CN114075608A - Kit for detecting southern blight of traditional Chinese medicine honeysuckle based on real-time fluorescent PCR technology - Google Patents
Kit for detecting southern blight of traditional Chinese medicine honeysuckle based on real-time fluorescent PCR technology Download PDFInfo
- Publication number
- CN114075608A CN114075608A CN202111582288.4A CN202111582288A CN114075608A CN 114075608 A CN114075608 A CN 114075608A CN 202111582288 A CN202111582288 A CN 202111582288A CN 114075608 A CN114075608 A CN 114075608A
- Authority
- CN
- China
- Prior art keywords
- kit
- honeysuckle
- southern blight
- probe
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kit for detecting traditional Chinese medicine honeysuckle southern blight by a real-time fluorescent PCR technology, wherein a target gene of the kit is selected from an internal transcribed spacer ITS gene, and compared with the special characteristics of other genes of fungi on the overall structure function of ribosome rDNA, the kit has certain conservation, higher variability and obvious interspecies difference, can accurately and quantitatively detect pathogenic bacteria of the honeysuckle southern blight, and prevent the southern blight in advance, lays a pathogenic foundation for the prevention and treatment of the honeysuckle southern blight, and has important significance for ensuring the stable increase of the quality and the yield of honeysuckle.
Description
Technical Field
The invention relates to a kit for detecting southern blight of traditional Chinese medicine honeysuckle based on a real-time fluorescent PCR technology, and belongs to the technical field of pathogenic bacterium nucleic acid detection.
Background
Southern blight, also called white mold, mainly damages the basal stem and root of plants close to the ground. The base of the stem is infected with disease, dark brown, moist and unshaped scabs appear, the scabs are slightly sunken, and radial white sericite mycelia grow on the root when the scabs are moist. The later stage lesion spots are transversely expanded and can surround the whole stem base part, so that the leaves gradually turn yellow from bottom to top, and the whole plant with serious morbidity falls off and dies. Hyphae gradually extend downwards to the root in the later period to cause root rot, and after the root is infected, the cortex is brown and rotten, and only fibrous tissues are left in dead rhizomes and are easily pulled out of the soil. Southern blight has a wide parasitic range and attacks over more than 100 families and more than 210 plants including Chinese herbal medicines, crops, flowers, agriculture and forestry, and the like. In addition, southern blight pathogenic bacterium is a rhizoctonia rot, the etiology is sclerotinia rolfsii Sacc (Selerotium rolfsii Sacc), and the sexual state is Athelia rolfsii. The hyphae overwinter on soil, plant residues and weeds. Pathogenic bacteria can be spread in soil along with surface water flow, and hypha can spread in the soil by means of growth to infect the root or rhizome of the seedling.
Lonicera japonica Thunb (Lonicera japonica Thunb.) is also known as Lonicera japonica Thunb, and belongs to Caprifoliaceae and Lonicera, commonly called Erbaohua, Lonicera japonica Thunb, etc. Honeysuckle is recorded in compendium of materia medica, is also recorded in pharmacopoeia of the people's republic of China, is one of 70 precious medicinal materials determined by the country, is used as a medicine by dry buds or flowers with initial blossoms, and is known as a spectral antibiotic after research proves that the honeysuckle has strong effects of clearing heat, removing toxicity, inhibiting bacteria, resisting viruses and the like. Many Chinese patent medicines use honeysuckle as a main formula and are commonly used bulk drugs. Shandong is a honeysuckle region and a medicine source base of a plurality of medicine enterprises, the artificial planting area of honeysuckle is continuously enlarged, the disease occurrence level is increased year by year, and in the investigation of Shandong honeysuckle disease, the southern blight which harms honeysuckle is mainly the root part of the honeysuckle, and the later period produces white silk film, so that the leaves of the whole plant fall off and die. The disease can affect the growth, yield and quality of honeysuckle and cause certain economic loss.
