CN114044815B - Chloroplast transit peptide Lsa3084 from lettuce and application thereof - Google Patents

Abstract

The invention discloses a chloroplast transit peptide Lsa3084 derived from lettuce and application thereof. The chloroplast transit peptide Lsa3084 provided by the invention is a protein shown by a 1) or a 2): a1) the amino acid sequence is a protein shown in a sequence 2; a2) and (b) a fusion protein obtained by connecting a tag to the N-terminal or/and the C-terminal of the protein shown in the sequence 2. Experiments prove that: the chloroplast transit peptide Lsa3084 can guide target protein to chloroplast, and provides a new idea for chloroplast genetic transformation.

Description

Chloroplast transit peptide Lsa3084 from lettuce and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a chloroplast transit peptide Lsa3084 derived from lettuce and application thereof.

Background

The endosymbiont of the original cyanobacteria and proteobacteria with eukaryotes produces plastids and mitochondria in plant cells. Plastids are a general term for a class of organelles, widely present in plant cells, and can be classified into yellow, red and orange chromoplasts, colorless leucoplasts, green chloroplasts, etioplasts in yellow seedlings, and the like, depending on the pigments contained therein. In young cells of plants, the plastids that have not yet differentiated to maturity are called proplastids, which gradually differentiate to mature plastids as the cells grow. In order to adapt to different chemical environments, plastids perform different functions in different cells, respectively.

The most interesting of the plastids are the chloroplasts. Chloroplasts were first found by Ris and Plau in chlamydomonas and are organelles for photosynthesis in plant cells and eukaryotic algae. Except in photosynthesis and CO₂Besides playing an important role in fixation, chloroplasts are also involved in the synthesis of chlorophyll, carotenoids, fatty acids, some amino acids, starch and proteins. Chloroplasts are structurally complex organelles surrounded by an inner and an outer membrane. Chloroplasts also exhibit a third internal membrane, known as the thylakoid membrane. The membrane system creates three compartments: the inter-membranous space, stroma, and thylakoid space. Transcription and translation processes and metabolic reactions, such as the calvin cycle, occur in the matrix. Photosynthesis occurs within the thylakoid space, with the production of NADPH, ATP and oxygen.

The chloroplast genome encodes only about 100 proteins, and a large number of proteins functioning in chloroplasts are synthesized in cytoplasm, and the proteins must be introduced from cytoplasm during or after translation, enter chloroplasts, and are processed into mature proteins to function.

Transit peptide (transit peptide), a 12-60 amino acid residue leader sequence, directs proteins synthesized in the cytosol to mitochondria and chloroplasts. Precursor proteins targeted for Chloroplast expression comprise an N-terminal extension called Chloroplast Transit Peptides (CTPs). These targeting peptides help to direct the protein precursors to the chloroplast surface where they are recognized by the receptors of the TOC import mechanism of the outer membrane, mediating the passage of the precursor proteins across the chloroplast membrane and transport to various sub-levels within the chloroplast. Chloroplast transit peptides are critical for the entry of the precursor protein into the chloroplast.

At present, more and more evidences show that the characters of photosynthesis, disease resistance, stress resistance, yield and the like of crops can be improved by utilizing the transit peptide through a biological engineering technology, and the method has important significance for solving the world food problem. Such as peas (pea) by van den Broeck et al, 1985Pisum sativum) The ribulose-1, 5-bisphosphate carboxylase/oxygenase (Rubisco) small subunit is linked to the N-terminus of NPT-II, successfully transporting bacterial neomycin phosphorylase II (NPT-II) into tobacco chloroplasts. Exogenous pest resistance gene is transformed into chloroplast by chloroplast transit peptide, thus enhancing the pest resistance of transgenic plants. Li et al transformed rice by fusion of Rubisco CTP from rice with β -Glucuronidase (GUS), and found that the expression level of GUS protein in rice plants containing Rubisco CTP was increased by about 4.2 times as compared with rice plants containing no CTP.

However, the structure of transit peptides is highly diverse and lacks uniform sequence motifs. Therefore, how such diversity supports accurate protein import into chloroplasts and how to determine import specificity of transit peptides remains a challenge.

Disclosure of Invention

An object of the present invention is to provide a transit peptide.

The transit peptide provided by the invention is derived from lettuce and is named as Lsa3084, and the Lsa3084 transit peptide is a protein shown in a 1) or a 2):

a1) the amino acid sequence is a protein shown in a sequence 2;

a2) and (b) a fusion protein obtained by connecting a tag to the N-terminal or/and the C-terminal of the protein shown in the sequence 2.

