CN114073700B

CN114073700B - Use of IOX1 in the prevention and/or treatment of autoimmune diseases

Info

Publication number: CN114073700B
Application number: CN202010834442.1A
Authority: CN
Inventors: 魏来
Original assignee: Zhongshan Ophthalmic Center
Current assignee: Zhongshan Ophthalmic Center
Priority date: 2020-08-19
Filing date: 2020-08-19
Publication date: 2023-08-01
Anticipated expiration: 2040-08-19
Also published as: CN114073700A

Abstract

The invention discloses an application of IOX1 in preventing and/or treating autoimmune diseases, in particular to an application of IOX1 in controlling Th17 mediated in vivo inflammation. The inventors screened a pool of epigenetic compounds for inhibitors of IFN-gamma and IL-17 expression in Th1 and Th17 cultures, screening to determine IOX1 as CD4 ⁺ Potent inhibitors of IL-17 expression in T cells, IOX1 was also found to inhibit IL17a expression by directly targeting TET2 to the activity of the promoter in Th17 cells. The inventor further proves that IOX1 can effectively control Th17 mediated inflammation in vivo by regulating migration and function of Th17 cells to play an anti-inflammatory role in vivo through a uveitis model.

Description

Use of IOX1 in the prevention and/or treatment of autoimmune diseases

Technical Field

The invention relates to the technical field of biological medicines, in particular to application of IOX1 in preventing and/or treating autoimmune diseases, especially application of IOX1 in controlling Th17 mediated in vivo inflammation and application of IOX1 in preventing and/or treating ocular inflammatory diseases (such as uveitis).

Background

CD4 ⁺ T helper (Th) cells play a vital role in host defense against pathogen invasion. However, their abnormal activation forms the basis of the pathogenesis of many autoimmune diseases such as rheumatoid arthritis, systemic lupus erythematosus, uveitis, multiple sclerosis, psoriasis, crohn's disease and type I diabetes. Initial CD4 ⁺ T cells can differentiate into functional subpopulations including Th1, th2, th17, treg, tfh, etc. This process is synergistically regulated by activation of major transcriptional regulators triggered by extracellular stimuli and chromatin accessibility commonly determined by the epigenoids. Although several key steps for specifying transcriptional and epigenetic control of Th have been well defined in the last two decades, there is still a need to develop trimmable CD4 ⁺ T is thinMethods of treating a cytomediated inflammatory response to treat an autoimmune disease.

Inflammatory Th17 cells play a critical immunopathogenic role in several autoimmune diseases. Thus, molecules targeting Th17 cells while mediating differentiation and inflammatory functions of these cells are a viable therapy for the treatment of autoimmune diseases. Biological agents (monoclonal antibodies) targeting IL-17 and IL-23 have shown great efficacy in the treatment of certain diseases such as psoriasis and rheumatoid arthritis, but are ineffective against other diseases such as uveitis and crohn's disease.

Autoimmune Uveitis (AU) is a common refractory eye disease caused by autoimmune imbalance and other reasons, and is a disease of young and young adult, the number of patients in China is over 500 ten thousand, the blindness rate is up to 35%, and the disease becomes an increasingly prominent serious blindness eye disease in China. The patient shows recurrent local ocular inflammation accompanied by systemic tissue organ inflammatory response, severely affecting normal life, and thus medical intervention becomes important. At this stage (or prior to this stage), conventional clinical treatment is hormone-conjugated immunosuppressants, and autoimmune uveitis is treated by systemic immunosuppression. Current conventional autoimmune uveitis therapies are prone to adverse side effects in patients.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention provides an application of a compound shown in a general formula I and pharmaceutically acceptable salts, esters, prodrugs and solvates thereof in preparing medicines for preventing and/or treating autoimmune diseases,

wherein R is ₁ -R ₅ Independently selected from: hydrogen, substituted or unsubstituted alkyl,Substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkylalkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted aryl, substituted or unsubstituted aralkyl, substituted or unsubstituted heterocyclyl, substituted or unsubstituted heterocyclylalkyl, -COR ₆ 、-C(O)OR ₆ 、-C(O)NR ₆ R ₇ 、-CH＝NR ₆ 、-CN、-OR ₆ 、-OC(O)R ₆ 、-S(O) _t -R ₆ 、-NR ₆ R ₇ 、-NR ₆ C(O)R ₇ 、-NO ₂ 、-N＝C ₁₆ R ₇ And halogen;

t is 0, 1 or 2;

R ₆ and R is ₇ Independently selected from: hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted aryl, substituted or unsubstituted heterocyclyl, and halogen.

Specifically, R _1-5 Independently selected from: hydrogen, substituted OR unsubstituted alkyl, halogen, -OR ₆ 。

In one embodiment of the invention, R ₁ Is hydrogen.

In one embodiment of the invention, R ₂ Is hydrogen.

In one embodiment of the invention, R ₃ Is hydrogen.

In one embodiment of the invention, R ₄ Is hydrogen.

In one embodiment of the invention, R ₅ Is hydrogen.

In one embodiment of the invention, the above compound is IOX1, which has the following structure:

in one embodiment of the invention, the autoimmune disease is a Th 17-mediated autoimmune disease.

In one embodiment of the invention, the autoimmune disease comprises an inflammation, such as an in vivo inflammation and/or a body surface inflammation, in particular an in vivo inflammation.

In one embodiment of the invention, the autoimmune disease is an inflammatory disease of the eye.

In one embodiment of the invention, the ocular inflammatory disease is uveitis and complications thereof.

Specifically, the uveitis may be anterior uveitis, posterior uveitis, intermediate uveitis, or total uveitis.

Specifically, complications of uveitis described above include: zonal corneal degeneration, cataract, macular portion and optic disk edema, macular surface fold-like changes, corneal edema, glaucoma, retinal detachment, etc.

The invention also provides application of the compound shown in the general formula I and pharmaceutically acceptable salts, esters, prodrugs and solvates thereof in preparing anti-inflammatory medicaments.

In particular, in the above applications, the compounds of formula I have the corresponding definitions according to the invention described above.

In particular, the inflammation may be a non-infectious inflammation or an infectious inflammation, in particular a non-infectious inflammation, such as an inflammation caused by an autoimmune disease.

In particular, the inflammation may be in vivo inflammation and/or in vivo inflammation, in particular in vivo inflammation.

Specifically, the inflammation is Th17 mediated inflammation.

In one embodiment of the invention, the inflammation is ocular inflammation.

In one embodiment of the invention, the ocular inflammation comprises uveitis.

The invention also provides application of the compound shown in the general formula I and pharmaceutically acceptable salts, esters, prodrugs and solvates thereof in preparing medicaments for preventing and/or treating ocular inflammatory diseases.

In particular, the ocular inflammatory disease may be an infectious ocular inflammatory disease or a non-infectious ocular inflammatory disease, in particular a non-infectious ocular inflammatory disease, such as an autoimmune ocular inflammatory disease, in particular a Th17 mediated autoimmune ocular inflammatory disease.

Specifically, the uveitis is autoimmune uveitis.

In the above-described applications of the present invention, the compounds of the above general formula I and pharmaceutically acceptable salts, esters, prodrugs, solvates thereof may be administered systemically, e.g., intravenously, intramuscularly, subcutaneously, intraperitoneally, etc., or locally, e.g., intraocularly, etc.

