CN114085869A - Construction method and application of transgenic mouse specifically expressing human-derived SIRPG - Google Patents

Abstract

The invention discloses a construction method of a transgenic mouse for specifically expressing human-derived SIRPG, belonging to the technical field of biology, wherein the method is characterized in that a CRISPR-Cas9 gene knock-in technology is utilized to insert an exogenous gene hSIRPG, and the specific steps are as follows: constructing gRNA and Cas9 expression vectors based on a CRISPR-Cas9 system according to a mouse insertion site sequence, and respectively carrying out in vitro transcription to obtain gRNA and Cas9 mRNA; constructing a donor plasmid which contains an exogenous gene and is integrated into a host genome according to the action site of the gRNA, and then microinjecting Cas9mRNA, the gRNA and the donor plasmid obtained by in vitro transcription into a mouse fertilized egg; the invention provides an animal model for researching the function of SIRPG, exploring the effect of hSIRPG in the occurrence, development and treatment of human diseases, especially lung cancer, especially in targeted treatment, and provides convenience for screening inhibitors of targeted SIRPG.

Description

Construction method and application of transgenic mouse specifically expressing human-derived SIRPG

Technical Field

The invention relates to the technical field of biology, in particular to a construction method and application of a transgenic mouse for specifically expressing human SIRPG.

Background

Non-small cell lung cancer (NSCLC) accounts for about 85% of all lung cancers statistically. The 5-year survival rate of stage IIIA NSCLC is about 14%, and the 5-year survival rate of stage IIIB is about 5%. However, once NSCLC has progressed to stage iv and moved to a different location, it is difficult to treat. The 5-year survival rate of stage iv NSCLC is only 1%. Immunotherapy is one of the effective treatment options available for patients with advanced non-small cell lung cancer, such as: immunotherapy against PD1/PDL1, while benefiting some lung cancer patients, does not benefit the majority of patients. Thus, the search for new immunodetection point inhibitors may provide more selectivity to patients. In order to search for new immunodetection point inhibitors, functional mice are indispensable for research.

SIRPG (also known as SIRPgamma, SIRP-beta2, and CD172g) is a transmembrane glycoprotein with an extracellular immunoglobulin-like domain. It belongs to the family of signal-regulatory proteins, encoded by a set of genes located closely on human chromosome 20p13, and also includes SIRPA, SIRPB and soluble SIRPD. SIRPG is mainly expressed on T lymphocytes and activated NK cells. To date, no correlation of SIRPG with non-small cell lung cancer (NSCLC) has been reported.

In addition, since mice lack the SIRPG gene, researchers have not been able to study the role of SIRPG in mouse models using gene knockout techniques. Therefore, how to construct a mouse model for knocking-in human-derived SIRPG (i.e. hSIRPG) gene is a problem to be solved urgently in the field.

Disclosure of Invention

One of the objectives of the present invention is to provide a method for constructing a transgenic mouse specifically expressing human SIRPG, so as to solve the above problems.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows: a construction method of a transgenic mouse for specifically expressing human-derived SIRPG is characterized in that a CRISPR-Cas9 gene knock-in technology is utilized to insert an exogenous gene hSIRPG, and the specific steps are as follows: constructing gRNA and Cas9 expression vectors based on a CRISPR-Cas9 system according to a mouse insertion site sequence, and respectively carrying out in vitro transcription to obtain gRNA and Cas9 mRNA; constructing a donor plasmid which contains an exogenous gene and is integrated into a host genome according to the action site of the gRNA, and then microinjecting Cas9mRNA, the gRNA and the donor plasmid obtained by in vitro transcription into a mouse fertilized egg; transplanting the fertilized eggs survived after injection into a pseudopregnant female mouse, and obtaining a transgenic mouse after the fertilized eggs are pregnant and farrowing; wherein, the nucleotide sequence of the exogenous gene hSIRPG is shown as SEQ ID NO. 2, and the amino acid sequence of the coded protein is shown as SEQ ID NO. 1.

Based on previous research findings of the inventors of the present application: cancer cells in NSCLC patients highly express SIRPG (see fig. 2), and thus, the development of blockers or inhibitors against SIRPG in NSCLC cancer cells may be an important direction for treating NSCLC. However, as known by those skilled in the art, the SIRPG gene is deleted from the mouse, so the present application provides a method for constructing a mouse model of human SIRPG (i.e. hSIRPG) gene knock-in, thereby providing research conditions and convenience for related research.

The CRIPR/Cas system is an efficient, fast, simple and inexpensive gene editing technique. After the CRISPR-Cas system is successfully applied to mammalian cells from the initial report of the Zhang-Feng laboratory in 2013, the CRISPR-Cas system is widely applied to various animal models. At present, the CRISPR system most widely used is the type II CRISPR-Cas system, i.e. the CRISPR-Cas9 system. The invention adopts a CRISPR/Cas9 system to design, construct and transcribe gRNA in vitro, and simultaneously construct a homologous recombinant vector (Donor vector), thereby establishing a humanized gene knock-in transgenic mouse model.

As a preferred technical scheme: the nucleotide of the gRNA is shown in SEQ ID NO. 7: 5'-CTGAGCCAACAGTGGTAGTA-3' are provided.

As a preferred technical scheme: the exogenous gene is driven by CAG promoter (nucleotide sequence is shown as SEQ ID NO: 4), and a STOP sequence conditionally controlled by Cre recombinase is contained between the promoter and the exogenous gene.

As a further preferable technical scheme: the recombinase is Cre recombinase.

As a further preferred technical scheme: the STOP sequence is shown in SEQ ID NO 3.

As a further preferred technical scheme: the exogenous gene hSIRPG is linked with the fluorescent reporter gene through a P2A self-cutting peptide fragment, and the nucleotide sequence of the P2A self-cutting peptide fragment is shown as SEQ ID NO. 8:

GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGTCCT。

as a further preferable technical proposal: the fluorescent reporter gene encodes green fluorescent protein zsGreen, and the sequence of the fluorescent reporter gene is shown in SEQ ID NO. 5. Other fluorescent proteins may also be used, as will be appreciated by those skilled in the art.

As a preferred technical scheme: the 5 ' end of the hSIRPG gene is provided with a kozak sequence, and the kozak sequence is 5 ' -GCCGCCACC-3 ', so that the translation efficiency of a foreign gene can be enhanced; the mice were C57BL/6JGpt background mice.

