding 200 mu L of desulfonation liquid into the adsorption column, incubating for 20min at room temperature (20-30 ℃), centrifuging for 30s at full speed, and discarding waste liquid;

(h) adding 200 mu L of rinsing liquid into the adsorption column, centrifuging at full speed for 30s, repeatedly adding 200 mu L of rinsing liquid, centrifuging at full speed for 30s, and discarding the waste liquid and the collecting pipe;

(i) placing the adsorption column into a 1.5mL sterile centrifuge tube, suspending and dropwise adding 30 μ L eluent into the middle part of the adsorption membrane, eluting and converting DNA, centrifuging at full speed for 1min, collecting Bis-DNA, and storing at-20 ℃.

Example 2: colorectal cancer tissue hypermethylation candidate gene, specific primer and probe screening

1. Screening of feces hypermethylation candidate gene of colorectal cancer patient

Screening methylation sites with significant differences by comprehensively analyzing literature research results, TCGA methylation chip databases and transcriptome sequencing expression profiles, and finally screening and determining NDRG4, SPG20, 3OST2 and ING1 as candidate gene sites of high methylation in colorectal cancer through multiple data filtering analysis.

2. Specific primer and probe screening for colorectal cancer methylation detection

1) Design and screening of specific primer and probe

Designing methylation primers and probes on Methyl primer Express v1.0 software according to the nucleotide sequences of the NDRG4, SPG20, 3OST2 and ING1, repeatedly designing and knocking by the applicant, screening to obtain fluorescence quantitative PCR probes and primers for related gene methylation, and sending the designed primers and probes to Beijing Rui Boxing Ke Biotech limited company for synthesis, wherein the specific sequences are shown in the following table:

specific primers and probes for an internal reference gene GAPDH are arranged at the same time, and the specific sequences are as follows:

name (R)	Sequence (5 '-3')
		Methy-GAPDH-F	AAGTTAGGTTAGTTTGGTAGGGAAGTT(SEQ ID NO.37)
Methy-GAPDH-R	AACCCTAAACCACCTCCCC(SEQ ID NO.38)
		Methy-GAPDH-P	TTTGGGTTTTTTTGGGGGTAAGGAGATGT(SEQ ID NO.39)

Wherein the 5' end of the probe sequence is modified with a fluorescent group selected from any one of FAM, HEX, NED, ROX, TET, JOE, TAMRA, CY3 and CY 5; the 3' end is marked with a fluorescence quenching group, and is selected from one of MGB, BHQ-1, BHQ-2 and BHQ-3, preferably MGB.

2) PCR amplification for further screening primer probe combination

And (3) PCR reaction system: mu.L of the PCR reaction system contained 10. mu.L of the 2 XPCR reaction premix, 0.1. mu.L of each of 10. mu.M GAPDH primer and probe, 0.5. mu.L of each of 10. mu.M of each of the primer and probe combination, 0.2. mu.L of each of the probe, 5. mu.L of Bis-DNA, and 20. mu.L of water.

The extent of the PCR reaction was as follows:

the primer probe combinations selected in the step 1) are screened by PCR amplification by using DNA samples of patients and healthy people who are diagnosed with colorectal cancer as templates, and the results are shown in figure 1, wherein the CT values of NDRG4-3, SPG20-1, 3OST2-2 and ING1-2 are obviously greater than those of the other primer probe combinations, so that NDRG4-1, NDRG4-2, SPG20-2, SPG20-3, 3OST2-1, 3OST2-3, ING1-1 and ING1-3 are screened as PCR identification primers for colorectal cancer.

