CN114085278A

CN114085278A - Application of Lsa25711 transit peptide in chloroplast genetic transformation

Info

Publication number: CN114085278A
Application number: CN202210062843.9A
Authority: CN
Inventors: 杨效曾; 杨靖; 王向峰
Original assignee: Beijing Academy of Agriculture and Forestry Sciences
Current assignee: Beijing Academy of Agriculture and Forestry Sciences
Priority date: 2022-01-20
Filing date: 2022-01-20
Publication date: 2022-02-25
Anticipated expiration: 2042-01-20
Also published as: CN114085278B

Abstract

The invention discloses application of Lsa25711 transit peptide in chloroplast genetic transformation. The Lsa25711 transit peptide provided by the invention is a protein shown in a 1) or a 2): a1) the amino acid sequence is a protein shown in a sequence 2; a2) and (b) a fusion protein obtained by connecting a tag to the N-terminal or/and the C-terminal of the protein shown in the sequence 2. Experiments prove that: the Lsa25711 transit peptide can guide target protein to chloroplast, and provides a new idea for chloroplast genetic transformation.

Description

Application of Lsa25711 transit peptide in chloroplast genetic transformation

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of Lsa25711 transit peptide in chloroplast genetic transformation.

Background

Plant cells contain a variety of different subcellular organelles, collectively referred to as "plastids," bounded by characteristic membrane systems and performing specialized functions within the cell. The pigments can be classified into yellow, red and orange color bodies, colorless white bodies, green chloroplasts, etioplasts in yellow seedlings, and the like.

In higher plants, the plastid of most interest is the chloroplast. The most essential function of chloroplasts is to perform a light-driven photosynthesis reaction. Chloroplasts are also involved in particularly important processes in the agrochemical industry. For example, many herbicides are known to act by blocking functions that operate within chloroplasts.

The precursor protein expressed to the chloroplast contains an N-terminal extension (extension) called the Chloroplast Transit Peptide (CTP). Transit peptides play a role in specific recognition at the chloroplast surface and are involved in mediating the transport of the precursor protein across the chloroplast membrane and into various sub-compartments within the chloroplast, such as the stroma, thylakoid and thylakoid membranes. Chloroplast transit peptides are critical for the entry of the precursor protein into the chloroplast.

However, due to the high diversity of transit peptide structures and the lack of common or consensus sequence motifs, how to support accurate protein import into chloroplasts and how to determine import specificity of transit peptides remains a challenge.

Disclosure of Invention

The invention aims to provide a transit peptide capable of guiding a target protein to chloroplast.

In order to achieve the above object, the present invention provides, in the first place, a transit peptide.

The transit peptide provided by the invention is derived from lettuce and is named as Lsa25711, and the Lsa25711 transit peptide is a protein shown in a 1) or a 2):

a1) the amino acid sequence is a protein shown in a sequence 2;

a2) and (b) a fusion protein obtained by connecting a tag to the N-terminal or/and the C-terminal of the protein shown in the sequence 2.

In the protein of a 2), the tag is a polypeptide or protein expressed by fusion with a target protein by using in vitro recombinant DNA technology, so as to facilitate the expression, detection, tracing and/or purification of the target protein. The tag may be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag, and/or a SUMO tag, among others.

The protein of a 1) or a 2) may be artificially synthesized, or may be obtained by synthesizing a gene encoding the protein and then performing biological expression.

In order to achieve the above object, the present invention further provides a biomaterial related to Lsa25711 transit peptide.

The biomaterial related to Lsa25711 transit peptide provided by the invention is any one of the following A1) to A8):

A1) a nucleic acid molecule encoding a Lsa25711 transit peptide;

A2) an expression cassette comprising the nucleic acid molecule of a 1);

A3) a recombinant vector comprising the nucleic acid molecule of a 1);

A4) a recombinant vector comprising the expression cassette of a 2);

A5) a recombinant microorganism comprising the nucleic acid molecule of a 1);

A6) a recombinant microorganism comprising the expression cassette of a 2);

A7) a recombinant microorganism comprising a 3) said recombinant vector;

A8) a recombinant microorganism comprising the recombinant vector of a 4).

In the above biological material, the nucleic acid molecule of A1) is a gene represented by the following 1) or 2):

1) the coding sequence is a DNA molecule shown in sequence 1;

2) a DNA molecule which has 75 percent or more than 75 percent of identity with the nucleotide sequence defined by 1) and codes Lsa25711 transit peptide.