In the above-described applications of the present invention, the compounds of the above general formula i and pharmaceutically acceptable salts, esters, prodrugs, solvates thereof may be formulated as pharmaceutical preparations in the form of: tablets (including sugar-coated tablets, film-coated tablets, sublingual tablets, orally disintegrating tablets, buccal tablets, and the like), pills, powders, granules, capsules (including soft capsules, microcapsules), lozenges, syrups, liquids, emulsions, suspensions, controlled release formulations (e.g., instantaneous release formulations, sustained release microcapsules), aerosols, films (e.g., orally disintegrating films, oral mucosa-adhesive films), injections (e.g., subcutaneous injections, intravenous injections, intramuscular injections, intraperitoneal injections), intravenous instillations, transdermal absorption formulations, ointments, lotions, adhesive formulations, suppositories (e.g., rectal suppositories, vaginal suppositories), pellets, nasal formulations, pulmonary formulations (inhalants), eye drops, and the like, particularly injections. The various formulations described above may be prepared according to conventional production methods in the pharmaceutical arts. For example by mixing the active ingredient with one or more auxiliary materials and then forming it into the desired dosage form.

In preparing the injection, any carrier commonly used in the art may be used, for example: water, ethanol, propylene glycol, ethoxylated isostearyl alcohol, polyethoxylated isostearyl alcohol, fatty acid esters of polyethylene sorbitan, and the like. In addition, a conventional dissolving agent, a buffer, and the like may be added.

Specifically, the above pharmaceutical preparation may be in unit dosage form. In this form, the formulation is subdivided into unit doses containing appropriate quantities of the active component. The unit dosage form can be injection, eye drop or any dosage form; in addition, the unit dosage form may also be a packaged formulation, such as an injection, eye drops, and powder, etc., packaged in a vial or ampoule.

In one embodiment of the present invention, the compounds of formula i and pharmaceutically acceptable salts, esters, prodrugs, solvates thereof are the only active ingredient in the medicament described above.

In another embodiment of the invention, the medicament further comprises a second active ingredient for preventing and/or treating the same or other diseases as the present invention.

The present invention also provides a method for preventing and/or treating autoimmune diseases comprising the step of administering to a subject in need thereof an effective amount of a compound of formula i, and pharmaceutically acceptable salts, esters, prodrugs, solvates thereof, or the aforementioned medicaments of the present invention.

Specifically, in the above methods, the compounds of formula I, autoimmune diseases, have the above definition of the invention.

In one embodiment of the invention, the subject is a mammal, particularly a human.

The present invention also provides a method for preventing and/or treating ocular inflammatory diseases comprising the step of administering to a subject in need thereof an effective amount of a compound of formula i, and pharmaceutically acceptable salts, esters, prodrugs, solvates thereof, or the aforementioned medicaments of the present invention.

In particular, in the above methods, the compounds of formula I, ocular inflammatory diseases, have the above definition of the invention.

The inventors screened a pool of epigenetic compounds for inhibitors of IFN-gamma and IL-17 expression in Th1 and Th17 cultures by using an in vitro culture system, screening to determine that IOX1 is CD4 ⁺ An effective inhibitor of IL-17 expression in T cells, in addition, IOX1 was found to inhibit IL17a expression by directly targeting TET2 to the activity of the promoter in Th17 cells. The inventors have used two models of uveitis for further analysis, demonstrating that IOX1 exerts anti-inflammatory effects in vivo by modulating Th17 cell migration and function, and that IOX1 can be an effective therapeutic agent for Th 17-mediated inflammation in vivo, such as ocular inflammatory diseases (e.g., uveitis).

Drawings

FIG. 1 shows the screening of "epigenetic compound repertoires" of anti-inflammatory molecules targeting helper T cells. (A) Schematic of in vitro compound screening and in vivo validation procedures to identify IOX1 as a Th17 cell inhibitor. (B) left graph: hierarchical clustering of fold-change in cytokines (IFN- γ and IL-17) and Foxp3 positive cell frequencies in Th1, th17 and iTreg cells after low-dose or high-dose drug treatment; right figure: hierarchical clustering of changes in viability of Th1, th17 and iTreg cells following low or high dose drug treatment. Sample number: duplicate samples of each drug dose used in the screening.

Figure 2 shows confirmation of the anti-inflammatory effect of five compounds as determined by the screening process. (A) IFN-gamma in OVA stimulated OTII Th1 cultures after treatment with five drug candidates ⁺ Frequency of cells. (B) IL-17 in OVA stimulated OTII Th17 cultures after treatment with five drug candidates ⁺ Frequency of cells. IFN-gamma in human CD4+ T cell culture after treatment with low, medium and high doses of five drug candidates ⁺ (C) And IL-17 ⁺ (D) Frequency of cells.

FIG. 3 shows IOX1 versus murine and human CD4 ⁺ In vitro action of T cells. (A) structural representation of IOX 1. (B) After treatment with various doses of IOX1, the derivatives were then used Derived from most of the peripheral CD4 ⁺ In murine Th1 and Th17 cultures of T cells (stimulated with anti-CD 3/CD28 antibodies), IFN-. Gamma.and IL-17 were stained by FACS for a representative period of 72 hours. IFN-gamma in murine Th1 (C) and Th17 (D) (stimulated by anti-CD 3/CD28 antibodies) cultures ⁺ And IL-17 ⁺ Cell frequency summary (n=6 in each case). (E) Outer Zhou Ren CD4 stimulated by anti-CD 3/CD28 coated microbeads after treatment with various doses of IOX1 ⁺ IFN-gamma, IL-17 and CFSE in T cells were stained by representative FACS on day 5. (F) Human CD4 stimulated by anti-CD 3/CD28 coated microbeads after IOX1 treatment ⁺ IFN-gamma in T cells ⁺ And IL-17 ⁺ Cell frequency summary (n=6 in each case). The significance level of the Mann-Whitney U test is indicated by an asterisk (<0.05，**P<0.01)。

FIG. 4 shows that IOX1 inhibited polarization of murine Th1 and Th17 in 48, 72 and 96 hour cultures (A) in a dose dependent manner, without affecting cell viability and proliferation in Th1 (B-C) and Th17 (D-E) cultures.

Fig. 5 shows that IOX1 suppresses polarization of Th1 and Th 17. (A) Representative FACS staining of IFN-gamma and IL-17 in initial derived murine Th1 and Th17 cultures (stimulated with anti-CD 3/CD28 antibodies) over 72 hours after treatment with various doses of IOX 1. (B) IFN-gamma in murine Th1 and Th17 (stimulated by anti-CD 3/CD28 antibodies) cultures ⁺ And IL-17 ⁺ Summary of cell frequencies (n=5 in each case). Cell viability (C) and proliferation (D) at 72 hours in initial derivative Th1 and Th17 cultures (E) after treatment with various doses of IOX1, representative FACS staining of IFN- γ and IL-17 in OTII Th1 and Th17 cultures (stimulated by OVA) at 72 hours after treatment with various doses of IOX 1. The significance level of the Mann-Whitney U test is indicated by asterisks (×p)<0.01)。

FIG. 6 shows the gene program for IOX1 regulation in Th17 cells. (A) The DEG is shown in the volcanic plot to change at least twice after IOX1 treatment, with P <0.05. (B) analysis of the pathway of enrichment in IOX 1-induced DEG using IPA. (C) IPA was used to analyze potential upstream mediators of IOX 1-induced DEG. Th17 cells were collected at 72 hours. CETSA was performed to analyze potential associations between IOX1 and JMJD3, KDM3A, KEM E (D), and between IOX1 and TET2, TET3 (E). The red rectangle highlights the change determined in CETSA of TET 2.