3) Multiplex PCR primer combination optimization

Performing combined pairing according to the primer probe combination screened in the step 2), and performing further screening through PCR amplification, wherein the combined pairing is shown in the following table:

numbering	Multiplex PCR primer combination
		P1	NDRG4-1、SPG20-2、3OST2-1、ING1-1
P2	NDRG4-1、SPG20-2、3OST2-3、ING1-1
		P3	NDRG4-1、SPG20-3、3OST2-1、ING1-1
P4	NDRG4-1、SPG20-3、3OST2-3、ING1-1
		P5	NDRG4-2、SPG20-2、3OST2-1、ING1-1
P6	NDRG4-2、SPG20-2、3OST2-3、ING1-1
		P7	NDRG4-2、SPG20-3、3OST2-1、ING1-1
P8	NDRG4-2、SPG20-3、3OST2-3、ING1-1
		P9	NDRG4-1、SPG20-2、3OST2-1、ING1-3
P10	NDRG4-1、SPG20-2、3OST2-3、ING1-3
		P11	NDRG4-1、SPG20-3、3OST2-1、ING1-3
P12	NDRG4-1、SPG20-3、3OST2-3、ING1-3
		P13	NDRG4-2、SPG20-2、3OST2-1、ING1-3
P14	NDRG4-2、SPG20-2、3OST2-3、ING1-3
		P15	NDRG4-2、SPG20-3、3OST2-1、ING1-3
P16	NDRG4-2、SPG20-3、3OST2-3、ING1-3

As shown in FIG. 2, the combinations P1, P2, P7, P10, P11 and P14 have relatively poor multiplex PCR amplification effect, and P3, P4, P5, P6, P8, P9, P12, P13, P15 and P16 have relatively good multiplex PCR amplification effect and cover more than 30 methylated CpG sites, so that the combinations P3, P4, P5, P6, P8, P9, P12, P13, P15 and P16 are selected as multiplex PCR primer combinations.

Example 3: clinical sample detection and verification kit effect

1. Interpretation of colorectal cancer gene methylation detection kit result

1) Threshold setting

2) Kit validity determination

3) Sample validity determination

4) Determination of methylation detection result

2. And (3) feces sample colorectal cancer gene methylation detection results:

in order to evaluate that the probe and the primer provided by the invention can be used for detecting colorectal cancer NDRG4, SPG20, 3OST2 and ING1 gene methylation in a sample by fluorescence PCR, a DNA template derived from the same sample is divided into 18 parts, and the detection of the fluorescence PCR is completed under different detection systems of T1-T18, wherein the detection systems are shown in the following table:

numbering	Primer probe combination
		T1	NDRG4-1
T2	NDRG4-3
		T3	SPG20-2
T4	SPG20-3
		T5	3OST2-2
T6	3OST2-3
		T7	ING1-1
T8	ING1-3
		T9	NDRG4-1、SPG20-3、3OST2-1、ING1-1
T10	NDRG4-1、SPG20-3、3OST2-3、ING1-1
		T11	NDRG4-2、SPG20-2、3OST2-1、ING1-1
T12	NDRG4-2、SPG20-2、3OST2-3、ING1-1
		T13	NDRG4-2、SPG20-3、3OST2-3、ING1-1
T14	NDRG4-1、SPG20-2、3OST2-1、ING1-3
		T15	NDRG4-1、SPG20-3、3OST2-3、ING1-3
T16	NDRG4-2、SPG20-2、3OST2-1、ING1-3
		T17	NDRG4-2、SPG20-3、3OST2-1、ING1-3
T18	NDRG4-2、SPG20-3、3OST2-3、ING1-3

The methylation detection of 40 colorectal cancer confirmed patients and 10 healthy human fecal samples NDRG4, SPG20, 3OST2 and ING1 genes is respectively completed in a T1-T18 fluorescent PCR detection system, and the detection results are as follows:

as a result, when NDRG4 gene is singly amplified in 40 patients with confirmed colorectal cancer, the detection rate of T1 and T2 on the confirmed colorectal cancer is more than 75%; when the SPG20 gene is independently amplified, the detection rate of T3 and T4 to the confirmed colorectal cancer is more than 80%; when the 3OST2 gene is independently amplified, the detection rate of T5 and T6 to the confirmed colorectal cancer is more than 75%; when the ING1 gene is independently amplified, the detection rate of the T7 and the T8 to the confirmed colorectal cancer is more than 77.5 percent. And the detection rate of confirmed colorectal cancer by multiple PCR for multi-gene methylation detection reaches more than 90%. In 10 healthy human control samples, 1 of T2 and T6 showed false positive detection results and the detection specificity was 90%, while in other detection combinations, none of the healthy human control samples was detected and the detection specificity was 100%. The result shows that the colorectal cancer gene methylation detection kit provided by the invention has higher detection sensitivity and detection specificity when detecting the colorectal cancer feces sample gene methylation.