The nucleotide sequence encoding the Lsa25711 transit peptide of the present invention can be easily mutated by a person of ordinary skill in the art using known methods, such as directed evolution and point mutation. Those nucleotides which are artificially modified to have 75% or more identity to the nucleotide sequence encoding the Lsa25711 transit peptide are derived from and identical to the nucleotide sequence of the present invention as long as they encode the Lsa25711 transit peptide and have the same function.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes nucleotide sequences that are 75% or more, or 85% or more, or 90% or more, or 95% or more identical to the nucleotide sequence of a protein consisting of the amino acid sequence shown in coding sequence 2 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.

The above-mentioned identity of 75% or more may be 80%, 85%, 90% or 95% or more.

In order to achieve the purpose, the invention also provides a new application of the Lsa25711 transport peptide or a biological material related to the Lsa25711 transport peptide.

The invention provides application of the Lsa25711 transit peptide or a biological material related to the Lsa25711 transit peptide in positioning target protein in chloroplast.

The invention also provides application of the Lsa25711 transit peptide or the biological material related to the Lsa25711 transit peptide in guiding target protein to chloroplast.

The invention also provides application of the Lsa25711 transit peptide or the biological material related to the Lsa25711 transit peptide in chloroplast genetic transformation.

In order to achieve the above object, the present invention also provides a method for localizing a target protein to chloroplasts.

The method for localizing the target protein in the chloroplast comprises the following steps: the Lsa25711 transit peptide and the target protein are subjected to fusion expression in a receptor plant, so that the target protein is positioned in chloroplast of the receptor plant.

In the above method, the Lsa25711 transit peptide is fused to the amino terminus of the target protein.

Furthermore, the method for performing fusion expression of the Lsa25711 transit peptide and the target protein in the recipient plant is to introduce a gene encoding a fusion protein formed by fusion of the Lsa25711 transit peptide and the target protein into the recipient plant.

Further, the gene encoding the fusion protein is introduced into a recipient plant via a recombinant expression vector.

The recombinant expression vector contains a DNA segment which sequentially consists of a nucleic acid molecule for encoding Lsa25711 transit peptide and a nucleic acid molecule for encoding target protein.

The method for introducing the encoding gene of the fusion protein into a receptor plant through a recombinant expression vector comprises the following steps: introducing the recombinant expression vector into agrobacterium to obtain a recombinant strain; and infecting a receptor plant by using the recombinant bacteria to realize transient transformation of the receptor plant.

The method for infecting the receptor plant by the recombinant bacteria can be an injection method.

The nucleic acid molecule for encoding the Lsa25711 transit peptide is a DNA molecule shown in sequence 1.

In a specific embodiment of the present invention, the recombinant vector is pYBA1132-Lsa25711-GFP, and the recombinant vector pYBA1132-Lsa25711-GFP is a vector obtained by replacing a DNA molecule between the XbaI and SalI cleavage sites of the vector pYBA1132 (the vector includes 184 bp NOS promoter, 795 bp NeoR/KanR, 253 bp NOS terminator and 346 bp CaMV 35S promoter) with a DNA molecule represented by sequence 1, and maintaining the other sequences of the vector pYBA1132 unchanged.

In order to achieve the above object, the present invention finally provides a fusion protein or a related biomaterial thereof; the fusion protein is formed by fusing Lsa25711 transit peptide and target protein; the biological material is a nucleic acid molecule encoding the fusion protein or an expression cassette or a recombinant vector or a recombinant microorganism containing the nucleic acid molecule.

The application of the method or the fusion protein or the nucleic acid molecule encoding the fusion protein or the expression cassette, the recombinant vector and the recombinant microorganism containing the nucleic acid molecule in chloroplast genetic transformation also belongs to the protection scope of the invention.

In any of the above methods or applications, the target protein may be any protein in the prior art, specifically GFP fluorescent protein.

In any of the above methods or uses, the plant is a chloroplast-containing plant. In a specific embodiment of the invention, the plant is tobacco (e.g., nicotiana benthamiana).

The invention provides a lettuce-derived Lsa25711 transit peptide, an encoding gene of the Lsa25711 transit peptide is fused with a target gene GFP, transient expression is carried out in tobacco to observe a chloroplast GFP fluorescence signal, and the result shows that the GFP signal can be positioned in chloroplast after the Lsa25711 transit peptide is connected to the amino terminal of the target protein GFP. The invention provides a new idea for chloroplast genetic transformation.

Drawings

FIG. 1 is a schematic structural diagram of pYBA1132-Lsa25711-GFP plasmid.

FIG. 2 shows PCR verification of transgenic tobacco Kan. Lane 1 is marker, and lanes 2-13 are Kan F/R primer verification results.

FIG. 3 shows protoplast brightfield (a), chlorophyll fluorescence (b), GFP fluorescence (c), all (d) of transgenic tobacco (pYBA 1132-GFP).