The honeysuckle is used as an important traditional Chinese medicinal material in China, related research reports on southern blight molecular detection of the honeysuckle are not found at present, and the current research on diseases is mainly realized by culturing and separating pathogenic bacteria, observing by an electron microscope and identifying by morphology through a traditional method. The quick and accurate detection technology is found, so that effective technical support can be provided for early comprehensive prevention and treatment of the southern blight of the honeysuckle. With the development of molecular biology technology, some biological identification means based on DNA are gradually enriched, and the DNA molecular method mainly utilizes different DNA sequence information of various biological species displaying biological characteristics to identify, can break through the limitation of sensory detection, and has more objectivity and accuracy compared with the traditional analysis method. In recent years, the rapid development of the real-time fluorescence PCR technology greatly improves the sensitivity, specificity and accuracy of detection and makes the quantitative tracing of the component content possible, so that the invention establishes a fluorescence quantitative kit and a detection method for rapidly identifying the pathogen of the southern blight of honeysuckle on the basis of the current research and report.
Disclosure of Invention
The invention overcomes the defects of the prior art and provides a kit for detecting the southern blight of the traditional Chinese medicine honeysuckle based on a real-time fluorescence PCR technology, and the target gene of the kit is selected from internal transcribed spacer region ITS genes, so that the pathogenic bacteria of the southern blight of the honeysuckle can be accurately and quantitatively detected, and the occurrence of the southern blight can be prevented in advance.
The kit for detecting the southern blight of the traditional Chinese medicine honeysuckle based on the real-time fluorescent PCR technology comprises the following primers:
Athelia_rolfsii-F：ATATAATATATACCCCTGTGAACCAA(SEQ ID NO.1)；
Athelia_rolfsii-R：AGAACCCAAAAAATCCGTG(SEQ ID NO.2)。
furthermore, the kit also comprises a probe for real-time fluorescence PCR detection of the pathogenic bacteria of the southern blight of the honeysuckle, a real-time fluorescence PCR reaction amplification system, and a positive control, a negative control and a blank control of the pathogenic bacteria of the southern blight of the honeysuckle.
Further, the nucleotide sequence of the probe is shown as follows:
Athelia_rolfsii P：5'FAM-TGTATGTTACATAGAACGATTTCATATTGA-BHQ2 3'(SEQ ID NO.3)。
furthermore, a 5 'end of the probe sequence is modified with a reporter group, and a 3' end of the probe sequence is modified with a quencher group; wherein the reporter group is any one of FAM, HEX, TAMRA, ROX and CY5, and the quencher group is any one of Dabcyl, BHQ1 and BHQ 2. The preferred embodiment of the invention is that the 5 'end is marked by a fluorescent group FAM and the 3' end is marked by a quenching group BHQ 1.
Further, the fluorescent PCR amplification system is as follows:
| name of reagent | Working concentration | Dosage (mu l) | Final concentration |
| TaqMan Master Mix | 2× | 10 | 1× |
| Primer set | 5-10μM | 1 | 0.25-0.5μM |
| Probe composition | 1-5μM | 1 | 0.05-0.25μM |
| DNA template | 1-50ng/μL | 2 | 2-100ng |
| Double distilled water | 6 | ||
| Total volume | 20 |
Furthermore, the positive control is the genome DNA of the pathogen of southern blight of honeysuckle.
Furthermore, the negative control is the genome DNA of a strain other than the pathogenic bacteria of southern blight of honeysuckle.
Further, the blank control is sterile water.
Further, the method for detecting the southern blight of the honeysuckle by using the kit comprises the following steps:
1) extracting DNA from a sample to be detected as a template, and selecting an internal transcribed spacer ITS gene as a target gene;
2) carrying out PCR amplification by using the kit;
3) setting positive control, negative control and blank control, analyzing the experimental result, giving out the fluorescence increase value delta Rn and the Ct value of the amplification curve in the nth cycle, and judging whether the detection is carried out or not according to the fluorescence signal of the probe and the Ct value of the amplification curve.
Further, the procedure of PCR amplification described in step 2) above is: pre-denaturation at 95 ℃ for 10 min; 10s at 95 ℃ and 35s at 60-63 ℃ (where fluorescence signals are collected), for 40 cycles.
Further, the determination of whether or not detection is performed based on the fluorescence signal of the probe and the Ct value of the amplification curve in the step 3) is as follows: if the Ct value is more than 36 and less than or equal to 40, the gene to be detected is judged to be suspicious, the template amount can be increased to repeat the experiment, if an amplification curve exists, the gene to be detected is judged to be positive, if the amplification curve exists, the gene to be detected is negative, no amplification curve exists, or the Ct value is more than or equal to 40, and the gene to be detected is judged to be negative.