3. Tissue sample colorectal cancer gene methylation detection results:

15 patients diagnosed with colorectal cancer and 7 healthy human tissue samples NDRG4, SPG20, 3OST2 and ING1 gene methylation detection are respectively completed in a T1-T18 fluorescent PCR detection system, and the results are shown in the following table:

as a result, 12-15 colorectal cancer gene methylation positive samples are detected out of 15 patients with confirmed colorectal cancer, the detection rate is 80% -100%, the overall detection rate under all detection conditions is more than 80%, and the detection rate of confirmed colorectal cancer is more than 93% for multiple PCR of multiple gene methylation detection; in 7 healthy human control samples, the specificity of the detection method was 100%. The result shows that the colorectal cancer gene methylation detection kit provided by the invention has higher detection sensitivity and detection specificity when detecting the colorectal cancer tissue sample gene methylation.

4. Blood sample colorectal cancer gene methylation detection results:

the methylation detection of 14 colorectal cancer confirmed patients and 6 healthy human tissue samples NDRG4, SPG20, 3OST2 and ING1 genes is respectively completed in a T1-T18 fluorescent PCR detection system, and the results are shown in the following table:

as a result, 11-14 colorectal cancer gene methylation positive samples are detected out of 14 patients with confirmed colorectal cancer, the detection rate is 71% -100%, the overall detection rate under all detection conditions is greater than 71.4%, and the detection rate of confirmed colorectal cancer is more than 85% for multiple PCR of multiple gene methylation detection; in 6 healthy human control samples, the specificity of the detection method was 100%. The result shows that the colorectal cancer gene methylation detection kit provided by the invention has higher detection sensitivity and detection specificity when detecting the colorectal cancer blood sample gene methylation.

In conclusion, the colorectal cancer gene methylation detection kit provided by the invention has higher detection sensitivity and detection specificity, becomes an ideal choice for colorectal cancer diagnosis and early screening, and assists in early diagnosis and early treatment of colorectal cancer.

While the foregoing description shows and describes several preferred embodiments of the invention, it is to be understood, as noted above, that the invention is not limited to the forms disclosed herein, but is not to be construed as excluding other embodiments and is capable of use in various other combinations, modifications, and environments and is capable of changes within the scope of the inventive concept as expressed herein, commensurate with the above teachings, or the skill or knowledge of the relevant art. And that modifications and variations may be effected by those skilled in the art without departing from the spirit and scope of the invention as defined by the appended claims.

Sequence listing

<110> Guangzhou Dajian Biotechnology Ltd

Anhui Dajian medicine science and technology Limited

Primer probe combination for colorectal cancer gene methylation detection, kit and application thereof

<160> 39

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ggatggggat gtttttgtag gtt 23

<210> 2

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gcgacgtcga attcccg 17

<210> 3

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

attacggtag cgtcgttt 18

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

aaactaaacg aaaacgcgcg 20

<210> 5

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gagtcggcgg cgttttc 17

<210> 6

<211> 15

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aaccgcgacg acgaa 15

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ccctacgcct actacttcgc g 21

<210> 8

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aggatatttt cgggtttcga aaac 24