In the protein of a 2), the tag is a polypeptide or protein expressed by fusion with a target protein by using in vitro recombinant DNA technology, so as to facilitate the expression, detection, tracing and/or purification of the target protein. The tag may be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag, and/or a SUMO tag, among others.

The protein of a 1) or a 2) may be artificially synthesized, or may be obtained by synthesizing a gene encoding the protein and then performing biological expression.

It is another object of the present invention to provide a biomaterial related to Lsa3084 transit peptide.

The biomaterial related to Lsa3084 transit peptide provided by the invention is any one of the following A1) to A8):

A1) a nucleic acid molecule encoding a Lsa3084 transit peptide;

A2) an expression cassette comprising the nucleic acid molecule of a 1);

A3) a recombinant vector comprising the nucleic acid molecule of a 1);

A4) a recombinant vector comprising the expression cassette of a 2);

A5) a recombinant microorganism comprising the nucleic acid molecule of a 1);

A6) a recombinant microorganism comprising the expression cassette of a 2);

A7) a recombinant microorganism comprising a 3) said recombinant vector;

A8) a recombinant microorganism comprising the recombinant vector of a 4).

In the above biological material, the nucleic acid molecule of A1) is a gene represented by the following 1) or 2):

1) the coding sequence is a DNA molecule shown in sequence 1;

2) a DNA molecule which has 75 percent or more than 75 percent of identity with the nucleotide sequence defined by 1) and codes Lsa3084 transport peptide.

The nucleotide sequence encoding the Lsa3084 transit peptide of the present invention can be easily mutated by a person of ordinary skill in the art using known methods, such as directed evolution and point mutation. Those nucleotides which are artificially modified to have 75% or more identity to the nucleotide sequence encoding the Lsa3084 transit peptide are derived from and identical to the nucleotide sequence of the present invention as long as they encode the Lsa3084 transit peptide and have the same function.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes nucleotide sequences that are 75% or more, or 85% or more, or 90% or more, or 95% or more identical to the nucleotide sequence of a protein consisting of the amino acid sequence shown in coding sequence 2 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.

The above-mentioned identity of 75% or more may be 80%, 85%, 90% or 95% or more.

Still another object of the present invention is to provide a novel use of the above Lsa3084 transit peptide or a biomaterial related thereto.

The invention provides application of the Lsa3084 transport peptide or a biological material related to the Lsa3084 transport peptide in positioning target protein in chloroplast.

The invention also provides application of the Lsa3084 transport peptide or the biological material related to the Lsa3084 transport peptide in guiding target protein to chloroplast.

The invention also provides application of the Lsa3084 transit peptide or the biological material related to the Lsa3084 transit peptide in chloroplast genetic transformation.

It is still another object of the present invention to provide a method for localizing a target protein to chloroplasts.

The method for localizing the target protein in the chloroplast comprises the following steps: the transit peptide and the target protein are subjected to fusion expression in a receptor plant, so that the target protein is positioned in chloroplast of the receptor plant.

In the above method, the Lsa3084 transit peptide is fused to the amino terminus of the target protein.

Furthermore, the method for performing fusion expression of the Lsa3084 transit peptide and the target protein in the recipient plant is to introduce a gene encoding a fusion protein formed by fusing the Lsa3084 transit peptide and the target protein into the recipient plant.

Further, the gene encoding the fusion protein is introduced into a recipient plant via a recombinant expression vector.

The recombinant expression vector contains a DNA segment which sequentially consists of a nucleic acid molecule for coding Lsa3084 transit peptide and a nucleic acid molecule for coding a target protein.

The method for introducing the encoding gene of the fusion protein into a receptor plant through a recombinant expression vector comprises the following steps: introducing the recombinant expression vector into agrobacterium to obtain a recombinant strain; and infecting a receptor plant by using the recombinant bacteria to realize transient transformation of the receptor plant.

The method for infecting the receptor plant by the recombinant bacteria can be an injection method.

The nucleic acid molecule for encoding the Lsa3084 transit peptide is a DNA molecule shown in a sequence 1.

In a specific embodiment of the present invention, the recombinant vector is pYBA1132-Lsa3084-GFP, and the recombinant vector pYBA1132-Lsa3084-GFP is a vector obtained by replacing DNA molecules between the XbaI and SalI cleavage sites of the vector pYBA1132 (the vector includes 184 bp NOS promoter, 795 bp NeoR/KanR, 253 bp NOS terminator and 346 bp CaMV 35S promoter) with DNA molecules represented by sequence 1, and keeping other sequences of the vector pYBA1132 unchanged.