FIG. 4 shows protoplast brightfield (a), chlorophyll fluorescence (b), GFP fluorescence (c), all (d) of transgenic tobacco (pYBA 1132-Lsa 25711-GFP).

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The lettuce variety in the following examples is the American big fast growth, and is described in the literature' Schlemna minor, Zingiber officinale, Dujin Wei, Chongyi, Baihongmei, Du riguang, Zhuchunhui Jiu Ru, Huangpu Jiu Ru.

The preparation of 2YT broth in the following examples was as follows: firstly, 16g of tryptone, 10g of yeast extract, 5g of NaCl and 1L of distilled water are mixed uniformly, sterilized at 121 ℃ for 20min, cooled to room temperature for use, and stored in a refrigerator at 4 ℃.

The preparation method of the enzymatic hydrolysate in the following examples is as follows: firstly, the following components are mixed evenly: 1.25% celluase R100.1875g, 0.3% macrocezyme R100.045g, 0.4M mannitol 7.5ml, 20mM KCl 1.5ml, 20mM MES (pH 5.7) 1.5ml, followed by 55 ℃ water bath for 10min, cooling to room temperature, adding 10mM CaCl₂0.15ml and 0.1% BSA 0.015g, finally make up the total volume to 15ml with water.

EXAMPLE 1 cloning of Lsa25711 Transporter peptide

1. Extraction of Total RNA

100mg of Jatropha monocrotala seedlings are taken as experimental materials, and a Novozan RNA extraction kit (RC 401) is used for extracting total RNA.

2. Obtaining of cDNA

Reverse transcribing the total RNA extracted in step 1 into cDNA using Novovovoxex reverse transcription kit (R312).

3. PCR amplification

And (3) carrying out PCR amplification by using the cDNA obtained in the step (2) as a template and adopting M-25711-F and M-25711-R primers to obtain a PCR product. The primer sequences are as follows:

M-25711-F：GCTCTAGAATGGCGGCGGCGGCCTCTTCTT (XbaI cleavage site underlined);

M-25711-R：ACGCGTCGACGCCATCGTCTTTCTTGGTGAAGCAA (SalI cleavage sites are underlined).

The PCR amplification system (total volume 50. mu.l) was as follows: cDNA 3. mu.l, M-25711-F (10. mu.M) 2. mu.l, M-25711-R (10. mu.M) 2. mu.l, ddH₂O 18μl，KOD OneTM PCR Master Mix -Blue（KMM-201）25μl。

The PCR reaction conditions were as follows: pre-denaturation at 98 ℃ for 3min, followed by denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 5s, extension at 68 ℃ for 5s, 35 cycles, and finally extension at 68 ℃ for 5min, after completion of the reaction, the reaction was maintained at 8 ℃ and electrophoresis was carried out using 1% agarose gel, and the corresponding band (transit peptide fragment) was recovered.

4. Sequencing of PCR products

Sequencing the PCR product obtained in the step 3, wherein the sequencing result shows that: the nucleotide sequence of the PCR product comprises DNA molecules shown as a sequence 1 in a sequence table and is named asLsa25711The amino acid sequence of Lsa25711 protein coded by the gene is shown as a sequence 2 in a sequence table.

Example 2 application of Lsa25711 Transporter peptide in targeting protein of interest to chloroplast

First, construction of vector

1. Enzyme digestion

The transit peptide fragment obtained in example 1 and the vector pYBA1132 (purchased from Shanghai grass Wu Biotech Co., Ltd., product number P8514) were cleaved with XbaI and SalI enzymes, respectively, and the cleavage products were recovered to obtain each cleaved fragment product.

The digestion system (total volume 50. mu.l) was as follows: XbaI enzyme and SalI enzyme 1 u l each, cutmarst 5 u l, nucleic acid fragment 43 u l.

The digestion procedure was 37 ℃ for 2h, 65 ℃ for 20 min.

2. Connection of

And (3) connecting the enzyme digestion product fragments obtained in the step (1) by using T4 ligase to obtain the recombinant vector.

The ligation reaction system (total volume 10. mu.l) was as follows: 0.5. mu.l of T4 ligase, 1. mu.l of T4 buffer, 7.5. mu.l of transit peptide fragment, and 1. mu.l of vector fragment.

The ligation reaction conditions were as follows: room temperature 1 h.

3. Identification

Coli DH 5. alpha. competent cells were transformed with the recombinant vector, plated on 2YT plates containing kanamycin resistance, and cultured overnight at 37 ℃. Selecting a single clone, extracting plasmids, obtaining recombinant plasmids through sequencing verification, and naming the plasmids with correct sequencing results as pYBA1132-Lsa 25711-GFP. The structure of pYBA1132-Lsa25711-GFP plasmid is schematically shown in FIG. 1.