Has the advantages that:
the target gene is selected from an internal transcribed spacer ITS gene, and compared with the special characteristics of other genes of fungi on the overall structure function of ribosome rDNA, the internal transcribed spacer ITS gene has certain conservation, higher variability and obvious interspecies difference, so that the ITS sequence used as the target gene of the pathogen of southern blight has strong characteristics and high accuracy.
The invention designs the dual specificity of the sclerotium rolfsii pathogenic bacteria specific primer and the specific probe, thereby greatly improving the accuracy and the reliability. The fluorescence quantitative PCR is detected in the same tube, does not need to open a cover, is not easy to pollute, has the beneficial effects of accuracy and stability, simple operation, high sensitivity, strong specificity, large flux and the like, and can quickly and accurately identify sample materials such as honeysuckle disease specimens, soil and the like. By utilizing the method, the separation and culture of pathogenic bacteria are not needed, the PCR amplification can be carried out on the fungal genome DNA or the field sample DNA, the fluorescent quantitative PCR technology can be used for quantitatively detecting the sclerotium rolfsii pathogenic bacteria in the sample, the occurrence period and the epidemic intensity of sclerotium rolfsii can be accurately predicted, the sclerotium rolfsii can be prevented and treated in advance, even the sclerotium rolfsii can be avoided, the negative influence caused by using pesticides can be reduced, and the basis is provided for the comprehensive prevention and treatment of sclerotium rolfsii. In a word, the method can be used for quickly and accurately identifying the pathogen of the southern blight of the honeysuckle, lays the etiological foundation for the prevention and treatment of the southern blight of the honeysuckle, and has important significance for ensuring the stable increase of the quality and the yield of the honeysuckle.
Detailed Description
In order to make the technical solutions in the present application better understood, the present invention is further described below with reference to examples, which are only a part of examples of the present application, but not all examples, and the present invention is not limited by the following examples.
Example 1
Experimental Material
Honeysuckle disease specimens are collected in a honeysuckle planting base in Linyi Fei county, Shandong, collected at the root base of honeysuckle roots with typical disease symptoms, and stored in an envelope and brought back to a laboratory for storage at 4 ℃. The pathogenic bacteria are separated by adopting a tissue separation method, the pathogenic part is washed by sterile water to clean soil, a tissue block with the side length of 5mm at the junction of white bacterial plaque and a disease key is taken, the surface of the tissue block is sterilized by 75% ethanol, then the tissue block is rinsed for 3 times by sterile distilled water, the water is sucked dry, the tissue block is placed on a Potato Dextrose Agar (PDA) culture medium plate under the sterile condition, and the tissue block is inverted and cultured for 3 days in an incubator at the temperature of 28 ℃.
Reagent and apparatus
The kit for extracting the soil microbial genome, the PCR reaction reagents such as DNA molecular weight MakerDL2000, electrophoresis sample loading buffer solution and the like are purchased from Takara bioengineering (Dalian) Co., Ltd. The primers and probes were synthesized by Shanghai Czeri bioengineering, Inc. 2 × TaqMan Master Mix is DBI Bioscience brand. DNA sequencing was performed by the Biotechnology center, institute of agricultural sciences, Shandong province.
The apparatus used was: the ABI 7500 fluorescent quantitative PCR instrument is a product of ABI company, and the Takara PCR instrument is a product of Bao bioengineering (Dalian) company Limited. Model 5424D high speed centrifuge is a product of Eppendorf corporation.
Example 1 establishment of real-time fluorescence PCR detection system for pathogenic bacteria of southern blight of honeysuckle
1. Pathogenic bacteria DNA extraction
After a honeysuckle root base sample with disease symptoms is cultured, hypha is picked and extracted by using a fungal genome DNA extraction kit, and the specific operation steps are shown in the kit specification. The purity and concentration of the extracted genomic DNA are measured by an ultraviolet spectrophotometer. The measured OD260/OD280 values are all about 1.8-1.9, and the concentration is more than 10 ng/muL, which shows that the DNA has high purity and moderate concentration and meets the PCR amplification requirement.
2. Selection of target genes and design of primers:
the ITS sequence is a non-coding sequence between 5.8S and 28S rRNA genes, has certain conservation and higher variability due to the special overall structure function of ribosome rDNA, and the sequence of the ITS sequence can have larger difference in different species or different individuals of the same species, so that the ITS sequence used as the honeysuckle southern blight pathogen identification target gene has the characteristics of simplicity and reliability.