It is a final object of the invention to provide a fusion protein or a biological material related thereto; the fusion protein is formed by fusing Lsa3084 transit peptide and target protein; the biological material is a nucleic acid molecule encoding the fusion protein or an expression cassette or a recombinant vector or a recombinant microorganism containing the nucleic acid molecule.

The application of the method or the fusion protein or the related biological materials in chloroplast genetic transformation also belongs to the protection scope of the invention.

In any of the above methods or applications, the target protein may be any protein in the prior art, specifically GFP fluorescent protein.

In any of the above methods or uses, the plant is a chloroplast-containing plant. In a specific embodiment of the invention, the plant is tobacco (e.g., nicotiana benthamiana).

The invention provides a lettuce-derived Lsa3084 transit peptide, an encoding gene of the transit peptide is fused with a target gene GFP, transient expression is carried out in tobacco to observe a chloroplast GFP fluorescence signal, and the result shows that the GFP signal can be positioned in chloroplast after the Lsa3084 transit peptide is connected to the amino terminal of the target protein GFP. The invention provides a new idea for chloroplast genetic transformation.

Drawings

FIG. 1 is a schematic structural diagram of pYBA1132-Lsa3084-GFP plasmid.

FIG. 2 shows PCR verification of transgenic tobacco Kan. Lane 1 is marker, and lanes 2-13 are Kan F/R primer verification results.

FIG. 3 shows protoplast brightfield (a), chlorophyll fluorescence (b), GFP fluorescence (c), all (d) of transgenic tobacco (pYBA 1132-GFP).

FIG. 4 shows protoplast brightfield (a), chlorophyll fluorescence (b), GFP fluorescence (c), all (d) of transgenic tobacco (pYBA 1132-Lsa 3084-GFP).

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The lettuce variety in the following examples is the American big fast growth, and is described in the literature' Schlemna minor, Zingiber officinale, Dujin Wei, Chongyi, Baihongmei, Du riguang, Zhuchunhui Jiu Ru, Huangpu Jiu Ru.

The preparation of 2YT broth in the following examples was as follows: firstly, 16g of tryptone, 10g of yeast extract, 5g of NaCl and 1L of distilled water are mixed uniformly, sterilized at 121 ℃ for 20min, cooled to room temperature for use, and stored in a refrigerator at 4 ℃.

The preparation method of the enzymatic hydrolysate in the following examples is as follows: firstly, the following components are mixed evenly: 1.25% celluase R100.1875g, 0.3% macrocezyme R100.045g, 0.4M mannitol 7.5ml, 20mM KCl 1.5ml, 20mM MES (pH 5.7) 1.5ml, then water bath at 55 ℃ for 10min, after cooling to room temperature, 10mM CaCl20.15ml and 0.1% BSA 0.015g were added, and finally the total volume was made up to 15ml with water.

EXAMPLE 1 cloning of Lsa3084 Transporter peptide

1. Extraction of Total RNA

100mg of Jatropha monocrotala seedlings are taken as experimental materials, and a Novozan RNA extraction kit (RC 401) is used for extracting total RNA.

2. Obtaining of cDNA

Reverse transcribing the total RNA extracted in step 1 into cDNA using Novovovoxex reverse transcription kit (R312).

3. PCR amplification

And (3) performing PCR amplification by using the cDNA obtained in the step (2) as a template and adopting M-3084-F and M-3084-R primers to obtain a PCR product. The primer sequences are as follows:

M-3084-F：GCTCTAGAATGGCGGCGGCGGCCTCTTCTT (the sequence shown underlined is the XbaI enzymeA cleavage site);

M-3084-R：ACGCGTCGACGCCATCGTCTTTCTTGGTGAAGCAA (SalI cleavage sites are underlined).

The PCR amplification system (total volume 50. mu.l) was as follows: cDNA 3. mu.l, M-3084-F (10. mu.M) 2. mu.l, M-3084-R (10. mu.M) 2. mu.l, ddH₂O 18μl，KOD OneTM PCR Master Mix-Blue（KMM-201）25μl。

The PCR reaction conditions were as follows: pre-denaturation at 98 ℃ for 3min, followed by denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 5s, extension at 68 ℃ for 5s, 35 cycles, and finally extension at 68 ℃ for 5min, after completion of the reaction, the reaction was maintained at 8 ℃ and electrophoresis was carried out using 1% agarose gel, and the corresponding band (transit peptide fragment) was recovered.