The second object of the present invention is to provide the use of the transgenic mouse constructed by the above method, comprising: the constructed transgenic mouse and Kras^LSL_G12D/+Mating the mice to obtain hSIRPG^LSL_KI/-+Kras ^LSL_G12D/+Injecting Cre virus into the transgenic mouse through the nasal cavity, inducing the expression of hSIRPG in the lung of the transgenic mouse and the mutation of Kras, and observing the survival time of the transgenic mouse after the hSIRPG is knocked in; dissecting lung tissues of the mice, taking out, weighing, HE staining and observing the formation condition of tumors;

at KRAS^G12D/++SIRPG^KI/+After 8 weeks of transgenic mouse Cre virus injection, neutralizing antibody is injected every other day, then mouse lung tissue is dissected, taken out, weighed and subjected to HE staining, and the tumor formation condition is observed and counted.

The Cre virus is preferably Ad-Cre virus.

The neutralizing antibody is preferably an anti-SIRPG LSB2.20 antibody available from Santa Cruz.

The transgenic mice are also used for at least one of:

(1) observing the influence of the knock-in of the hSIRPG gene on the general physiological functions, especially the immune function of the transgenic mice;

(2) observing the influence of the knock-in hSIRPG gene on the infiltration of tumor tissue microenvironment immune cells;

(3) exploring the specific mechanism of tumor growth inhibition after targeting hSIRPG;

(4) research for hSIRPG monoclonal antibody;

(5) used for researching more functions of the hSIRPG gene.

The invention constructs hSIRPG^LSL_KI/+The transgenic mouse can explore the physiological function and pathological action of hSIRPG gene expression through the action with Cre recombinase, especially the influence on tumorigenesis, development and immunotherapy. Meanwhile, the invention also discloses hSIRPG^LSL_KI/+Mouse and Kras^LSL_G12D/+Co-breeding of mice to construct hSIRPG^LSL_KI/++Kras^LSL_G12D/+The transgenic mouse model provides an animal model for exploring the function of the hSIRPG in the growth of lung tumor and activating immune to inhibit the growth of tumor by targeting the hSIRPG.

Compared with the prior art, the invention has the advantages that: the invention provides an animal model for researching the function of the SIRPG, exploring the effect of the hSIRPG in the generation, development and treatment of human diseases, particularly lung cancer, particularly in targeted therapy, provides convenience for screening targeted SIRPG inhibitors, and has the advantages of high utilization value, strong practicability and the like.

Drawings

FIG. 1 is a schematic diagram of a design strategy of the construction method of the present invention; the transgenic mouse model adopts CRISPR/Cas9 technology to insert CAG-LSL-hSIRPG-P2A-ZsGreen gene segment into H11 site of mouse at fixed point;

FIG. 2 is an immunoblot of carcinoma and paracarcinoma tissues of a NSCLC patient; in 12 patients with NSCLC, SIRPG was significantly higher in cancer tissues (T) than in paracancerous tissues (a);

FIG. 3 is a map of a targeting vector for the sequences after recombination;

FIG. 4 is a schematic diagram of an authentication strategy;

wild type: a Target band is not obtained in the PCR reaction; PCR reaction to obtain single WT band;

heterozygote: firstly, PCR reaction can obtain Target bands; PCR reaction to obtain single WT band;

a homozygote: firstly, a Target strip can be obtained through PCR reaction; ③ PCR reaction does not obtain single WT band;

FIG. 5 shows KRAS^G12D/++SIRPG^KI/+Obtaining a strategy diagram of the transgenic mouse; the Cre virus is injected through a nasal cavity to induce the expression of hSIRPG in the lung of the transgenic mouse and the mutation of Kras.

FIG. 6 shows KRAS^G12D/+Transgenic mice and KRAS^G12D/++SIRPG^KI/+Pictures of untreated lung HE staining of transgenic mice;

FIG. 7 shows KRAS^G12D/+Transgenic mice and KRAS^G12D/++SIRPG^KI/+Comparison of the untreated survival curve, lung weight, tumor nodule number greater than 100 μm in diameter of the transgenic mice;

FIG. 8 shows KRAS^G12D/++SIRPG^KI/+After transgenic mice received the targeted hSIRPG neutralizing antibody, lung body weight of the control group, number of tumor nodules with diameter > 100 μm.

Detailed Description

The invention will be further explained with reference to the drawings.

Example 1

hSIRPG^LSL_KI/+Construction of transgenic mice

Transgenic mouse (hSIRPG) for specifically expressing human SIRPG^LSL_KI/+) The construction method comprises the following steps:

inserting CAG-LSL-hSIRPG-P2A-ZsGreen (the amino acid sequence of which is shown as SEQ ID NO: 6) into a mouse H11 site by using a CRISPR/Cas9 technology;

the schematic diagram of the principle is shown in figure 1, the sgRNA is designed around the insertion position, a plurality of sgRNAs are designed in the target site region based on the design principle of the sgRNA, the selected sgRNA (SEQ ID NO: 7: 5'-CTGAGCCAACAGTGGTAGTA-3') is connected to a plasmid vector pUC57 with a T7 promoter and is subjected to in vitro transcription, and the gRNA for microinjection is obtained;

designing a primer according to a target gene sequence, connecting a target gene (hSIRPG-P2A-zsGreen-pA) segment to a PMD-18T vector, namely a donor plasmid, wherein the plasmid map is shown in figure 3;

cas9mRNA, gRNA and donor plasmid are mixed according to an equal molar ratio, and are injected into mouse fertilized eggs in a microinjection way, and F0 mice are obtained after the injection till birth. The F0 mouse was obtained as a chimera due to the rapid rate of early cleavage of the embryo. Therefore, the F0 genotype identified by F0 mouse toes is only used as a reference and cannot represent a certain heritable gene mutant type, and the heritable genotype is determined after the F1 mouse toes are detected;

genotyping of transgenic mice (identification strategy as in figure 4):

1) the transgenic mice genotype identification is carried out by adopting a rat tail direct PCR kit (rapid genotype identification):

genome extraction of mouse tissue (toes): tissue lysate and protease were mixed as 100: 1, preparing.

2) Adding 50ul of the lysate to the tissue, and incubating at 55 ℃ for 30 minutes; then incubated at 95 ℃ for 5 minutes to catch fire protease.