The recombinant vector pYBA1132-Lsa25711-GFP is a vector obtained by replacing a DNA molecule between XbaI and SalI enzyme cutting sites of the vector pYBA1132 with a DNA molecule shown in a sequence 1 and keeping other sequences of the vector pYBA1132 unchanged.

Secondly, preparation of bacterial liquid

1. Preparation of recombinant bacteria

And (2) transforming the recombinant vector pYBA1132-Lsa25711-GFP obtained in the first step into agrobacterium EHA105 (purchased from Beijing Bomaide Gene technology Co., Ltd., product number is BC 313-01) to obtain a recombinant strain pYBA1132-Lsa25711-GFP/EHA 105.

2. Preparation of bacterial liquid

The recombinant strain pYBA1132-Lsa25711-GFP/EHA105 prepared in the step 1 is coated on a 2YT culture dish containing kanamycin and rifampicin resistance, is cultured at 28 ℃ overnight, then a single clone is picked up and is cultured in a 2YT culture solution containing kanamycin and rifampicin resistance overnight till OD is reached_600nmIs 1.2-1.3, and then centrifuged at 6000r at room temperature for 5min, using MgCl containing acetosyringone₂Resuspending the bacterial solution to OD_600nm0.6-0.8, obtaining the experimental bacteria liquid, and standing for 3-4 hours at room temperature for later use.

According to the method, pYBA1132-Lsa25711-GFP is replaced by pYBA1132, and a contrast group bacterial liquid is obtained.

Thirdly, observing the transient transformation and fluorescence signal of the tobacco

1. Injection of bacterial liquid

Injecting the bacterial solution (experimental group bacterial solution or control group bacterial solution) obtained in the second step into 1-month-old Bunsen tobacco by using an injector without a needle headNicotiana benthamiana) In the leaf, 1ml of each leaf is marked, and dark culture is performed for one day (culture conditions: the culture temperature is 24 ℃; light conditions were shaded for 24 hours), followed by two days of light culture (culture conditions: the culture temperature is 24 ℃; the illumination conditions are 16 hours of illumination and 8 hours of darkness), and obtaining the transgenic tobacco respectively for later use.

The tobacco injected with the experimental group bacterial liquid was designated as transgenic tobacco (pYBA 1132-Lsa 25711-GFP).

The tobacco injected with the control bacterial liquid was designated as transgenic tobacco (pYBA 1132-GFP).

2. PCR verification of transgenic tobacco

Transgenic tobacco (pYBA 1132-Lsa 25711-GFP) and transgenic tobacco (pYBA 1132-GFP) are taken as experimental materials, and a CTAB method is used for extracting total DNA. The DNA is used as a template, and Kan-F and Kan-R are used as primers to carry out PCR amplification to obtain a PCR product.

The primer sequences are as follows:

Kan-F：GGTGGAGAGGCTATTCGGCTATG；

Kan-R：TGCTCGCTCGATGCGATGTTT。

the PCR amplification system (20. mu.l) was as follows: DNA 2. mu.l, K-F (10. mu.M) 1. mu.l, K-R (10. mu.M) 1. mu.l, ddH₂O 6μl，2xRapid Taq Master Mix（P222-AA）10μl。

The PCR reaction conditions were as follows: pre-denaturation at 95 ℃ for 3min, then denaturation at 95 ℃ for 10s, annealing at 60 ℃ for 10s, extension at 72 ℃ for 10s, 35 cycles, and finally extension at 72 ℃ for 5min, keeping the temperature at 8 ℃ after the reaction is finished, and performing electrophoresis detection by using 1% agarose gel (the target band is 388 bp).

The results are shown in FIG. 2, in which lanes 2-4 are the results of control transgenic tobacco (pYBA 1132-GFP), and lanes 11-13 are the results of experimental transgenic tobacco (pYBA 1132-Lsa 25711-GFP). The results show that: the vector successfully entered tobacco lamina tissue.

3. Enzymolysis

Taking transgenic tobacco (pYBA 1132-Lsa 25711-GFP) and transgenic tobacco (pYBA 1132-GFP) leaves injected with bacteria liquid after three days of culture, cutting the leaves into thin strips by a sharp blade (the thinner the leaf is, the better the leaf is, the enzymolysis is easy), adding a proper amount of enzymolysis liquid, and performing shake enzymolysis for 2-3 hours at a temperature of 22 ℃ in weak light or in dark at 60rpm to obtain enzymolysis products.