The nucleotide sequences are shown in Table 1.
TABLE 1 primer and Probe sequences
3. And (3) pathogen fluorescence detection:
a20. mu.L real-time fluorescent PCR amplification system was selected and shown in Table 2.
TABLE 2 PCR reaction amplification System
| Name of reagent | Concentration of | Dosage (mu L) |
| TaqMan Master Mix | 2× | 10 |
| Primer set | 10μM | 1 |
| Probe composition | 1～5μM | 1 |
| DNA template | 20ng/μL | 2 |
| Double distilled water | 6 | |
| Total volume | 20 |
4. The PCR amplification conditions were: 2min at 95 ℃; fluorescence signals were collected at 95 ℃ for 10s, 60 ℃ for 35s, for 45 cycles.
5. And (4) analyzing results: and setting a positive control, a negative control and a blank control in each test, opening analysis software after the test is finished, analyzing the test result, giving out delta Rn (fluorescence increase value in the nth cycle) and an amplification curve Ct value, and judging whether the sample to be detected is positive or not according to the corresponding probe fluorescence signal and the amplification curve Ct value. When the FAM fluorescence modified probe has an amplification curve and the Ct value is less than or equal to 35, the sample to be detected is positive. And when the FAM fluorescence modified probe has no amplification curve, the sample to be detected is negative.
Example 2 specificity test
By using the primers and the probes designed by the invention, the real-time fluorescence PCR detection is carried out by respectively taking fungal genome DNAs (Colletotrichum gloeosporioides), southern blight (Athelia rolfsii Sacc), brown spot (Cercospora rhamni Fack), Trichoderma (Trichoderma spp), Fusarium graminearum (Fusarium graminearum), honeysuckle leaf spot (Stemphylium sp.), honeysuckle powdery mildew (Erysiphe japonica), Aspergillus niger (Aspergillus niger) and the like as templates, and the specificity of the primers and the probes is verified. The results are shown in Table 3, which shows that the probes and primers designed in this study have strong specificity.
TABLE 3 specificity verification test
Example 3. sensitivity assay:
the genome DNA of southern blight pathogen (Athelia rolfsii Sacc) is quantified to 50ng, and diluted according to 5 Xgradient, and 2.0. mu.L of each gradient is taken as template quantity (namely, 10ng, 2ng, 0.4ng, 0.08ng and 0.016ng) to carry out real-time fluorescence quantitative PCR detection, and the detection limit of the invention is evaluated. The result shows that the detection limit of the method is 0.08ng, which indicates that the method provided by the invention has higher sensitivity.
EXAMPLE 4 actual sample testing
10 parts of honeysuckle disease specimens are collected from different planting areas near the Yi in Shandong, honeysuckle roots and stems with typical disease symptoms are collected, genome DNA is extracted after treatment and culture, the sample is detected by using the kit and the detection method provided by the invention, and is verified by using the sequencing result, the morphological identification and detection method, and the result shows that the method is completely consistent with the sequencing result, and is more accurate, reliable, sensitive and rapid compared with the morphological method.
TABLE 4 actual sample testing
| Sample name | Location of a body part | Source | DNA barcode sequencing results | Fluorescent quantitative detection |
| 1 | Rhizome of Japanese apricot | Shandong Linyi | Athelia rolfsii | Positive for |
| 2 | Rhizome of Japanese apricot | Shandong Linyi | Athelia rolfsii | Positive for |
| 3 | Rhizome of Japanese apricot | Shandong Linyi | Athelia rolfsii | Positive for |
| 4 | Rhizome of Japanese apricot | Shandong Linyi | Athelia rolfsii | Positive for |
| 5 | Rhizome of Japanese apricot | Shandong Linyi | Athelia rolfsii | Positive for |
| 6 | Rhizome of Japanese apricot | Shandong Linyi | Athelia rolfsii | Positive for |
| 7 | Rhizome of Japanese apricot | Shandong Linyi | Athelia rolfsii | Positive for |
| 8 | Rhizome of Japanese apricot | Shandong Linyi | Athelia rolfsii | Positive for |
| 9 | Rhizome of Japanese apricot | Shandong Linyi | Athelia rolfsii | Positive for |
| 10 | Rhizome of Japanese apricot | Shandong Linyi | Athelia rolfsii | Positive for |
While the invention has been described in detail with reference to specific embodiments thereof, it will be understood by those skilled in the art that various changes and modifications may be made therein without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> Shandong province academy of agricultural sciences
<120> kit for detecting southern blight of traditional Chinese medicine honeysuckle based on real-time fluorescent PCR technology
<130> 2021
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 26
<212> DNA
<213> Artificial sequence
<400> 1
atataatata tacccctgtg aaccaa 26
<210> 2
<211> 19
<212> DNA
<213> Artificial sequence
<400> 2
agaacccaaa aaatccgtg 19
<210> 3
<211> 30
<212> DNA
<213> Artificial sequence
<400> 3
tgtatgttac atagaacgat ttcatattga 30
Claims (10)
1. The kit for detecting the southern blight of the traditional Chinese medicine honeysuckle based on the real-time fluorescent PCR technology is characterized by comprising the following primers:
Athelia_rolfsii-F：ATATAATATATACCCCTGTGAACCAA；
Athelia_rolfsii-R：AGAACCCAAAAAATCCGTG。
2. the kit of claim 1, further comprising a probe for real-time fluorescence PCR detection of pathogenic bacteria of southern blight of honeysuckle, a real-time fluorescence PCR reaction amplification system, and a positive control, a negative control and a blank control of pathogenic bacteria of southern blight of honeysuckle.