3) The fragment of interest was amplified according to normal PCR procedures for genotyping mice.

4) Primer information for identifying hsrpg alleles table 1:

TABLE 1 primer sequences for the identification of hSIRPG alleles

The primer sequences in Table 1 are shown as SEQ ID NO 9-SEQ ID NO 14 in sequence.

Example 2

hSIRPG^LSL_KI/+Application of transgenic mice

Kras^LSL_G12D/+Transgenic mice (B6.129S4-Krast 4Tyj/Jnju, gifted to Sichuan university) carried a point mutation (G12D) whose expression was blocked by the presence of a loxP-flanking stop codon, which homozygote died in the uterus. Cre-mediated recombination can cleave off the stop codon, allowing the expression of oncogenic Kras proteins. Infection of Cre-encoding adenovirus via nasal cavity can lead to very high incidence of lung tumors, starting from studies of lung tumorsHas important function.

SIRPG has been reported to be expressed predominantly on T lymphocytes and activated NK cells. The inventor detects that cancer cells highly express SIRPG in lung cancer patients (as shown in figure 2), and the highly expressed SIRPG is involved in maintaining the dryness of tumor cells and the occurrence of immune escape. However, the mouse has no SIRPG gene in vivo, and the establishment of a mouse model with the knock-in of the hSIRPG gene can play a great value.

Therefore, the hSIRPG constructed in the example 1^LSL_KI/+Transgenic mice and Kras^LSL_G12D/+Mating the transgenic mice to obtain hSIRPG with the genotype of hSIRPG^LSL_KI/++Kras^LSL_G12D/+The progeny mouse of (3). Adeno-Cre virus can be injected through a nasal cavity, so that lung tissues can specifically express Cre recombinase, and the gene type hSIRPG is generated by shearing a stop sequence^KI/++Kras^G12D/+Lung tissue of the progeny mice specifically express hsrpg. The breeding strategy is shown in FIG. 5. Transgenic mice were genotyped by the methods described previously.

Kras^LSL_G12D+Transgenic mouse primer information:

①GTCGACAAGCTCATGCGGG(SEQ ID NO:15)

②CGCAGACTGTAGAGCAGCG(SEQ ID NO:16)

③CCATGGCTTGAGTAAGTCTGC(SEQ ID NO:17)

(ii) the wild type is 507 bp;

(ii) indicates that the mutation is 600 bp.

Recording and observing KRAS^G12D/+And KRAS^G12D/++SIRPG^KI/+Survival time of the transgenic mice; and (3) dissecting lung tissues of the mice, taking out, weighing, HE staining, observing the tumor formation condition and making statistics. The results of HE staining of lung tissues of mice are shown in fig. 6, and the statistical results of survival time, lung tissue weight and lung nodule number of mice are shown in fig. 7. The result shows that the knock-in of the hSIRPG gene obviously promotes the growth of tumors, so that the number of tumor nodules is obviously increased, the tumor burden of a mouse is obviously increased, the survival capability of the mouse is obviously weakened, and the survival time is obviously shortened, thereby proving that the invention can provide an accurate and reliable transgenic mouse model for the influence of the hSIRPG gene on lung cancer;

in KRAS^G12D/++SIRPG^KI/+After 8 weeks of age of transgenic mice Cre virus injection, neutralizing antibody (IgG 50. mu.g/time; anti-SIRPG LSB 2.20/50. mu.g/time) was given every other day for a total of 4 treatments. The lung tissue of the mice was dissected, taken out, weighed and HE stained, and the tumor formation was observed and counted. The results of the statistics of lung tissue weight and lung nodule number in mice are shown in FIG. 8. The result shows that the knock-in of the hSIRPG gene promotes the growth of tumors, but the neutralizing antibody targeting the hSIRPG obviously improves the tumor burden of a gene knock-in mouse, and the number of lung nodules is obviously reduced; the invention proves that the invention can provide an accurate and reliable transgenic mouse model for the research of lung cancer treatment of the targeted hSIRPG gene, and is beneficial to the further research in the field.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> xuchuan

Wu hong (Wu hong)

Liu Yi Qiang (Strong Liu Yi)

Jiang Tao

<120> construction method and application of transgenic mouse specifically expressing human SIRPG

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 387

<212> PRT

<213> human (Homo sapiens)