4. Collecting protoplasts

Filtering the enzymolysis product with a 200-mesh nylon net, collecting the filtrate in a 50ml centrifuge tube, centrifuging for 5min at 100g with a horizontal rotor at 4 ℃, discarding the supernatant, collecting the precipitate, adding a precooled W5 solution into the precipitate gently, suspending the bottom protoplast, and observing the fluorescence signal under a laser confocal microscope.

The results are shown in fig. 3 and 4, and show that: the GFP signal of the transgenic tobacco (pYBA 1132-GFP) is localized to the non-chloroplasts, while the GFP signal of the transgenic tobacco (pYBA 1132-Lsa 25711-GFP) is localized to the chloroplasts, which indicates that the Lsa25711 transit peptide can guide the non-chloroplast protein GFP to the chloroplasts to be localized in the chloroplasts.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> agriculture and forestry academy of sciences of Beijing City

Application of <120> Lsa25711 transit peptide in chloroplast genetic transformation

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 198

<212> DNA

<213> Artificial Sequence

<400> 1

atggcgtctg ctaatgcgat atctacagct tcaatccttt cttcccataa gaaggggaat 60

tttcttgatg gtagtaggag gattaatcta ttgcagactg ctgtgaatat gagacaatcg 120

aatcgccggt ttgtggttcg agctgcggct aaagatattg cgtttgacca gaagtcgagg 180

gcggctatgc aggccgga 198

<210> 2

<211> 66

<212> PRT

<213> Artificial Sequence

<400> 2

Met Ala Ser Ala Asn Ala Ile Ser Thr Ala Ser Ile Leu Ser Ser His

1 5 10 15

Lys Lys Gly Asn Phe Leu Asp Gly Ser Arg Arg Ile Asn Leu Leu Gln

20 25 30

Thr Ala Val Asn Met Arg Gln Ser Asn Arg Arg Phe Val Val Arg Ala

35 40 45

Ala Ala Lys Asp Ile Ala Phe Asp Gln Lys Ser Arg Ala Ala Met Gln

50 55 60

Ala Gly

65

Claims

1. A transit peptide which is a protein shown as a 1) or a 2):

a1) the amino acid sequence is a protein shown in a sequence 2;

2. The biomaterial related to the transit peptide of claim 1, which is any one of the following A1) to A8):

A1) a nucleic acid molecule encoding the transit peptide of claim 1;

A2) an expression cassette comprising the nucleic acid molecule of a 1);

A3) a recombinant vector comprising the nucleic acid molecule of a 1);

A4) a recombinant vector comprising the expression cassette of a 2);

A5) a recombinant microorganism comprising the nucleic acid molecule of a 1);

A6) a recombinant microorganism comprising the expression cassette of a 2);

A7) a recombinant microorganism comprising a 3) said recombinant vector;

A8) a recombinant microorganism comprising the recombinant vector of a 4).

3. The related biological material according to claim 2, wherein: A1) the nucleic acid molecule is a gene shown in the following 1) or 2):

1) the coding sequence is a DNA molecule shown in sequence 1;

2) a DNA molecule having 75% or more 75% identity to the nucleotide sequence defined in 1) and encoding the transit peptide of claim 1.

4. Use of the transit peptide of claim 1 or the biomaterial of claim 2 or 3 for localizing a protein of interest to chloroplasts;

or, the use of the transit peptide of claim 1 or the biomaterial of claim 2 or 3 for directing a protein of interest to chloroplasts.

5. Use of the transit peptide of claim 1 or the biomaterial of claim 2 or 3 in chloroplast genetic transformation.

6. A method for localizing a protein of interest to chloroplasts, comprising the steps of: the transporter peptide of claim 1 and a protein of interest are expressed as a fusion in a recipient plant, such that the protein of interest is localized in chloroplasts of the recipient plant.

7. The method of claim 6, wherein: the method for fusion expression of the transit peptide of claim 1 and the target protein in a recipient plant comprises introducing a gene encoding a fusion protein obtained by fusing the transit peptide of claim 1 and the target protein into the recipient plant.

8. The method of claim 7, wherein: the encoding gene of the fusion protein is introduced into a receptor plant through a recombinant expression vector.

9. A fusion protein or its related biomaterial, wherein the fusion protein is formed by fusing the transit peptide of claim 1 and a target protein; the biological material is a nucleic acid molecule encoding the fusion protein or an expression cassette or a recombinant vector or a recombinant microorganism containing the nucleic acid molecule.

10. Use of the method of any one of claims 6-8 or the fusion protein of claim 9 or related biological material thereof in chloroplast genetic transformation.