FIG. 7 shows that IOX1 directly regulates the expression of IL17a by direct association with TET2 on the IL17a promoter. (A) DNA methylation status was determined using bisulfite sequencing to analyze CpG sites on the Il17a proximal promoter in murine Th17 cells. CpG sites are numbered 1 to 12. A total of 36 clones from four independent experiments were sequenced. Methylation status of CpG sites #7 and #8 was found to be statistically different between DMSO and IOX1 treated Th17 cells (Fisher exact test, ×p <0.05). (B) summary of the frequency of demethylated CpG sites on the Il17a promoter. (C) TET2 binds to CpG-5 and CpG-6-8 sites of the II17a promoter after IOX1 treatment as determined by ChIP. (D) IOX1 binds to CpG-5 and CpG-6-8 sites of the IL17a promoter after IOX1 treatment as determined by Chem-IP. (E) WT (CD 4) under the action of IOX1 (20. Mu.M) ^Cre ) And TET 2-deficient (CD 4) ^Cre Tet2 ^f/f ) Representative FACS analysis of IL-17 expression in Th17 cells. (F) In WT (CD 4) ^Cre ) And TET 2-deficient (CD 4) ^Cre Tet2 ^f/f ) Summary of IOX 1-induced IL-17 inhibition in Th17 cells (n=3). (G) In WT (CD 4) ^Cre ) And TET 2-deficient (CD 4) ^Cre Tet2 ^f/f ) IL-17 induced by IOX1 in Th17 cells ⁺ Fold inhibition of cell frequency (n=3). The significance level of the Mann-Whitney U test is indicated by an asterisk (<0.05，**P<0.01)。

Fig. 8 shows: (A) A schematic of biotinylated IOX1 was generated for Chem-IP analysis. (B) In WT (CD 4) ^Cre ) (n=4) and TET 2-deficient (CD 4) ^Cre Tet2 ^f/f ) (n=3) inhibition of IOX 1-induced CCL20 expression in Th17 cells (measured by ELISA in culture supernatants) was summarized. (C) In WT (CD 4) ^Cre ) (n=4) and TET 2-deficient (CD 4) ^Cre Tet2 ^f/f ) (n=3) IOX 1-induced inhibition of CCL20 expression in Th17 cells. The significance level of the Mann-Whitney U test is indicated by an asterisk (<0.05)。

FIG. 9 shows the effect of IOX1 on murine EAU. (A) The cells were treated with DMSO or IOX1 (12.5 mg/kg, twice daily) 13 days after immunization (n=10 for each DMSO and IOX1 treated mice). (B) Representative fundus photographs showing severity of ocular inflammation and OCT at days 7, 9, 11 and 13 post immunization. (C) EAU clinical scores summary (n=10 for each DMSO and IOX1 treated mice). (D) representative FACS staining of retinal cells. (E) Retina CD45 ⁺ CD4 ⁺ Number of cells. (F) Retinal CD45 in all living cells of each retinal tissue ⁺ CD4 ⁺ Frequency of cells. (G) Retinal CD45 in all living cells of each retinal tissue ⁺ CD4 ⁺ IL-17 ⁺ Frequency of cells. (H) Retinal CD45 in all living cells of each retinal tissue ⁺ CD4 ⁺ IFN-γ ⁺ Frequency of cells. (I) Retinal CD45 in all living cells of each retinal tissue ⁺ CD4 ⁺ IL-17 ⁺ IFN-γ ⁺ Frequency of cells. (n=10 for each DMSO and IOX1 treated mice). The significance level of the Mann-Whitney U test is indicated by an asterisk (<0.05，**P<0.01)。

FIG. 10 shows CD4 in lymph nodes of IOX1 versus a typical murine EAU model at day 14 post-immunization ⁺ T cell effect. (A) representative FACS staining of ocular draining lymph nodes. CD45 in all living cells of ocular draining lymph nodes ⁺ CD4 ⁺ (B)、CD45 ⁺ CD4 ⁺ IL-17 ⁺ (C)、CD45 ⁺ CD4 ⁺ IFN-γ ⁺ (D) And CD45 ⁺ CD4 ⁺ IL-17 ⁺ IFN-γ ⁺ (E) Frequency of cells. (F) representative FACS staining of inguinal lymph nodes. CD45 in all living cells of inguinal lymph node ⁺ CD4 ⁺ (G)、CD45 ⁺ CD4 ⁺ IL-17 ⁺ (H)、CD45 ⁺ CD4 ⁺ IFN-γ ⁺ (I) And CD45 ⁺ CD4 ⁺ IL-17 ⁺ IFN-γ ⁺ (J) Frequency of cells. (K) representative FACS staining of spleen. CD45 in all living cells of each spleen ⁺ CD4 ⁺ (L)、CD45 ⁺ CD4 ⁺ IL-17 ⁺ (M)、CD45 ⁺ CD4 ⁺ IFN-γ ⁺ (N) and CD45 ⁺ CD4 ⁺ IL-17 ⁺ IFN-γ ⁺ (O) frequency of cells. (n=7 for each DMSO and IOX1 treated mice). The significance level of the Mann-Whitney U test is indicated by an asterisk (<0.05)。

FIG. 11 shows the CD4 of the IOX1 pair adoptive transfer ⁺ Effect of T cell-induced intraocular inflammation. (A) Adoptive transfer of CD4 with IOX1 or DMSO treatment ⁺ Schematic representation of T-cell producing EAU mice. (B) Representative fundus photographs showing severity of ocular inflammation and OCT at days 5, 7, 9, and 11 after cell transfer. (C) EAU clinical scores summary (n=10 for each DMSO and IOX1 treated mice). (D) representative FACS staining of retinal cells. (E) Retina CD45 ⁺ CD4 ⁺ Number of cells. (F) Retinal CD45 in all living cells of each retinal tissue ⁺ CD4 ⁺ Frequency of cells. (G) Retinal CD45 in all living cells of each retinal tissue ⁺ CD4 ⁺ IL-17 ⁺ Frequency of cells. (H) Retinal CD45 in all living cells of each retinal tissue ⁺ CD4 ⁺ IFN-γ ⁺ Frequency of cells. (I) Retinal CD45 in all living cells of each retinal tissue ⁺ CD4 ⁺ IL-17 ⁺ IFN-γ ⁺ Frequency of cells. (n=10 for each DMSO and IOX1 treated mice). The significance level of the Mann-Whitney U test is indicated by an asterisk ( <0.05，**P<0.01，***P<0.001，****P<0.0001)。

FIG. 12 shows CD4 in lymph nodes of murine EAU model on day 10 IOX1 versus adoptive transfer following cell metastasis ⁺ T cell effect. (A) representative FACS staining of ocular draining lymph nodes. CD45 in all living cells of ocular draining lymph nodes ⁺ CD4 ⁺ (B)、CD45 ⁺ CD4 ⁺ IL-17 ⁺ (C)、CD45 ⁺ CD4 ⁺ IFN-γ ⁺ (D) And CD45 ⁺ CD4 ⁺ IL-17 ⁺ IFN-γ ⁺ (E) Frequency of cells. (F) representative FACS staining of inguinal lymph nodes. CD45 in all living cells of inguinal lymph node ⁺ CD4 ⁺ (G)、CD45 ⁺ CD4 ⁺ IL-17 ⁺ (H)、CD45 ⁺ CD4 ⁺ IFN-γ ⁺ (I) And CD45 ⁺ CD4 ⁺ IL-17 ⁺ IFN-γ ⁺ (J) Frequency of cells. (K) representative FACS staining of spleen. CD45 in all living cells of each spleen ⁺ CD4 ⁺ (L)、CD45 ⁺ CD4 ⁺ IL-17 ⁺ (M)、CD45 ⁺ CD4 ⁺ IFN-γ ⁺ (N) and CD45 ⁺ CD4 ⁺ IL-17 ⁺ IFN-γ ⁺ (O) frequency of cells. (n=7 for each DMSO and IOX1 treated mice). The significance level of the Mann-Whitney U test is indicated by an asterisk (<0.05)。

Detailed Description

Unless defined otherwise, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention relates.