<400> 1

Met Pro Val Pro Ala Ser Trp Pro His Pro Pro Gly Pro Phe Leu Leu

1 5 10 15

Leu Thr Leu Leu Leu Gly Leu Thr Glu Val Ala Gly Glu Glu Glu Leu

20 25 30

Gln Met Ile Gln Pro Glu Lys Leu Leu Leu Val Thr Val Gly Lys Thr

35 40 45

Ala Thr Leu His Cys Thr Val Thr Ser Leu Leu Pro Val Gly Pro Val

50 55 60

Leu Trp Phe Arg Gly Val Gly Pro Gly Arg Glu Leu Ile Tyr Asn Gln

65 70 75 80

Lys Glu Gly His Phe Pro Arg Val Thr Thr Val Ser Asp Leu Thr Lys

85 90 95

Arg Asn Asn Met Asp Phe Ser Ile Arg Ile Ser Ser Ile Thr Pro Ala

100 105 110

Asp Val Gly Thr Tyr Tyr Cys Val Lys Phe Arg Lys Gly Ser Pro Glu

115 120 125

Asn Val Glu Phe Lys Ser Gly Pro Gly Thr Glu Met Ala Leu Gly Ala

130 135 140

Lys Pro Ser Ala Pro Val Val Leu Gly Pro Ala Ala Arg Thr Thr Pro

145 150 155 160

Glu His Thr Val Ser Phe Thr Cys Glu Ser His Gly Phe Ser Pro Arg

165 170 175

Asp Ile Thr Leu Lys Trp Phe Lys Asn Gly Asn Glu Leu Ser Asp Phe

180 185 190

Gln Thr Asn Val Asp Pro Thr Gly Gln Ser Val Ala Tyr Ser Ile Arg

195 200 205

Ser Thr Ala Arg Val Val Leu Asp Pro Trp Asp Val Arg Ser Gln Val

210 215 220

Ile Cys Glu Val Ala His Val Thr Leu Gln Gly Asp Pro Leu Arg Gly

225 230 235 240

Thr Ala Asn Leu Ser Glu Ala Ile Arg Val Pro Pro Thr Leu Glu Val

245 250 255

Thr Gln Gln Pro Met Arg Val Gly Asn Gln Val Asn Val Thr Cys Gln

260 265 270

Val Arg Lys Phe Tyr Pro Gln Ser Leu Gln Leu Thr Trp Ser Glu Asn

275 280 285

Gly Asn Val Cys Gln Arg Glu Thr Ala Ser Thr Leu Thr Glu Asn Lys

290 295 300

Asp Gly Thr Tyr Asn Trp Thr Ser Trp Phe Leu Val Asn Ile Ser Asp

305 310 315 320

Gln Arg Asp Asp Val Val Leu Thr Cys Gln Val Lys His Asp Gly Gln

325 330 335

Leu Ala Val Ser Lys Arg Leu Ala Leu Glu Val Thr Val His Gln Lys

340 345 350

Asp Gln Ser Ser Asp Ala Thr Pro Gly Pro Ala Ser Ser Leu Thr Ala

355 360 365

Leu Leu Leu Ile Ala Val Leu Leu Gly Pro Ile Tyr Val Pro Trp Lys

370 375 380

Gln Lys Thr

385

<210> 2

<211> 1161

<212> DNA

<213> human (Homo sapiens)

<400> 2

atgcctgtcc cagcctcctg gccccatcct cctggtcctt tcctgcttct gactctactg 60

ctgggactta cagaagtggc aggtgaggag gagctacaga tgattcagcc tgagaagctc 120

ctgttggtca cagttggaaa gacagccact ctgcactgca ctgtgacctc cctgcttccc 180

gtgggacccg tcctgtggtt cagaggagtt ggaccaggcc gggaattaat ctacaatcaa 240

aaagaaggcc acttccccag ggtaacaaca gtttcagacc tcacaaagag aaacaacatg 300

gacttttcca tccgcatcag tagcatcacc ccagcagatg tcggcacata ctactgtgtg 360

aagtttcgaa aagggagccc tgagaacgtg gagtttaagt ctggaccagg cactgagatg 420

gctttgggtg ccaaaccctc tgcccccgtg gtattgggcc ctgcggcgag gaccacacct 480

gagcatacag tgagtttcac ctgtgagtcc catggcttct ctcccagaga catcaccctg 540

aaatggttca aaaatgggaa tgagctctca gacttccaga ccaacgtgga ccccacagga 600

cagagtgtgg cctacagcat ccgcagcaca gccagggtgg tactggaccc ctgggacgtt 660

cgctctcagg tcatctgcga ggtggcccat gtcaccttgc agggggaccc tcttcgtggg 720

actgccaact tgtctgaggc catccgagtt ccacccacct tggaggttac tcaacagccc 780

atgagggtgg ggaaccaggt aaacgtcacc tgccaggtga ggaagttcta cccccagagc 840

ctacagctga cctggtcgga gaatggaaac gtgtgccaga gagaaacagc ctcgaccctt 900

acagagaaca aggatggtac ctacaactgg acaagctggt tcctggtgaa catatctgac 960

caaagggatg atgtggtcct cacctgccag gtgaagcatg atgggcagct ggcggtcagc 1020

aaacgccttg ccctagaggt cacagtccac cagaaggacc agagctcaga tgctacccct 1080

ggcccggcat catcccttac tgcgctgctc ctcatagctg tcctcctggg ccccatctac 1140

gtcccctgga agcagaagac c 1161

<210> 3

<211> 1662

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ataacttcgt atagcataca ttatacgaag ttatctgtaa gtctgcagaa attgatgatc 60

tattaaacaa taaagatgtc cactaaaatg gaagtttttc ctgtcatact ttgttaagaa 120

gggtgagaac agagtaccta cattttgaat ggaaggattg gagctacggg ggtgggggtg 180

gggtgggatt agataaatgc ctgctcttta ctgaaggctc tttactattg ctttatgata 240

atgtttcata gttggatatc ataatttaaa caagcaaaac caaattaagg gccagctcat 300

tcctcccact catgatctat agatctatag atctctcgtg ggatcattgt ttttctcttg 360

attcccactt tgtggttcta agtactgtgg tttccaaatg tgtcagtttc atagcctgaa 420

gaacgagatc agcagcctct gttccacata cacttcattc tcagtattgt tttgccaagt 480

tctaattcca tcagaagctt gcagatctgc gactctagag gatcgactgt gccttctagt 540

tgccagccat ctgttgtttg cccctccccc gtgccttcct tgaccctgga aggtgccact 600

cccactgtcc tttcctaata aaatgaggaa attgcatcgc attgtctgag taggtgtcat 660

tctattctgg ggggtggggt ggggcaggac agcaaggggg aggattggga agacaatagc 720

aggcatgctg gggatgcggt gggctctatg gctgcgactc tagaggatca taatcagcca 780

taccacattt gtagaggttt tacttgcttt aaaaaacgtt taaacctccc acacctcccc 840

ctgaacctga aacataaaat gaatgcaatt gttgttgtta acttgtttat tgcagcttat 900

aatggttaca aataaagcaa tagcatcaca aatttcacaa ataaagcatt tttttcactg 960

cattctagtt gtggtttgtc caaactcatc aatgtatctt atcatgtctg gatctgcgac 1020

tctagaggat cataatcagc cataccacat ttgtagaggt tttacttgct ttaaaaaacc 1080

tcccacacct ccccctgaac ctgaaacata aaatgaatgc aattgttgtt gttaacttgt 1140

ttattgcagc ttataatggt tacaaataaa gcaatagcat cacaaatttc acaaataaag 1200

catttttttc actgcattct agttgtggtt tgtccaaact catcaatgta tcttatcatg 1260

tctggatctg cgactctaga ggatcataat cagccatacc acatttgtag aggttttact 1320

tgctttaaaa aacctcccac acctccccct gaacctgaaa cataaaatga atgcaattgt 1380

tgttgttaac ttgtttattg cagcttataa tggttacaaa taaagcaata gcatcacaaa 1440

tttcacaaat aaagcatttt tttcactgca ttctagttgt ggtttgtcca aactcatcaa 1500

tgtatcttat catgtctgga tccccatcaa gctgataaca tacgctctcc atcaaaacaa 1560

aacgaaacaa aacaaactag caaaataggc tgtccccagt gcaagtgcag gtgccagaac 1620

atttctctat aacttcgtat agcatacatt atacgaagtt at 1662

<210> 4

<211> 1720

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gacattgatt attgactagt tattaatagt aatcaattac ggggtcatta gttcatagcc 60