<210> 9

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tacccgccgt cgccgcct 18

<210> 10

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gcgcgtcgtg gaacgt 16

<210> 11

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gctacgctcg ccgaaaac 18

<210> 12

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

agcgcgcgcg cgaggtt 17

<210> 13

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gtttttcgga ggtttcggtt tc 22

<210> 14

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

atcccctacg accacgtcg 19

<210> 15

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

attgcgtagg cgtcgagta 19

<210> 16

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

tttgagtagg tcggtgatga attc 24

<210> 17

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gctcccgcca caaaacc 17

<210> 18

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

tgggtattta cgtgatttag gtt 23

<210> 19

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

ttggatagtt tttcggggag tagt 24

<210> 20

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

ccccgaaacg acaaactcc 19

<210> 21

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

tatcgttagg cggcggt 17

<210> 22

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

ggtttgtatg tcggcgcg 18

<210> 23

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

aactaaacac ccccaccacg 20

<210> 24

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

tttcgatttg gattcgtgtt t 21

<210> 25

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

cgtgttttag tttagggcgt gc 22

<210> 26

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

cccgctctcg acatctcg 18

<210> 27

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

tgttcgattt cgggttgtgt 20

<210> 28

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

cgtagtttaa aggatatcga gagggt 26

<210> 29

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

ccaaatcctc cgaaaaacga 20

<210> 30

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

tagtgcgtat gcgtcgtta 19

<210> 31

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

cgtttcggaa ttagagagtt aggc 24

<210> 32

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

cttccgacca aaaaacccg 19

<210> 33

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

aaggtacgag gttacgttt 19

<210> 34

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

tttaggacgt cggtcgatcg 20

<210> 35

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

aacaccgttc tcgaaaaccg 20

<210> 36

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

ttgtatattg tgggcggttt 20

<210> 37

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

aagttaggtt agtttggtag ggaagtt 27

<210> 38

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

aaccctaaac cacctcccc 19

<210> 39

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

tttgggtttt tttgggggta aggagatgt 29

Claims

1. The colorectal cancer gene methylation detection site is characterized by comprising one or more of NDRG4, SPG20, 3OST2 and ING 1.

2. PCR primer probe combination for detecting colorectal cancer gene methylation, and one or more of the following nucleic acid sequence combinations shown in 1) -4):

3. The PCR primer probe combination for detecting the methylation of colorectal cancer genes as claimed in claim 2, wherein the PCR primer probe combination further comprises PCR primers and probes for detecting the internal reference gene GAPDH, and comprises an upstream primer shown as SEQ ID No.37, a downstream primer shown as SEQ ID No.38 and a fluorescent probe shown as SEQ ID No. 39.

4. The PCR primer probe combination for detecting the methylation of colorectal cancer genes according to claim 2 or claim 3, wherein the 5' end of the fluorescent probe comprises a fluorescent reporter group comprising any one of FAM, HEX, NED, ROX, TET, JOE, TAMRA, CY3 and CY 5.

5. The PCR primer probe combination for detecting the methylation of colorectal cancer genes according to claim 2 or claim 3, wherein the 3' end of the fluorescent probe comprises a fluorescence quenching group, and the fluorescence quenching group comprises any one of MGB, BHQ-1, BHQ-2 and BHQ-3.

6. A kit for detecting colorectal cancer gene methylation, wherein the kit comprises the PCR primer probe combination of claim 2, and further comprises a positive quality control substance and a negative quality control substance.

7. The kit for detecting colorectal cancer gene methylation according to claim 6, wherein the final concentration composition of the kit reaction system comprises: 0.1-1 μ M PCR primer, 0.1-1 μ M probe.

8. The kit for detecting the methylation of colorectal cancer gene according to claim 6, wherein the kit comprises the following fluorescent quantitative PCR reaction conditions:

9. a colorectal cancer gene methylation detection method is characterized by comprising the following steps:

10. Use of the colorectal cancer gene methylation detection site according to claim 1, the PCR primer probe combination for colorectal cancer gene methylation detection according to claim 2, the colorectal cancer gene methylation detection kit according to claim 6, or the colorectal cancer gene methylation detection method according to claim 9 for preparing a kit for detecting colorectal cancer.