In the context of the present invention, the following terms have the meanings detailed below.

The term "alkyl" refers to a hydrocarbon chain radical that is straight or branched and contains no unsaturation, and is attached to the rest of the molecule by a single bond. Typical alkyl groups contain 1 to 12 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12), 1 to 8, 1 to 6, or 1 to 3 carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, n-pentyl, and the like. If the alkyl group is substituted with cycloalkyl, it is correspondingly "cycloalkylalkyl", such as cyclopropylmethyl. If the alkyl group is substituted with an aryl group, it is correspondingly "aralkyl" such as benzyl, benzhydryl or phenethyl. If an alkyl group is substituted with a heterocyclic group, then it is correspondingly "heterocyclylalkyl".

The term "alkenyl" refers to a straight or branched hydrocarbon chain radical containing at least two carbon atoms, at least one unsaturated bond, and the hydrocarbon chain radical is attached to the rest of the molecule by a single bond. Typical alkenyl groups contain 2 to 12 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12), 2 to 8, 2 to 6, or 2 to 4 carbon atoms. In particular embodiments, the alkenyl group is vinyl, 1-methyl-vinyl, 1-propenyl, 2-propenyl, or butenyl.

The term "cycloalkyl" refers to an alicyclic hydrocarbon. Typical cycloalkyl groups contain 1 to 4 monocyclic and/or fused rings, 3 to 18 carbon atoms, preferably 3 to 10 (e.g. 3, 4, 5, 6, 7, 8, 9, 10) carbon atoms, such as cyclopropyl, cyclohexyl or adamantyl. In specific embodiments, cycloalkyl groups contain 3 to about 6 carbon atoms.

The term "aryl" refers to a monocyclic or polycyclic radical, including polycyclic radicals containing a single aryl group and/or a fused aryl group. Typical aryl groups contain 1 to 3 monocyclic or fused rings and 6 to about 18 carbon ring atoms, preferably 6 to about 14 (e.g., 6, 8, 10, 12, 14) carbon ring atoms, such as phenyl, naphthyl, biphenyl, indenyl, phenanthryl, or anthracyl.

The term "heterocyclyl" includes heteroaromatic and heteroalicyclic groups containing 1 to 3 monocyclic and/or fused rings and 3 to 18 ring atoms. Preferred heteroaromatic and heteroalicyclic groups contain from 5 to 10 (e.g., 5, 6, 7, 8, 9, 10) ring atoms. Suitable heteroaryl groups in the compounds of the invention contain 1,2 or 3 heteroatoms selected from N, O or S atoms. Heteroaryl groups include, for example, coumarin, including 8-coumarin, quinolinyl, including 8-quinolinyl, isoquinolinyl, pyridinyl, pyrazinyl, pyrazolyl, pyrimidinyl, furanyl, pyrrolyl, thienyl, thiazolyl, isothiazolyl, triazolyl, tetrazolyl, isoxazolyl, oxazolyl, imidazolyl, indolyl, isoindolyl, indazolyl, indolizinyl, phthalazinyl, pteridinyl, purinyl, oxadiazolyl, thiadiazolyl, furazayl, pyridazinyl, triazinyl, cinnolinyl, benzimidazolyl, benzofuranyl, benzofurazayl, benzothienyl, benzothiazolyl, benzoxazolyl, quinazolinyl, quinoxalinyl, naphthyridinyl, and furopyridinyl. Suitable heteroalicyclic groups in the compounds of the present invention contain 1,2 or 3 heteroatoms, wherein the heteroatom is selected from N, O or S atom, and the heteroalicyclic group includes, for example, pyrrolidinyl, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothienyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, oxathiolanyl, piperazinyl, azetidinyl, oxetanyl, thietanyl, homopiperidinyl, oxetanyl, thiiranyl, azepanyl, oxaazepanyl, diazepinyl, triazepinyl, 1,2,3, 6-tetrahydropyridinyl, 2-pyrrolinyl, 3-pyrrolinyl, indolinyl, 2H-pyranyl, 4H-pyranyl, dioxanyl, 1, 3-dioxolanyl, pyrazolinyl, dithianyl, dithiolanyl, dihydrothiophenyl, pyrazolidinyl, imidazolinyl, 3-aza [ 3.0.1-3-1.0 ] bicycloindolyl, and bicycloindolyl.

The term "halogen" or "halo" refers to bromo, chloro, iodo or fluoro.

The term "salt" is understood to mean any form of the compounds of the general formula I according to the invention, in which the compounds are in ionic form or are charged and are coupled with ions (cations or anions) of opposite charge or are in solution. The definition also includes quaternary ammonium salts and complexes of the molecule with other molecules and ions, particularly complexes formed by ionic interactions.

The term "esters" is understood to mean the compounds which are produced by the reaction of an acid with the hydroxyl groups of the compounds of the formula I according to the invention.

The term "solvate" is understood to mean any form of the compound of the invention, wherein the compound is linked to another molecule (usually a polar solvent) by a non-covalent bond, including in particular hydrates and alcoholates, such as methanolate.

The term "prodrug" is used in its broad sense and encompasses derivatives which can be converted in vivo to the compounds of the invention. Examples of prodrugs include, but are not limited to, derivatives and metabolites of the compounds of formula (I), including biohydrolyzable moieties such as biohydrolyzable amides, biohydrolyzable esters, biohydrolyzable carbamates, biohydrolyzable carbonates, biohydrolyzable ureides, and biohydrolyzable phosphate analogs. Preferably, the prodrug having a carboxyl functionality is a lower alkyl ester of a carboxylic acid. The carboxylic acid esters are readily esterified from any carboxylic acid moiety present in the molecule. Prodrugs can generally be prepared by known methods, such as those described in Burger "Medicinal Chemistry and Drug Discovery, sixth edition (Donald J. Abraham ed.,2001, wiley) and" Design and Applications of Prodrugs "(H. Bundgaard ed.,1985,Harwood Academic Publishers).

The term "autoimmune disease" refers to a disease caused by an immune response of an organism to an autoantigen resulting in damage to self-tissues. Autoimmune diseases are the result of inappropriate and excessive responses to self-antigens. Examples of autoimmune diseases include, but are not limited to, addison's disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune parotitis, crohn's disease, diabetes (type 1), dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, graves ' disease, gillin-barre syndrome, hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, sjogren's syndrome, spondyloarthropathies, thyroiditis, vasculitis, vitiligo, myxoedema, pernicious anemia, ulcerative colitis, and the like.

The term "inflammation" is usually said to be a defensive response of the body to stimulus, manifested by redness, swelling, heat, pain and dysfunction; it may be an infectious inflammation caused by an infection, or may be a non-infectious inflammation not caused by an infection, such as an inflammation caused by an immune response (e.g., various types of hypersensitivity reactions, inflammation caused by some autoimmune diseases). Inflammatory lesions may occur on the body surface and/or in the body.

The term "Ocular Inflammatory Disease (OID)" is a generic term that includes a variety of diseases and conditions in which inflammation affects the eye or surrounding tissue. In general, the diagnostic name of OID is given based on the location of ocular inflammation, e.g., uveitis is an inflammation of the uvea, scleritis is an inflammation of the sclera, pars planitis (pars planis) is an inflammation of the pars plana (pars plana), etc. The etiology of OID can be divided into infectious and non-infectious, wherein infectious OID refers to infection by a pathogen such as bacteria, viruses, fungi, rickettsiae, parasites, etc.; non-infectivity can be divided into exogenous and endogenous, wherein exogenous OID mainly comprises physical injury caused by trauma, surgery, etc., chemical injury caused by acid-base and medicine, etc., blood-eye barrier destruction and vascular permeability increase; endogenous OID is mainly due to autoimmune reactions. OID is often a manifestation of systemic autoimmune disease.