catatatgga gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca 120

acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga 180

ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 240

aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 300

ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 360

tagtcatcgc tattaccatg gtcgaggtga gccccacgtt ctgcttcact ctccccatct 420

cccccccctc cccaccccca attttgtatt tatttatttt ttaattattt tgtgcagcga 480

tgggggcggg gggggggggc gcgcgccagg cggggcgggg cggggcgagg ggcggggcgg 540

ggcgaggcgg agaggtgcgg cggcagccaa tcagagcggc gcgctccgaa agtttccttt 600

tatggcgagg cggcggcggc ggcggcccta taaaaagcga agcgcgcggc gggcgggagt 660

cgctgcgcgc tgccttcgcc ccgtgccccg ctccgccgcc gcctcgcgcc gcccgccccg 720

gctctgactg accgcgttac tcccacaggt gagcgggcgg gacggccctt ctcctccggg 780

ctgtaattag cgcttggttt aatgacggct tgtttctttt ctgtggctgc gtgaaagcct 840

tgaggggctc cgggagggcc ctttgtgcgg ggggagcggc tcggggggtg cgtgcgtgtg 900

tgtgtgcgtg gggagcgccg cgtgcggctc cgcgctgccc ggcggctgtg agcgctgcgg 960

gcgcggcgcg gggctttgtg cgctccgcag tgtgcgcgag gggagcgcgg ccgggggcgg 1020

tgccccgcgg tgcggggggg gctgcgaggg gaacaaaggc tgcgtgcggg gtgtgtgcgt 1080

gggggggtga gcagggggtg tgggcgcgtc ggtcgggctg caaccccccc tgcacccccc 1140

tccccgagtt gctgagcacg gcccggcttc gggtgcgggg ctccgtacgg ggcgtggcgc 1200

ggggctcgcc gtgccgggcg gggggtggcg gcaggtgggg gtgccgggcg gggcggggcc 1260

gcctcgggcc ggggagggct cgggggaggg gcgcggcggc ccccggagcg ccggcggctg 1320

tcgaggcgcg gcgagccgca gccattgcct tttatggtaa tcgtgcgaga gggcgcaggg 1380

acttcctttg tcccaaatct gtgcggagcc gaaatctggg aggcgccgcc gcaccccctc 1440

tagcgggcgc ggggcgaagc ggtgcggcgc cggcaggaag gaaatgggcg gggagggcct 1500

tcgtgcgtcg ccgcgccgcc gtccccttct ccctctccag cctcggggct gtccgcgggg 1560

ggacggctgc cttcgggggg gacggggcag ggcggggttc ggcttctggc gtgtgaccgg 1620

cggctctaga gcctctgcta accatgttca tgccttcttc tttttcctac agctcctggg 1680

caacgtgctg gttattgtgc tgtctcatca ttttggcaaa 1720

<210> 5

<211> 693

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atggcccagt ccaagcacgg cctgaccaag gagatgacca tgaagtaccg catggagggc 60

tgcgtggacg gccacaagtt cgtgatcacc ggcgagggca tcggctaccc cttcaagggc 120

aagcaggcca tcaacctgtg cgtggtggag ggcggcccct tgcccttcgc cgaggacatc 180

ttgtccgccg ccttcatgta cggcaaccgc gtgttcaccg agtaccccca ggacatcgtc 240

gactacttca agaactcctg ccccgccggc tacacctggg accgctcctt cctgttcgag 300

gacggcgccg tgtgcatctg caacgccgac atcaccgtga gcgtggagga gaactgcatg 360

taccacgagt ccaagttcta cggcgtgaac ttccccgccg acggccccgt gatgaagaag 420

atgaccgaca actgggagcc ctcctgcgag aagatcatcc ccgtgcccaa gcagggcatc 480

ttgaagggcg acgtgagcat gtacctgctg ctgaaggacg gtggccgctt gcgctgccag 540

ttcgacaccg tgtacaaggc caagtccgtg ccccgcaaga tgcccgactg gcacttcatc 600

cagcacaagc tgacccgcga ggaccgcagc gacgccaaga accagaagtg gcacctgacc 660

gagcacgcca tcgcctccgg ctccgccttg ccc 693

<210> 6

<211> 9060

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atttccagga gcaatagtta tcactgcccc tttgtttctt aggtgtcact agaaaaacag 60

gtgaagtgaa ctgacctgtg cagtctcagg gattattact actgcaagga cagtcggagc 120

cagccatgct ctagctctgt ttttcacttc ttataagcct gagaattttt gctgagatgt 180

gaacatgtca gccttggtgg gctttcttac gttgcatttt cttacgttgc attttgcact 240

ttaggaagcc tttggttaaa tcctctggta gacttcccat cccccaaagt aacaaaccat 300

tcaagcaaag taggtcagaa aatattgtca atactgagaa caggacttgg gagtgagtat 360

ccaagggtgg tcttagtaga cttgtggggt tctgtgggtg aggtgtagag tagagctact 420

ttgctgcact gacactcttc tctccatagt tctgcatcct ccaggctcta gttcccaggc 480

agcagctatc agcgttcaga ctcctcagaa tgtacccagc cggtcgggca tgccccacat 540

gcactcccag ctggagcatc gtaccagcca aaggagcagc tcccctgtgg gccttgccaa 600

atggtttggc tcagatgtgc tacagcagcc tctgccctcc atgcccacca aagtcatcag 660

tgtagatgaa ctggaatata gacagtgaag agggcaggct ggctcaccca tacctggacc 720

tgtggtgaca ccctggtcat gactctcatt ccctctttgt aatgggcttt tacattggag 780

cacactatgt gaagatgttt aggggatcca catacctacc atgatctaca ttatgacaga 840

aggctgttaa atcgaatgaa cctacatggt tcaaatacaa gggatacaag attgtcagtc 900

ctggaagtct ttcttttata aaatatgtga atgaagtgtt ggtgtcttct agaggtgaca 960

cctaagggtt ctgaaaaaat aaaatgtata gacccttatg tacagacctg tgtataaact 1020

tttgtacata caaatagggt agcttttttt gaacttatac atacagctgt acataaagta 1080

actatcagtt aggcttgtgt caactgtttg gatttttttc acttgaatat ttgggacttt 1140

ttcttttggt ttattaaaag ttacatatgc cacgtgtgtg aacgatatgg ctggtactgt 1200

gtttatttct tccatgaact aagacagtct aaatgagttc ctttcacgtt ttaattttac 1260

cttaggactt ctggaatttc ttctgcacat aaagttctga tagcattagt ttaagctgga 1320

ctaaccctga aagtagcttg tggcaagtat caaggaatca atattatact ctacaaaatc 1380

aaagtttaca gagaagtcat atagtaattt ttctgaaatt tactggcaca atgttaatcc 1440

agcctgactc caactaatta atggtcacat taatttaagt ctttcccttg cctctgctgc 1500

attagtttct ctcaaaattg ttaacttaca acttgaagtc tggtattata aattgaatgt 1560

aaagcattct gaaagatact atactgattg caggtttttc agtcaggttc aagctaattt 1620

gaccagtcat tggattaatt atggatctgg ggccataaat gctattttaa ttccactata 1680

gagattaaaa taagccattc tccatttcat aatattctat tggactttga ctgcaggggc 1740

ctccaagtct tgacagtaga ttataatcct tcagctgccc actctactgg aggaggacaa 1800

actggtcact tttcagcaaa acctggctgt ggatcagggc agtctggtac ttccaagctc 1860

attagatgcc atcatgctct cactgcctcc tcagcttcaa gaggaatctg gaaaaagcag 1920

tcccactggt caggaaagga acactagtgc acttatcctg ggtgtctgct gagctcgaga 1980

gtcgacctta attaagtcga cattgattat tgactagtta ttaatagtaa tcaattacgg 2040

ggtcattagt tcatagccca tatatggagt tccgcgttac ataacttacg gtaaatggcc 2100

cgcctggctg accgcccaac gacccccgcc cattgacgtc aataatgacg tatgttccca 2160

tagtaacgcc aatagggact ttccattgac gtcaatgggt ggagtattta cggtaaactg 2220

cccacttggc agtacatcaa gtgtatcata tgccaagtac gccccctatt gacgtcaatg 2280

acggtaaatg gcccgcctgg cattatgccc agtacatgac cttatgggac tttcctactt 2340

ggcagtacat ctacgtatta gtcatcgcta ttaccatggt cgaggtgagc cccacgttct 2400

gcttcactct ccccatctcc cccccctccc cacccccaat tttgtattta tttatttttt 2460

aattattttg tgcagcgatg ggggcggggg gggggggcgc gcgccaggcg gggcggggcg 2520

gggcgagggg cggggcgggg cgaggcggag aggtgcggcg gcagccaatc agagcggcgc 2580

gctccgaaag tttcctttta tggcgaggcg gcggcggcgg cggccctata aaaagcgaag 2640

cgcgcggcgg gcgggagtcg ctgcgcgctg ccttcgcccc gtgccccgct ccgccgccgc 2700

ctcgcgccgc ccgccccggc tctgactgac cgcgttactc ccacaggtga gcgggcggga 2760

cggcccttct cctccgggct gtaattagcg cttggtttaa tgacggcttg tttcttttct 2820

gtggctgcgt gaaagccttg aggggctccg ggagggccct ttgtgcgggg ggagcggctc 2880

ggggggtgcg tgcgtgtgtg tgtgcgtggg gagcgccgcg tgcggctccg cgctgcccgg 2940

cggctgtgag cgctgcgggc gcggcgcggg gctttgtgcg ctccgcagtg tgcgcgaggg 3000

gagcgcggcc gggggcggtg ccccgcggtg cggggggggc tgcgagggga acaaaggctg 3060

cgtgcggggt gtgtgcgtgg gggggtgagc agggggtgtg ggcgcgtcgg tcgggctgca 3120

accccccctg cacccccctc cccgagttgc tgagcacggc ccggcttcgg gtgcggggct 3180

ccgtacgggg cgtggcgcgg ggctcgccgt gccgggcggg gggtggcggc aggtgggggt 3240

gccgggcggg gcggggccgc ctcgggccgg ggagggctcg ggggaggggc gcggcggccc 3300

ccggagcgcc ggcggctgtc gaggcgcggc gagccgcagc cattgccttt tatggtaatc 3360

gtgcgagagg gcgcagggac ttcctttgtc ccaaatctgt gcggagccga aatctgggag 3420

gcgccgccgc accccctcta gcgggcgcgg ggcgaagcgg tgcggcgccg gcaggaagga 3480

aatgggcggg gagggccttc gtgcgtcgcc gcgccgccgt ccccttctcc ctctccagcc 3540

tcggggctgt ccgcgggggg acggctgcct tcggggggga cggggcaggg cggggttcgg 3600

cttctggcgt gtgaccggcg gctctagagc ctctgctaac catgttcatg ccttcttctt 3660

tttcctacag ctcctgggca acgtgctggt tattgtgctg tctcatcatt ttggcaaaat 3720

aacttcgtat agcatacatt atacgaagtt atctgtaagt ctgcagaaat tgatgatcta 3780

ttaaacaata aagatgtcca ctaaaatgga agtttttcct gtcatacttt gttaagaagg 3840

gtgagaacag agtacctaca ttttgaatgg aaggattgga gctacggggg tgggggtggg 3900

gtgggattag ataaatgcct gctctttact gaaggctctt tactattgct ttatgataat 3960

gtttcatagt tggatatcat aatttaaaca agcaaaacca aattaagggc cagctcattc 4020

ctcccactca tgatctatag atctatagat ctctcgtggg atcattgttt ttctcttgat 4080

tcccactttg tggttctaag tactgtggtt tccaaatgtg tcagtttcat agcctgaaga 4140

acgagatcag cagcctctgt tccacataca cttcattctc agtattgttt tgccaagttc 4200

taattccatc agaagcttgc agatctgcga ctctagagga tcgactgtgc cttctagttg 4260

ccagccatct gttgtttgcc cctcccccgt gccttccttg accctggaag gtgccactcc 4320

cactgtcctt tcctaataaa atgaggaaat tgcatcgcat tgtctgagta ggtgtcattc 4380

tattctgggg ggtggggtgg ggcaggacag caagggggag gattgggaag acaatagcag 4440

gcatgctggg gatgcggtgg gctctatggc tgcgactcta gaggatcata atcagccata 4500

ccacatttgt agaggtttta cttgctttaa aaaacgttta aacctcccac acctccccct 4560

gaacctgaaa cataaaatga atgcaattgt tgttgttaac ttgtttattg cagcttataa 4620

tggttacaaa taaagcaata gcatcacaaa tttcacaaat aaagcatttt tttcactgca 4680

ttctagttgt ggtttgtcca aactcatcaa tgtatcttat catgtctgga tctgcgactc 4740

tagaggatca taatcagcca taccacattt gtagaggttt tacttgcttt aaaaaacctc 4800

ccacacctcc ccctgaacct gaaacataaa atgaatgcaa ttgttgttgt taacttgttt 4860

attgcagctt ataatggtta caaataaagc aatagcatca caaatttcac aaataaagca 4920

tttttttcac tgcattctag ttgtggtttg tccaaactca tcaatgtatc ttatcatgtc 4980

tggatctgcg actctagagg atcataatca gccataccac atttgtagag gttttacttg 5040

ctttaaaaaa cctcccacac ctccccctga acctgaaaca taaaatgaat gcaattgttg 5100

ttgttaactt gtttattgca gcttataatg gttacaaata aagcaatagc atcacaaatt 5160

tcacaaataa agcatttttt tcactgcatt ctagttgtgg tttgtccaaa ctcatcaatg 5220

tatcttatca tgtctggatc cccatcaagc tgataacata cgctctccat caaaacaaaa 5280

cgaaacaaaa caaactagca aaataggctg tccccagtgc aagtgcaggt gccagaacat 5340

ttctctataa cttcgtatag catacattat acgaagttat tctgaggcgg aaagaaccag 5400

gccgccacca tgcctgtccc agcctcctgg ccccatcctc ctggtccttt cctgcttctg 5460

actctactgc tgggacttac agaagtggca ggtgaggagg agctacagat gattcagcct 5520

gagaagctcc tgttggtcac agttggaaag acagccactc tgcactgcac tgtgacctcc 5580

ctgcttcccg tgggacccgt cctgtggttc agaggagttg gaccaggccg ggaattaatc 5640

tacaatcaaa aagaaggcca cttccccagg gtaacaacag tttcagacct cacaaagaga 5700

aacaacatgg acttttccat ccgcatcagt agcatcaccc cagcagatgt cggcacatac 5760

tactgtgtga agtttcgaaa agggagccct gagaacgtgg agtttaagtc tggaccaggc 5820

actgagatgg ctttgggtgc caaaccctct gcccccgtgg tattgggccc tgcggcgagg 5880

accacacctg agcatacagt gagtttcacc tgtgagtccc atggcttctc tcccagagac 5940

atcaccctga aatggttcaa aaatgggaat gagctctcag acttccagac caacgtggac 6000

cccacaggac agagtgtggc ctacagcatc cgcagcacag ccagggtggt actggacccc 6060

tgggacgttc gctctcaggt catctgcgag gtggcccatg tcaccttgca gggggaccct 6120

cttcgtggga ctgccaactt gtctgaggcc atccgagttc cacccacctt ggaggttact 6180

caacagccca tgagggtggg gaaccaggta aacgtcacct gccaggtgag gaagttctac 6240

ccccagagcc tacagctgac ctggtcggag aatggaaacg tgtgccagag agaaacagcc 6300

tcgaccctta cagagaacaa ggatggtacc tacaactgga caagctggtt cctggtgaac 6360

atatctgacc aaagggatga tgtggtcctc acctgccagg tgaagcatga tgggcagctg 6420

gcggtcagca aacgccttgc cctagaggtc acagtccacc agaaggacca gagctcagat 6480

gctacccctg gcccggcatc atcccttact gcgctgctcc tcatagctgt cctcctgggc 6540

cccatctacg tcccctggaa gcagaagacc ggaagcggag ctactaactt cagcctgctg 6600

aagcaggctg gcgacgtgga ggagaaccct ggtcctatgg cccagtccaa gcacggcctg 6660

accaaggaga tgaccatgaa gtaccgcatg gagggctgcg tggacggcca caagttcgtg 6720

atcaccggcg agggcatcgg ctaccccttc aagggcaagc aggccatcaa cctgtgcgtg 6780

gtggagggcg gccccttgcc cttcgccgag gacatcttgt ccgccgcctt catgtacggc 6840

aaccgcgtgt tcaccgagta cccccaggac atcgtcgact acttcaagaa ctcctgcccc 6900

gccggctaca cctgggaccg ctccttcctg ttcgaggacg gcgccgtgtg catctgcaac 6960

gccgacatca ccgtgagcgt ggaggagaac tgcatgtacc acgagtccaa gttctacggc 7020

gtgaacttcc ccgccgacgg ccccgtgatg aagaagatga ccgacaactg ggagccctcc 7080

tgcgagaaga tcatccccgt gcccaagcag ggcatcttga agggcgacgt gagcatgtac 7140

ctgctgctga aggacggtgg ccgcttgcgc tgccagttcg acaccgtgta caaggccaag 7200

tccgtgcccc gcaagatgcc cgactggcac ttcatccagc acaagctgac ccgcgaggac 7260

cgcagcgacg ccaagaacca gaagtggcac ctgaccgagc acgccatcgc ctccggctcc 7320

gccttgccct aactagagct cgctgatcag cctcgactgt gccttctagt tgccagccat 7380

ctgttgtttg cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc 7440

tttcctaata aaatgaggaa attgcatcgc attgtctgag taggtgtcat tctattctgg 7500

ggggtggggt ggggcaggac agcaaggggg aggattggga agacaatagc aggcatgctg 7560

gggagtaagg gcaggatgtg tcaaactgcc aatagagaac tacttactct tcaggctgaa 7620

gctgatggaa caggtaacaa aggcaaacac taatcatgat cagcaagatg aagcagaaag 7680

ggaacaaggg gatattaaat gtgtatagac acgctagaga gatggctcag cagttaagag 7740

aactagctgg tctttcagag gtcctgagat caattttaga cacccacatg gtggctcatg 7800

accatctatc tataaatgga tctgattttc atgtctggca gtgtacagaa gctaactgaa 7860

gaaaggtgga agacccacaa gagttcaaga taagccctat atagtgaagt tcaaggcaag 7920

ctttttctac ctgaaactta gtctcaaaaa aaaatgaata cgtaaacagt cttccagggg 7980

ataagaacct tacagaaaaa gcagaaatgc ctggggcact ggattaccga tgtaatcaaa 8040

ttcagtcctt gaattgaaca caggattgcc tagagcaagg ccagccagag attcatctca 8100

gagggagaaa ggtgtctttg gagcaatttt gtggtaatct agtatgtatc acataagttt 8160

agacgcattt gggactggaa agatgtgaac aaagcaccct atggctcaca tctgtcatta 8220

actctagttc cagtgcacct gacaccgtct tctggcctct gcagtgacca agcacatggg 8280

tagtatgtag acatatacat aagcaaaaca cacatcatta aaaagtgaca tttcccaaag 8340

gaagctgaag aaccagttct tgagaagata gtagaaatca gaaggggaaa tagtagacat 8400

acagagggac tgaccaggtt gtgtcacctt tataggctag gctaatggat gatcgacact 8460

agcgctcttt gtgaaggaca cacaaatgag acatagttta taggactaaa cacacttcta 8520

agcaatttaa tgagacttaa gaccctgtct ctagcaaata ctctggatga tattcagctc 8580

aaggctcttg tcagacatgt ttccattttc aaggtgagct aactggccaa aactgccaac 8640

aacctgtagt gaatagagaa gatgagaaaa tctggattct caaatgacct aatgaaagcc 8700

actggagcgc catatggttt ctgtgaaaat gccttttcaa tcattaacct cttaaatgag 8760

tgttagcatc ctaactaatg agtggtgcag aatagtgggt ctgcttagct taactaaggc 8820

caagaaaaca aaacaggaaa ttcattccat gtcatgagac tcatactacg aggttccctt 8880

agacctcagg agaaaaagtc tttggctgta agaacacacc tcagtggatg tggtagacta 8940

tgcctttact cttttttttt tttttttttt tttttgggtt ttttcgagac agggtttctc 9000

tgtgtagcct tggctgtcct ggaactcact ttgttgacca ggctggcctc gaactcagag 9060

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ctgagccaac agtggtagta 20

<210> 8

<211> 66

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ggaagcggag ctactaactt cagcctgctg aagcaggctg gcgacgtgga ggagaaccct 60

ggtcct 66

<210> 9

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tcagcgttca gactcctcag aatgt 25

<210> 10

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tcaatggaaa gtccctattg gcgt 24

<210> 11

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

atcagcctcg actgtgcctt cta 23

<210> 12

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tcacagaaac catatggcgc tcc 23

<210> 13

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

agtctttccc ttgcctctgc t 21

<210> 14

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gggtcttcca cctttcttca g 21

<210> 15

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gtcgacaagc tcatgcggg 19

<210> 16

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

cgcagactgt agagcagcg 19

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

ccatggcttg agtaagtctg c 21

Claims (10)

1. A construction method of a transgenic mouse specifically expressing human SIRPG is characterized in that the method is characterized in that a CRISPR-Cas9 gene knock-in technology is used for inserting an exogenous gene hSIRPG, and the specific steps are as follows: constructing gRNA and Cas9 expression vectors based on a CRISPR-Cas9 system according to a mouse insertion site sequence, and respectively carrying out in vitro transcription to obtain gRNA and Cas9 mRNA; constructing a donor plasmid which contains an exogenous gene and is integrated into a host genome according to the action site of the gRNA, and then microinjecting Cas9mRNA, the gRNA and the donor plasmid obtained by in vitro transcription into a mouse fertilized egg; transplanting the fertilized eggs survived after injection into a pseudopregnant female mouse, and obtaining a transgenic mouse after the fertilized eggs are pregnant and farrowing; wherein, the nucleotide sequence of the exogenous gene hSIRPG is shown as SEQ ID NO. 2, and the amino acid sequence of the coded protein is shown as SEQ ID NO. 1.

2. The method of claim 1, wherein: the DNA sequence of the gRNA is 5'-CTGAGCCAACAGTGGTAGTA-3'.

3. The method of claim 1, wherein: the exogenous gene is driven by CAG promoter, and a STOP sequence conditionally controlled by Cre recombinase is contained between the promoter and the exogenous gene.

4. The method of claim 3, wherein: the recombinase is Cre recombinase.

5. The method of claim 3, wherein: the STOP sequence is shown in SEQ ID NO 3.

6. The method of claim 3, wherein: the exogenous gene hSIRPG and the fluorescent reporter gene are linked through a P2A self-cutting peptide segment, and the nucleotide sequence of the P2A self-cutting peptide segment is as follows: GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGTCCT are provided.

7. The method of claim 6, wherein: the fluorescent reporter gene encodes green fluorescent protein zsGreen, and the sequence of the fluorescent reporter gene is shown in SEQ ID NO. 5.

8. The method of claim 1, wherein: the 5 ' end of the hSIRPG gene is provided with a kozak sequence, and the kozak sequence is 5 ' -GCCGCCACC-3 '; the mice were C57BL/6JGpt background mice.

9. Use of a transgenic mouse constructed by the method of any one of claims 1 to 8, characterized in that: the constructed transgenic mouse and Kras ^LSL_G12D/+Mating the mice to obtain hSIRPG^LSL_KI/-+Kras ^LSL_G12D/+Injecting Cre virus into the transgenic mouse through the nasal cavity, inducing the expression of hSIRPG in the lung of the transgenic mouse and the mutation of Kras, and observing the survival time of the transgenic mouse after the hSIRPG is knocked in; dissecting lung tissues of the mice, taking out, weighing, HE staining and observing the formation condition of tumors;

in KRAS^G12D/++SIRPG^KI/+After 8 weeks of transgenic mouse Cre virus injection, neutralizing antibody is injected every other day, then mouse lung tissue is dissected, taken out, weighed and subjected to HE staining, and the tumor formation condition is observed and counted.

10. Use of a transgenic mouse constructed by the method of any one of claims 1 to 8, characterized in that: the transgenic mice are used for at least one of:

(1) observing the influence of the knock-in of the hSIRPG gene on the general physiological functions, particularly the immune function of the transgenic mice;

(2) observing the influence of the knock-in hSIRPG gene on the infiltration of tumor tissue microenvironment immune cells;

(3) exploring a specific mechanism for inhibiting the growth of the tumor after targeting the hSIRPG;

(4) research for hSIRPG monoclonal antibody;

(5) used for researching more functions of the hSIRPG gene.

Images