3. The kit of claim 2, wherein the nucleotide sequence of the probe is as follows:
Athelia_rolfsii P：5'FAM-TGTATGTTACATAGAACGATTTCATATTGA-BHQ2 3'。
4. the kit of claim 2, wherein the 5 'end of the nucleotide sequence of the probe is modified with a reporter group and the 3' end is modified with a quencher group; wherein the reporter group is any one of FAM, HEX, TAMRA, ROX and CY5, and the quencher group is any one of Dabcyl, BHQ1 and BHQ 2.
5. The kit of claim 2, wherein the fluorescent PCR reaction amplification system is as follows:
。
6. The kit of claim 2, wherein the positive control is genomic DNA of southern blight pathogenic bacteria of honeysuckle.
7. The kit of claim 2, wherein the negative control is genomic DNA of a strain other than southern honeysuckle blight pathogenic bacteria; the blank control is sterile water.
8. The method for detecting southern blight of honeysuckle using the kit according to any one of claims 1 to 7, comprising the steps of:
1) extracting DNA from a sample to be detected as a template, and selecting an internal transcribed spacer ITS gene as a target gene;
2) carrying out PCR amplification by using the kit;
3) setting positive control, negative control and blank control, analyzing the experimental result, giving out the fluorescence increase value delta Rn and the Ct value of the amplification curve in the nth cycle, and judging whether the detection is carried out or not according to the fluorescence signal of the probe and the Ct value of the amplification curve.
9. The method of claim 8, wherein the PCR amplification procedure in step 2) is: pre-denaturation at 95 ℃ for 10 min; the fluorescence signal was collected at 95 ℃ for 10s and 60-63 ℃ for 35s for 40 cycles.
10. The method of claim 8, wherein the step 3) of determining whether the detected probe is a probe fluorescent signal and the Ct value of the amplification curve is: if the Ct value is more than 36 and less than or equal to 40, the gene to be detected is judged to be suspicious, the template amount can be increased to repeat the experiment, if an amplification curve exists, the gene to be detected is judged to be positive, if the amplification curve exists, the gene to be detected is negative, no amplification curve exists, or the Ct value is more than or equal to 40, and the gene to be detected is judged to be negative.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111582288.4A CN114075608A (en) | 2021-12-22 | 2021-12-22 | Kit for detecting southern blight of traditional Chinese medicine honeysuckle based on real-time fluorescent PCR technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111582288.4A CN114075608A (en) | 2021-12-22 | 2021-12-22 | Kit for detecting southern blight of traditional Chinese medicine honeysuckle based on real-time fluorescent PCR technology |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114075608A true CN114075608A (en) | 2022-02-22 |
Family
ID=80284535
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111582288.4A Pending CN114075608A (en) | 2021-12-22 | 2021-12-22 | Kit for detecting southern blight of traditional Chinese medicine honeysuckle based on real-time fluorescent PCR technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114075608A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101805794A (en) * | 2010-04-08 | 2010-08-18 | 中华人民共和国上海出入境检验检疫局 | Real-time fluorescent PCR detection method of L.maculans as well as primer and probe used for detection |
| CN107012251A (en) * | 2017-05-19 | 2017-08-04 | 福建出入境检验检疫局检验检疫技术中心 | Bee larva bacillus fluorescent quantificationally PCR detecting kit and its application |
-
2021
- 2021-12-22 CN CN202111582288.4A patent/CN114075608A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101805794A (en) * | 2010-04-08 | 2010-08-18 | 中华人民共和国上海出入境检验检疫局 | Real-time fluorescent PCR detection method of L.maculans as well as primer and probe used for detection |