The term "uveitis" also known as uveitis is a generic term for inflammation of iris, ciliary body, and choroidal tissues. According to the disease parts, anterior uveitis, posterior uveitis, middle uveitis and total uveitis can be classified; wherein the anterior uveitis comprises iritis, anterior ciliary body inflammation, and iridocyclitis; posterior uveitis affects the posterior choroidal and retinal tissues of the vitreous membrane; intermediate uveitis involves the pars plana, peripheral retina, vitreous base; full uveitis refers to a mixture of anterior uveitis, intermediate uveitis, and posterior uveitis. An "acute" uveitis is a form of uveitis in which signs and symptoms suddenly occur and persist for up to about six weeks. "chronic" uveitis is a form of its progressive onset and lasts longer than about six weeks.

The clinical manifestations of uveitis mainly include: redness of the eye, eye pain, photophobia, tearing, blurred vision, hypopsia, eye front shadow waving, distortion of vision, etc., even complete vision loss. Uveitis can cause various complications, and common complications include zonal corneal degeneration, cataract, macular edema, optic disc edema, macular surface fold change, corneal edema, glaucoma, retinal detachment, and the like.

The term "pharmaceutically acceptable" means that the indicated material does not have properties that lead to a reasonably cautious physician avoiding administration of the material to the patient, in view of the disease to be treated and the corresponding route of administration. For example, such materials are often required to be substantially sterile.

The term "treatment" refers to preventing, curing, reversing, attenuating, alleviating, minimizing, inhibiting, arresting, and/or stopping one or more clinical symptoms of a disease after the onset of the disease.

The term "preventing" refers to the prevention, treatment to avoid, minimize or make difficult the onset or progression of a disease prior to the onset of the disease.

The terms "patient" or "subject" and the like are used interchangeably herein to refer to any animal or cell thereof, whether in vitro or in situ, treated according to the methods described herein. Specifically, the aforementioned animals include mammals, for example, rats, mice, guinea pigs, rabbits, dogs, monkeys or humans, particularly humans.

The term "effective amount" refers to an amount that provides a therapeutic or prophylactic benefit, which includes the amounts of the following compounds: when administered, it is sufficient to prevent the development of, or to alleviate to some extent, one or more of the signs or symptoms of the disease being treated. The "effective amount" will vary depending on the compound, the disease and its severity, and the age, weight, etc., of the subject to be treated.

Various publications, patents, and published patent specifications cited herein are incorporated by reference in their entirety.

The technical solutions of the present invention will be clearly and completely described in conjunction with the embodiments of the present invention, and it is apparent that the described embodiments are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

The materials and methods used in the examples of the invention are as follows:

material

An epigenetic compound library (class number L1900) containing 128 compounds was purchased from Selleck, U.S.A. All compounds were initially placed in DMSO solutions (stock concentration 10 mM) and further diluted to working solutions according to the instructions in each experiment. Murine anti-CD 3, anti-CD 28, anti-IL-4 and anti-IFN-gamma antibodies for cell culture were purchased from eBioscience, USA. Murine anti-IL-17, anti-IFN-gamma, anti-CD 3, anti-CD 4, anti-CD 44 and anti-CD 62L antibodies for FACS analysis or sorting were purchased from Biolegend, U.S.A. Human anti-IL-17, anti-IFN-gamma antibodies for FACS were purchased from Biolegend, U.S.A. Recombinant murine mIL-2 was purchased from PeproTech, U.S.A. Recombinant murine mIL-6, mIL-12 and recombinant human hTGF-beta 1 were purchased from R & D Systems, U.S.A. anti-TET 2 (accession number 45010), anti-TET 3 (ab 139311), anti-JMJD 3 (accession number 3457), anti-KDM 3A (accession number 12835-1-AP) and anti-KDM 4E (accession number TA 337374) antibodies were purchased from Merck, abcam, U.S. Proteintech, oriGene, U.S. middle.

A mouse

Female C57BL6/J, B10.RIII or OT-II (8-10 weeks) mice were purchased from Charles River or Guangdong province medical laboratory animal center (China). CD4 ^Cre Tet2 ^f/f Mice are gifts from the university of Shanghai traffic Chen Guojiang professor. All animals were housed in SPF facilities at university of bristol, center of mountain ophthalmology, or center of mountain university cancer. All animal experiments have been approved by institutional animal care and use committee at university of bristol, center of chinese ophthalmology, or center of chinese university cancer. All animal related work was done according to ARVO statement of animal use in ophthalmic and vision research.

Murine CD4 ⁺ T cell culture

The murine lymph nodes and spleen were dissected and treated into single cell suspensions. Total CD4 was isolated using CD4 (L3T 4) microbeads (Miltenyi Biotec, germany) according to the manufacturer's instructions ⁺ T cells. Alternatively, CD62L was sorted using BD Aria sorter ⁺ CD44 ^- Initial CD4 ⁺ T cells were FACS sorted. Obtained CD4 ⁺ The purity of T cells is greater than 95%. CD4 to be isolated ⁺ T cells were seeded into 96-well plates (10 ten thousand cells/well) pre-coated with 5. Mu.g/ml anti-CD 3 and 2. Mu.g/ml anti-CD 28. The T helper cells were polarized under the following conditions: th1 (20 ng/ml mIL-12 and 100ng/ml anti-IL-4), th17 (20 ng/ml mIL-6, 1ng/ml hTGF-. Beta.1, 100ng/ml anti-IL-4 and 100ng/ml anti-IFN-. Gamma.) and iTreg (50 ng/ml mIL-2 and 10ng/ml hTGF-. Beta.1) all cells contained 5% CO at 37 ℃ ₂ In a humidified incubator (II) with RPMI-1640 containing 10% FCS, pen/Strep and 2-mercaptoethanol. In the screening experiments, at the beginning of cell polarization, the cell was then128 epigenetic compounds were added to the cultures, where the concentrations were determined by published data or preliminary experiments. In the OTII experiment, spleen cells from 57BL6/J mice were collected and irradiated to APC; isolation of CD4 from 57BL6 OT-II Tg mice ⁺ T cells and inoculated with APC (1 CD4:10 APC) under polarized culture conditions (Th 1:4ng/ml mIL-12 and 4. Mu.g/ml anti-IL-4 mAb; th17: 4. Mu.g/ml anti-IL-4 mAb, 1.2ng/ml hTGF-. Beta., 4ng/ml mIL-6,2ng/ml mIL-1. Alpha., 4. Mu.g/ml anti-IL-12 mAb and 8. Mu.g/ml anti-IFN-. Gamma.mAb) and OVA peptide (2. Mu.g/ml).

Human peripheral blood CD4 ⁺ Isolation and treatment of T cells

After informed consent was obtained according to a protocol approved by the national institutes of health services, negative selection was made at the university of british hospital trust foundation (04/Q2002/84) from peripheral blood of Healthy Controls (HC) (n=6, 5 females and 1 male; average age 32.83 years) to obtain CD4 ⁺ T cells. Written informed consent was obtained from all study participants. Up to 80ml of non-coagulated peripheral blood was combined with rosetteep human CD4 according to manufacturer's instructions ⁺ Incubation of T cell enriched mixture (STEMCELL Technologies, canada) with Ficoll-Paque PLUS (GE Healthcare, USA) gave CD4 ⁺ T cells. Removal of enriched CD4 by density gradient ⁺ T cells and washed in RPMI-1640 (thermosusher, usa) supplemented with 10% fetal bovine serum (Gibco, usa). Human CD4 ⁺ The purity of T cells is greater than 95%.

Stimulation of CD4 with immunomagnetic beads human T activator CD3/CD28 (Gibco, USA) ⁺ T cells and seeded in 96-well microwell plates (10 ten thousand cells/well) with or without DMSO, or indicated IOX1 concentration in complete RPMI1640 medium. Cells were stimulated with PMA and ionomycin for 4 hours prior to harvest on day 5 for proliferation and intracellular cytokine staining analysis.

Flow cytometry

DEAD cells can be removed using LIVE/DEAD fixable DEAD cell fuel kit (Thermofisher Scientific, usa). In FACS analysis, fcgammaRII/III (24G 2; supernatant) was used to block non-specific antibody binding. Cells were incubated with a primary antibody against a cell surface marker, and then intracellular cytokine staining was performed using the protocol described previously (Zou, Y.et al DNA Methylation Inhibitor Zebularine Controls CD4 (+) T Cell Mediated Intraocular Information. Front in immunology 10,1950, doi:10.3389/fimmu.2019.01950 (2019)). All samples were analyzed using BD LSR II or BD LSR Fortessa X-20 (BD Bioscience, usa) flow cytometry and FCS data using FlowJo v10 (Tree Star inc., usa).

RNA sequencing analysis

Total RNA was extracted from IOX1 or DMSO treated Th17 cells (n=2) using MasterPure Complete DNA and RNA purification kit (Epicentre, uk) according to manufacturer's instructions. A total of 100ng RNA was sonicated into fragments with 300-400 base pairs using a Biorupter PLUS (Diagenode, belgium). mRNA libraries were prepared using the VAHTS mRNA-seq V3 library preparation kit for Illumina (Vazyme, nanj, china) according to the manufacturer's protocol, and sequenced on an Illumina Hiseq2500 sequencer using the Hiseq SR cluster kit V4 and the Hiseq SBS kit V4 cycle kit 50 (Illumina). The initial treatment was performed by casova (v1.8.2). Quality control of sequencing reads was then accomplished by FastQC (v0.11.5) and trimmed by Cutadapt (v1.9.1). Then, differential Expression Gene (DEG) analysis was performed on quality control readings using DEseq2, and path analysis was performed using Ingenuity Pathway Analysis (IPA).

ELISA

Supernatants were collected from Th17 cell cultures treated with DMSO or IOX1 (20. Mu.M) over 72 hours and analyzed using CCL20 ELISA kit (Classification No. ab100728, abcam, USA) according to manufacturer's instructions.

Bisulfite sequencing

DNA was extracted from cultured Th17 cells using a Epicenter MasterPure purification kit (EpiCenter, usa); transformation was then performed with the EpiTect bisulfite kit (Qiagen, germany) according to the manufacturer's instructions. After transformation, the DNA was purified and eluted into 20 μl elution buffer. The Il17a promoter sequence was PCR amplified, TA cloned, and more than 30 clones were sequenced. The following primer pairs were used: bisulfite-F: TAAATATTAATAGGTTTTTTGATAATATGT; bisulfite-R: AATAAAA-CTCTCCCTAAACTCATATTTA.

Chromosome immunoprecipitation (ChIP)

ChIP analysis was performed using ChIP-IT kit (Active Motif, usa). Briefly, th17 cells treated with IOX1 or DMSO were fixed with a fixation buffer containing 1% formaldehyde for 15 min at room temperature. Then, the nuclear DNA-protein complex was extracted using a bioluper PLUS (dieager, belgium) and sonicated. Samples were incubated with anti-TET 2 antibodies overnight at 4 ℃. The antibody-DNA complex is then captured by protein G agarose beads. The immunoprecipitated DNA was then purified and quantified by real-time PCR. The following primer pairs were used: cpG-6-8-F: TCTGCCCTTCCCATCTAC; cpG-6-8-R: TCCCTGGACT-CATGTTTG; cpG-5-F: TGCTCTCTAGCCAGGGAA; cpG-5-R: ATGGGAAGGGC-AGAAGTT.

Cell thermal transfer analysis (CETSA)

CETSA is carried out as described above (Jafari, R.et al. The cellular thermal shift assay for evaluating drug target interactions in cells. Nature protocols 9,2100-2122, doi:10.1038/nprot.2014.138 (2014)). Briefly, total CD4 was isolated ⁺ T cells were polarized for 3 days under Th17 conditions. IOX1 (20. Mu.M) was added to the culture 4 hours prior to harvest. After harvesting, the cells were washed twice in PBS at room temperature and resuspended in PBS containing protease inhibitors in 200 μl PCR tube. The cells were then warmed to different temperatures and then snap frozen in liquid nitrogen. Proteins extracted from the treated cells were then loaded onto 7.5%15 well microgels in a Bio-Rad Mini-protein Tetra system and analyzed using antibodies against JMJD3, KDM3A, KDM4E, TET and TET 3.

Chem-IP-PCR analysis

The method is based on previous studies by Anders et al (Anders, L.et al genome-wide localization of small molecules Nature biotechnology 32,92-96, doi:10.1038/nbt.2776 (2014)). Briefly, by Danmanng Peptides inc (china) synthesizes biotinylated IOX1. The product was validated using liquid chromatography-mass spectrometry and nuclear magnetic resonance. Isolation of Total CD4 ⁺ T cells were polarized for 3 days under Th17 conditions. 3 hours prior to harvesting the cells, 20. Mu.M IOX 1-biotin or 20. Mu.M biotin was added to Th17 cells. Then, at room temperature, the cells were fixed with a fixation buffer containing 1% formaldehyde for 15 minutes, and the fixation was terminated by adding a 5-minute termination buffer. Sonication was performed using a Biorupter PLUS (Diagenode, belgium) and all samples were incubated with streptavidin microbeads (MyOne streptavidin T1, invitrogen) overnight at 4 ℃, washed with PBS containing 0.1% BSA, and eluted with the elution buffer in the ChIP kit described above at 70 ℃. The immunoprecipitated DNA was then purified and quantified by real-time PCR.

Experimental Autoimmune Uveitis (EAU)

On day 0, b10.riii mice were immunized subcutaneously along the thigh with 100 μl of recombinant human inter-photoreceptor retinoid binding protein (IRBP) peptide (161-180) (1 mg/mL) at 1: the ratio of 1 (v: v) was emulsified in complete Freund's adjuvant containing 2.5mg of Mycobacterium tuberculosis (Mycobacterium tuberculosis) complete H37Ra (BD Biosciences). After immunization, each mouse was intraperitoneally injected with 1 μg bordetella pertussis toxin (Tocris Bioscience). IOX1 (12.5 mg/kg) or DMSO solutions were administered intraperitoneally twice daily from day 0 to day 13. On day 14, all mice were sacrificed for analysis. To evaluate the clinical scores of EAU, we performed local endoscopic fundus imaging (TEFI) with a Micron III murine bottom camera (Phoenix Research Labs, usa) with simultaneous spectro-Optical Coherence Tomography (OCT) scan. Clinical scores were given by two experienced independent observers in a blind manner according to the EAU scoring criteria described previously (Copland, D.A. et al, clinical time-course of experimental autoimmune uveoretinitis using topical endoscopic fundal imaging with histologic and cellular infiltrate correlation, research and visual science 49,5458-5465, doi:10.1167/iovs.08-2348 (2008); chu, C.J. et al, quality and in vivo scoring of murine experimental autoimmune uveoretinitis using optical coherence, clinical.PloS one 8, e63002, doi: 10.1371/journ.0063002 (2013)).

CD4 ⁺ Uveitis induced by T cell adoptive transfer

EAU was induced in donor mice in the manner described above. On day 11, spleens and lymph nodes were obtained from donor mice and made into single cell suspensions. About 7.5X10 were cultured in 25ml of complete RPMI1640 medium supplemented with 20ng/ml murine IL-23 and 10. Mu.g/ml hIRBP161-180 peptide ⁶ Individual cells/flasks. After 24 hours, 10ml of fresh medium (final concentration 10 ng/ml) containing murine IL-2 was added to the culture. After 72 hours, ruptured CD4 was isolated using CD4 (L3T 4) microbeads (Miltenyi Biotec, germany) ⁺ T cells. Together, 200 ten thousand CD4 ⁺ T cells (in 200 μl PBS) were transferred intraperitoneally adoptively into each of the primary recipient mice. The clinical scores of EAU were assessed in the manner described above.

Statistics

Statistical analysis was performed using Prism Graphpad 7.0 (GraphPad Software, usa). The Mann-Whitney U test, the Kruskal-Wallis test or the two-way ANOVA test were used accordingly.

Example 1: in vitro CD4 ⁺ Screening of a library of epigenetic compounds of IFN-gamma and IL-17A inhibitors in T cells

The inventors have found in previous studies that epigenetic regulation is in CD4 ⁺ Plays a critical role in T cell differentiation. To systematically assess which molecular components of the epigenetic mechanism can be directly manipulated to achieve optimal control of inflammatory cytokine expression in helper T cells, the inventors screened a commercially available "epigenetic compound pool" (from Selleck in 2015) and studied its potential role in proliferation and differentiation of Th1, th17 and Treg cells. The compound library collected 128 epigenetic enzymes and signal molecule inhibitors, including Histone Deacetylase (HDAC), JAK, histone demethylase, histone Acetyltransferase (HATs), DNA, and methyltransferase (Dnmts) (as shown in fig. 1A). Murine Th1, th17 and induced Treg (iTr) were first used eg) the culture system screened the effect of these 128 compounds on Th cell differentiation and viability (as shown in figure 1A). Based on previous applications in the relevant literature or preliminary results obtained by the inventors in murine Th cell cultures, two doses (i.e. low and high) were selected for each compound (as shown in table 1). 4000 cultures were performed and the response to all these 128 compounds was characterized for Th1, th17 and iTreg cells. The marker cytokines IFN-. Gamma.and IL-17 and the transcription factor Foxp3, detected by FACS staining, were used as differentiation markers for Th1, th17 and iTreg, respectively. As shown in FIG. 1B, 11 compounds (i.e., the selective aurora kinase A inhibitor Alisertib) were found to be IFN-gamma in Th1 cultures at high doses ⁺ The frequency of cells was increased at least 2-fold, while 52 compounds (i.e., JAK2 inhibitor CEP-33779) were found to increase IFN- γ in Th1 cultures ⁺ The frequency of the cells is reduced by at least a factor of 2. On the other hand, 10 compounds (i.e. PARP inhibitor AZD 2461) were found to bind IL-17 in Th17 cultures at high doses ⁺ The frequency of cells was increased at least 2-fold, while 42 compounds (i.e., the bromodomain-containing protein inhibitor molibbesib) were found to bind IL-17 in Th17 cultures ⁺ The frequency of the cells is reduced by at least a factor of 2. All compounds tested failed to promote Foxp3 expression in the iTreg cells. Importantly, of those inhibitors of Th1 (52) and Th17 (42) differentiation, the inventors found that about 62% of the inhibitors resulted in significant cell death (at least 20% decrease in cell viability). Thus, the results indicate that inhibition of the expression of key inflammatory cytokines in Th1 and Th17 cells is generally accompanied by a decrease in cell viability under the action of epigenetic drugs.

Next, the inventors selected five compounds that inhibited IFN- γ expression in Th1 cells and IL-17 expression in Th17 cells, but did not affect T cell viability, including INO-1001, AZD1208, IOX1, OTX015, and Tubastatin a. Th1 and Th17 cultures using OTII systems stimulated with antigen-specific OVA and peripheral blood Total CD4 from healthy volunteers ⁺ T cells were used to examine whether these 5 candidate compounds were still able to control IFN- γ and IL-17 expression in vitro. As shown in fig. 2A-B, none of these five compounds inhibited IFN- γ expression in Th1 cells,whereas IOX1 and OTX015 inhibited IL-17 expression in Th17 cells. Furthermore, under stimulation with high doses of AZD1208, IOX1 and OTX015, inhibition of IFN-gamma and IL-17 was observed in Th1 and Th17 cells (as shown in FIGS. 2C-D). These data indicate that IOX1 and OTX015 can act as candidate inhibitors of Th1 and Th17 differentiation.

TABLE 1 Compounds of the epigenetic Compound library and high and Low doses thereof

/>

Example 2: IOX1 inhibits CD4 ⁺ IL-17 expression in T cells in vitro

Because of the limited in vivo anti-inflammatory effect of OTX015 (data not shown), the inventors focused further research on IOX1, a potent broad-spectrum inhibitor of 2OG oxygenase, comprising JmjC demethylase and DNA demethylase. In addition to the screening assays, the inventors further examined the inhibition of IFN- γ and IL-17 expression in Th1 and Th17 cells by two different doses of IOX1 after 48 hours, 72 hours and 96 hours of incubation (as shown in FIGS. 3B-D and 4A-E). The results indicate that IOX1 preferentially controls Th17 differentiation without altering CD4 in vitro ⁺ Viability and proliferation of T cells in T cell total culture. These results were further confirmed using initial T cell derived Th1 and Th17 cultures (as shown in FIGS. 5A-D). Furthermore, when using OVA-stimulated OT-II cell system, the inventors found that IOX1 only inhibited antigen-specific Th17 differentiation, and did not affect Th1 differentiation (as shown in fig. 5E). Interestingly, in human CD4 ⁺ IOX1 showed significant inhibition of both cytokine expression and cell proliferation in T cell culture (FIGS. 3E-F). The study conclusion is: IOX (IOX) 1 has an anti-inflammatory effect on helper T cells, preferably on Th17 cells in vitro.

Example 3: IOX1 inhibits Il17a expression by targeting TET2 protein

To explore the overall effect of IOX1 on Th17 cells, the inventors performed RNA sequence analysis to profile changes in whole genome expression induced by IOX1 in Th17 cells. As shown in the volcanic plot (shown in fig. 6A), IOX1 significantly down-regulated the expression of 36 genes (P <0.05, fold change > 2) and up-regulated the expression of only 7 genes in Th17 cells (shown in table 2). Expression of both Th 17-marker cytokines Il17a and Ccl20 were significantly inhibited by IOX1 (as shown in fig. 6A). However, under the action of IOX1, no changes in transcription factors (e.g., rorc, rora, stat3 or Irf 4) that promote Th17 differentiation were found. Further gene ontology analysis using the Ingenuity Pathway Analysis procedure showed that 43 IOX1 response genes were significantly enriched in IL-17A signaling and inflammatory corpuscles pathways (as shown in fig. 6B), while various upstream regulators could be responsible for the regulation of IOX1 response genes (as shown in fig. 6C). Thus, transcriptomic analysis showed that IOX1 can only inhibit key cytokine expression in Th17 cells.

TABLE 2 variation of genome-wide expression induced by IOX1 in Th17 cells

/>

To further elucidate the molecular mechanism by which IOX1 inhibits Il17a expression, the inventors next studied the potential targets of IOX1 in Th17 cells. Potential targets for IOX1 as inhibitors of 2OG oxygenase include histones and DNA demethylases. These demethylases play a critical role in the demethylation of methylated-mediated DNA and histone markers (including H3K4me3, H3K9me3, and H3K27me 3), together with the coordination of epigenetic regulation of Th17 differentiation. Since H3K27me3 demethylase JMJD3 and DNA demethylase TET2/TET3 proved to be activators of IL-17 expression, and H3K9me3 could regulate IL-17 expression, the inventors examined whether IOX1 targets histone demethylases JMJD3, KDM3A, KDM E, and DNA demethylase TET2/TET3 to inhibit IL17a expression in Th17 cells. Cell thermal transition analysis was performed to examine whether IOX1 interacted directly with its targeting protein. As shown in fig. 6D-E, IOX1 interacted with TET2, but not JMJD3, KDM3A, KDM4E, or TET 3. The data indicate that IOX1 can function by interacting with DNA demethylase TET2 in Th17 cells.

If TET2 is the target of IOX1 in Th17 cells, the DNA demethylation state of the IL17a promoter can be altered by the action of IOX 1. Thus, the inventors next performed a bisulfite sequencing analysis to detect the frequency of DNA demethylation (600 to +200bp of the transcription start site) at all 12 CpG sites present on the Il17A promoter (as shown in fig. 7A). The data indicate that IOX1 significantly reduced the frequency of DNA demethylation at CpG sites 7 and 8 (as shown in figure 7B). Moreover, chIP analysis demonstrated that TET2 binds directly to CpG-6-8 site of Il17a promoter, while Chem-IP analysis (fig. 8A shows the chemical structure of biotinylated IOX 1) indicated that IOX1 also binds to CpG-6-8 site of Il17a promoter. Taken together, these results indicate that IOX1 interacts directly with TET2 on the Il17a promoter, which can counteract the DNA demethylating function of TET 2.

To verify whether IOX1 works by targeting TET2, the inventors further studied the IL-17 inhibition of IOX1 in TET 2-deficient Th17 cells. As shown in FIGS. 7C-E, CD4 defective in TET2 ⁺ Among T cells, polarization of Th17 cells is significantly affected. However, under the action of IOX1, IL-17 ⁺ The mean fold reduction of cells was changed from 7.5 fold for wild type to 2.5 fold for TET2 deficient Th17 cells (as shown in fig. 7D-E). In addition to Il17a, RNA sequencing data also showed that IOX1 significantly reduced expression of Ccl20 in Th17 cells (as shown in fig. 6A). As shown in FIGS. 8B-C, the average fold reduction of CCL20 protein in the supernatant of Th17 culture was changed from 4.0 fold for wild type to 1.7 fold for TET2 deficient Th17 cells under the action of IOX 1. Research knot The theory is that: TET2 does play a mediating role in the inhibition of IL-17 expression by IOX 1.

Example 4: IOX1 controls in vivo intraocular inflammation

To investigate the anti-inflammatory effect of IOX1 in vivo, the inventors first examined whether intraperitoneal administration of IOX1 could control uveal retinitis using a classical murine EAU model (see "methods" section). During IOX1 treatment, mice receiving drug treatment were not found to develop weight loss (as shown in fig. 9A). Local endoscopic fundus imaging (TEFI) and OCT scans were performed daily to assess the severity of ocular inflammation in EAU mice. As shown in fig. 9B-C, retinal inflammation began on day 7 and peaked on day 13 after immunization. The evaluation results demonstrate that IOX1 treatment significantly reduced the severity of intraocular inflammation, as evidenced by a reduction in fundus clinical scores. Next, the inventors prepared single cell suspensions using eyes, eye draining lymph nodes, inguinal lymph nodes and spleen of EAU mice treated with DMSO or IOX1 on day 14 after immunization, and analyzed CD4 producing IFN-. Gamma.and IL-17 ⁺ A T cell population. In the eye, IOX1 treatment was observed to significantly reduce total CD4 in the eye ⁺ 、CD4 ⁺ IFN-γ ⁺ 、CD4 ⁺ IL-17 ⁺ And CD4 ⁺ IFN-γ ⁺ IL-17 ⁺ The number and frequency of T cells (as shown in figures 9D-I). In contrast, outside the eye, the only change induced by IOX1 treatment was observed to be CD4 in the inguinal lymph node ⁺ IL-17 ⁺ T cell depletion (as shown in fig. 10A-O). Thus, these data demonstrate that systemic administration of IOX1 can control intraocular inflammation without significantly altering systemic CD4 ⁺ A T cell population.

Systemic administration of IOX1 can control intraocular inflammation by modulating multiple cell types. Thus, the next use of pathogenic CD4 transferred by adoptive transfer ⁺ T cell-induced EAU model (AT-EAU), detection of whether IOX1 can be modified only by CD4 ⁺ T cells function. Total spleen cells from EAU mice were cultured in vitro with DMSO or IOX1 for two days. Then, CD4 isolated from these cultures ⁺ T cell transfer into recipient miceUveoretinitis was induced within 5 days (as shown in fig. 11A). Using TEFI, the inventors found that IOX 1-treated CD4 compared to DMSO-treated cell transfer ⁺ Pathogenic T cell-induced intraocular inflammation was significantly reduced (as shown in fig. 11B). In the case of transfer of IOX 1-treated cells, a reduction in the severity of clinical disease in mice is accompanied by an in-focus inflammatory CD4 ⁺ A substantial decrease in T cells (particularly Th17 cells) (as shown in fig. 11D-I), and a decrease in Th17 cells of the draining lymph nodes of the eye (as shown in fig. 12A-O). The study conclusion is: IOX1 does control Th 17-mediated inflammation in vivo.

The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is to be construed as including any modifications, equivalents, and alternatives falling within the spirit and principles of the invention.

The foregoing embodiments and methods described in this invention may vary based on the capabilities, experience, and preferences of those skilled in the art.

The listing of the steps of a method in a certain order in the present invention does not constitute any limitation on the order of the steps of the method.

Claims

1. Use of a compound or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for the prevention and/or treatment of an autoimmune disease, said autoimmune disease being uveitis, said compound having the structure:

。

2. the use of claim 1, wherein the uveitis is anterior uveitis, posterior uveitis, intermediate uveitis, or total uveitis.

3. Use of a compound or a pharmaceutically acceptable salt thereof in the manufacture of an anti-inflammatory medicament, said compound having the structure:

。

4. the use according to claim 3, wherein the anti-inflammatory agent is directed against inflammation which is Th17 mediated inflammation;

The inflammation is in vivo inflammation and/or body surface inflammation.

5. The use of claim 4, wherein the inflammation is in vivo.

6. The use according to claim 3, wherein the inflammation for which the anti-inflammatory drug is directed is ocular inflammation.

7. The use of claim 6, wherein the ocular inflammation comprises uveitis.

8. Use of a compound or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for the prevention and/or treatment of an inflammatory disease of the eye, said compound having the structure:

。

9. the use of claim 8, wherein the ocular inflammatory disease is an infectious ocular inflammatory disease or a non-infectious ocular inflammatory disease.

10. The use according to claim 8, wherein the ocular inflammatory disease is a Th 17-mediated autoimmune ocular inflammatory disease.

11. The use of claim 8, wherein the ocular inflammatory disease is uveitis.

12. The use of claim 11, wherein the uveitis is autoimmune uveitis.

13. The use of claim 11, wherein the uveitis is anterior uveitis, posterior uveitis, intermediate uveitis, or total uveitis.