4. Sequencing of PCR products

Sequencing the PCR product obtained in the step 3, wherein the sequencing result shows that: the nucleotide sequence of the PCR product comprises DNA molecules shown as a sequence 1 in a sequence table and is named asLsa3084The gene, the amino acid sequence of Lsa3084 protein coded by the gene is shown as a sequence 2 in a sequence table.

Example 2 application of Lsa3084 Transporter peptide in localizing target protein in chloroplast

First, construction of vector

1. Enzyme digestion

The transit peptide fragment obtained in example 1 and the vector pYBA1132 (purchased from Shanghai grass Wu Biotech Co., Ltd., product number P8514) were cleaved with XbaI and SalI enzymes, respectively, and the cleavage products were recovered to obtain each cleaved fragment product.

The digestion system (total volume 50. mu.l) was as follows: XbaI enzyme and SalI enzyme 1 u l each, cutmarst 5 u l, nucleic acid fragment 43 u l.

The digestion procedure was 37 ℃ for 2h, 65 ℃ for 20 min.

2. Connection of

And (3) connecting the enzyme digestion product fragments obtained in the step (1) by using T4 ligase to obtain the recombinant vector.

The ligation reaction system (total volume 10. mu.l) was as follows: 0.5. mu.l of T4 ligase, 1. mu.l of T4 buffer, 7.5. mu.l of transit peptide fragment, and 1. mu.l of vector fragment.

The ligation reaction conditions were as follows: room temperature 1 h.

3. Identification

Coli DH 5. alpha. competent cells were transformed with the recombinant vector, plated on 2YT plates containing kanamycin resistance, and cultured overnight at 37 ℃. Selecting a single clone, extracting plasmids, obtaining recombinant plasmids through sequencing verification, and naming the plasmids with correct sequencing results as pYBA1132-Lsa 3084-GFP.

pYBA1132-Lsa3084-GFP is a vector obtained by replacing a DNA molecule between XbaI and SalI cleavage sites of the vector pYBA1132 with a DNA molecule shown in sequence 1, and keeping other sequences of the vector pYBA1132 unchanged. pYBA1132-Lsa3084-GFP expresses a fusion protein formed by fusing a Lsa3084 transit peptide and a GFP protein. The schematic structure of pYBA1132-Lsa3084-GFP plasmid is shown in FIG. 1.

Secondly, preparation of bacterial liquid

1. Preparation of recombinant bacteria

And (3) transforming the recombinant vector pYBA1132-Lsa3084-GFP obtained in the first step into agrobacterium EHA105 (purchased from Beijing Bomaide Gene technology Co., Ltd., product number is BC 313-01) to obtain a recombinant strain pYBA1132-Lsa3084-GFP/EHA 105.

2. Preparation of bacterial liquid

The recombinant strain pYBA1132-Lsa3084-GFP/EHA105 prepared in the step 1 is coated on a 2YT culture dish containing kanamycin and rifampicin resistance, is cultured at 28 ℃ overnight, then a single clone is picked up and is cultured in a 2YT culture solution containing kanamycin and rifampicin resistance overnight till OD_600nmIs 1.2-1.3, and then centrifuged at 6000r at room temperature for 5min, using MgCl containing acetosyringone₂Resuspending the bacterial solution to OD_600nm0.6-0.8, obtaining the experimental bacteria liquid, and standing for 3-4 hours at room temperature for later use.

According to the method, pYBA1132-Lsa3084-GFP is replaced by pYBA1132 to obtain a contrast group bacterial liquid.

Thirdly, observing the transient transformation and fluorescence signal of the tobacco

1. Injection of bacterial liquid

The bacterial solution obtained in the second step was injected into a syringe without a needle (experiment)Inoculum or control inoculum) into 1 month old native tobacco ((II)Nicotiana benthamiana) In the leaf, 1ml of each leaf is marked, and dark culture is performed for one day (culture conditions: the culture temperature is 24 ℃; light conditions were shaded for 24 hours), followed by two days of light culture (culture conditions: the culture temperature is 24 ℃; the illumination conditions are 16 hours of illumination and 8 hours of darkness), and obtaining the transgenic tobacco respectively for later use.

The tobacco injected with the experimental group bacterial liquid was designated as transgenic tobacco (pYBA 1132-Lsa 3084-GFP).

The tobacco injected with the control bacterial liquid was designated as transgenic tobacco (pYBA 1132-GFP).

2. PCR verification of transgenic tobacco

Transgenic tobacco (pYBA 1132-Lsa 3084-GFP) and transgenic tobacco (pYBA 1132-GFP) are taken as experimental materials, and a CTAB method is used for extracting total DNA. The DNA is used as a template, and Kan-F and Kan-R are used as primers to carry out PCR amplification to obtain a PCR product.

The primer sequences are as follows:

Kan-F：GGTGGAGAGGCTATTCGGCTATG；

Kan-R：TGCTCGCTCGATGCGATGTTT。

the PCR amplification system (20. mu.l) was as follows: DNA 2. mu.l, K-F (10. mu.M) 1. mu.l, K-R (10. mu.M) 1. mu.l, ddH₂O 6μl，2xRapid Taq Master Mix（P222-AA）10μl。

The PCR reaction conditions were as follows: pre-denaturation at 95 ℃ for 3min, then denaturation at 95 ℃ for 10s, annealing at 60 ℃ for 10s, extension at 72 ℃ for 10s, 35 cycles, and finally extension at 72 ℃ for 5min, keeping the temperature at 8 ℃ after the reaction is finished, and performing electrophoresis detection by using 1% agarose gel (the target band is 388 bp).

The results are shown in FIG. 2, in which lanes 2-4 are the results of control transgenic tobacco (pYBA 1132-GFP), and lanes 5-7 are the results of experimental transgenic tobacco (pYBA 1132-Lsa 3084-GFP). As can be seen from the figure: the vector successfully entered tobacco lamina tissue.

3. Enzymolysis

Taking transgenic tobacco (pYBA 1132-Lsa 3084-GFP) and transgenic tobacco (pYBA 1132-GFP) leaves injected with bacteria liquid after three days of culture, cutting the leaves into thin strips by a sharp blade (the thinner the better, the easier the enzymolysis is), adding a proper amount of enzymolysis liquid, and performing shaking table enzymolysis at the temperature of 22 ℃ and weak light or dark 60rpm for 2-3 hours to obtain enzymolysis products.

4. Collecting protoplasts

Filtering the enzymolysis product with 200 mesh nylon net, collecting the filtrate in 50ml centrifuge tube, centrifuging at 4 deg.C and 100g for 5min with horizontal rotor, removing supernatant, collecting precipitate, adding precooled W5 solution into the precipitate, suspending the bottom protoplast, and observing fluorescence signal under confocal laser microscope.

The results are shown in fig. 3 and 4, and show that: the GFP signal of the transgenic tobacco (pYBA 1132-GFP) localized to non-chloroplasts, while the GFP signal of the transgenic tobacco (pYBA 1132-Lsa 3084-GFP) localized to chloroplasts. It is demonstrated that the Lsa3084 transit peptide can direct the non-chloroplast protein GFP to the chloroplast, allowing it to localize in the chloroplast.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> agriculture and forestry academy of sciences of Beijing City

<120> chloroplast transit peptide Lsa3084 derived from lettuce and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 207

<212> DNA

<213> Artificial Sequence

<400> 1

atggcggcgg cggcctcttc ttcccacctt caatttcaat cgctctcttt cgccaaaacc 60

ctaaatcaat cttcaaagcc gatcactccc aaaaccttaa tttcttataa acccgcttcc 120

aaaacactcg ctatccgagc tgtcatatca caaaaacctc cagcaactca gaaatttcaa 180

cattgcttca ccaagaaaga cgatggc 207

<210> 2

<211> 69

<212> PRT

<213> Artificial Sequence

<400> 2

Met Ala Ala Ala Ala Ser Ser Ser His Leu Gln Phe Gln Ser Leu Ser

1 5 10 15

Phe Ala Lys Thr Leu Asn Gln Ser Ser Lys Pro Ile Thr Pro Lys Thr

20 25 30

Leu Ile Ser Tyr Lys Pro Ala Ser Lys Thr Leu Ala Ile Arg Ala Val

35 40 45

Ile Ser Gln Lys Pro Pro Ala Thr Gln Lys Phe Gln His Cys Phe Thr

50 55 60

Lys Lys Asp Asp Gly

65

Claims (4)

1. A transit peptide which is a protein shown as a 1) or a 2):

a1) the amino acid sequence is a protein shown in a sequence 2;

a2) and (3) a fusion protein obtained by connecting a tag to the C-terminal of the protein shown in the sequence 2.

2. A nucleic acid molecule encoding the transit peptide of claim 1.

3. The nucleic acid molecule of claim 2, wherein: the nucleic acid molecule is a DNA molecule shown in a sequence 1.

4. Use of the transit peptide of claim 1 or the nucleic acid molecule of claim 2 or 3 in chloroplast genetic transformation.

Images