| CN107012251A (en) * | 2017-05-19 | 2017-08-04 | 福建出入境检验检疫局检验检疫技术中心 | Bee larva bacillus fluorescent quantificationally PCR detecting kit and its application |
Non-Patent Citations (2)
| Title |
|---|
| 李河等: "油茶白绢病原菌齐整小核菌分子检测的研究", 《生物技术》 * |
| 赵中振编著: "《百药栽培》", 30 June 2019, 中国中医药出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Barnes et al. | Multigene phylogenies reveal that red band needle blight of Pinus is caused by two distinct species of Dothistroma, D. septosporum and D. pini | |
| Das et al. | RAPD cluster analysis and chlorate sensitivity of some Indian isolates of Macrophomina phaseolina from sorghum and their relationships with pathogenicity | |
| Singh et al. | Smut disease assessment by PCR and microscopy in inoculated tissue cultured sugarcane cultivars | |
| CN107937599B (en) | Molecular marker KB2 for identifying clubroot resistance of Chinese cabbages, primers and application | |
| Purwantara et al. | Genetic diversity of isolates of the Leptosphaeria maculans species complex from Australia, Europe and North America using amplified fragment length polymorphism analysis | |
| Liu et al. | Virulence profile and genetic structure of a North Dakota population of Pyrenophora teres f. teres, the causal agent of net form net blotch of barley | |
| Hameed | Inflorescence rot disease of date palm caused by Fusarium proliferatum in Southern Iraq | |
| Basım et al. | Identification and characterization of Didymella bryoniae causing gummy stem blight disease of watermelon (Citrullus lanatus) in Turkey | |
| Guzman et al. | Detection and differentiation of Phaeoisariopsis griseola isolates with the polymerase chain reaction and group-specific primers | |
| Gryzenhout et al. | Chrysoporthe doradensis sp. nov. pathogenic to Eucalyptus in Ecuador | |
| Guan et al. | Seed-associated fungal diversity and the molecular identification of Fusarium with potential threat to ginseng (Panax ginseng) in China | |
| Williams et al. | Molecular variation in Rhynchosporium secalis isolates obtained from hotspots | |
| CN104911262B (en) | A kind of dalbergia odorifera tar spot bacterium molecule detection primer and quick determination method | |
| CN108018375B (en) | Molecular marker KB1 for identifying clubroot resistance of Chinese cabbages, primers and application | |
| CN108660239B (en) | Specific SSR primers for wild apples in Xinjiang and cultured apples and application of specific SSR primers | |
| CN114075608A (en) | Kit for detecting southern blight of traditional Chinese medicine honeysuckle based on real-time fluorescent PCR technology | |
| Sudirga et al. | First testimony of new host plant of Colletotrichum magnum (sf jenkins & winstead) rossman & wc Allen causing anthracnose in Carica papaya L. fruits in Bali, Indonesia. | |
| CN114032334A (en) | Primer group and kit for detecting quinoa phomopsis and detection method thereof | |
| CN107119141A (en) | The selection and molecular labeling of wheat E. elongata anti gibberellic disease translocation line | |
| CN106701917A (en) | Special primer for identifying gummy stem blight resistance of muskmelon and molecular marking method | |
| CN115247219A (en) | Method for simultaneously identifying honeysuckle anthracnose, powdery mildew and brown spot based on Real-time PCR | |
| Abramova et al. | Diagnostics of phytopathogen fungi Septoria tritici and Stagonospora nodorum by fluorescent amplification-based specific hybridization (FLASH) PCR | |
| CN111187851B (en) | Specific molecular marker primer of rice blast resistance gene Pi-kf2 (t) and application | |
| CN114410828B (en) | Primer composition for identifying or assisting in identifying bacterial leaf blight resistance of rice and method thereof | |
| CN116200528B (en) | SNP molecular marker linked with wheat stripe rust resistance gene QYr.sicau. -2BL and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |