CN114073700A

CN114073700A - Use of IOX1 in the prevention and/or treatment of autoimmune diseases

Info

Publication number: CN114073700A
Application number: CN202010834442.1A
Authority: CN
Inventors: 魏来
Original assignee: Zhongshan Ophthalmic Center
Current assignee: Zhongshan Ophthalmic Center
Priority date: 2020-08-19
Filing date: 2020-08-19
Publication date: 2022-02-22
Anticipated expiration: 2040-08-19
Also published as: CN114073700B

Abstract

The invention discloses an application of IOX1 in prevention and/or treatment of autoimmune diseases, in particular an application of IOX1 in control of Th 17-mediated in vivo inflammation. The inventors screened a pool of epigenetic compounds for inhibitors of IFN-. gamma.and IL-17 expression in Th1 and Th17 cultures, which identified IOX1 as CD4⁺Effective inhibitors of IL-17 expression in T cells, IOX1 was also found to inhibit IL17a expression by directly targeting the activity of TET2 on the promoter in Th17 cells. The inventors further demonstrated by the uveitis model that IOX1 can effectively control Th 17-mediated inflammation in vivo by modulating the migration and function of Th17 cells to exert anti-inflammatory effects in vivo.

Description

Use of IOX1 in the prevention and/or treatment of autoimmune diseases

Technical Field

The invention relates to the technical field of biomedicine, in particular to application of IOX1 in prevention and/or treatment of autoimmune diseases, particularly application of IOX1 in control of Th 17-mediated in-vivo inflammation and application of IOX1 in prevention and/or treatment of ocular inflammatory diseases (such as uveitis).

Background

CD4⁺T helper (Th) cells play a crucial role in the defense of the host against pathogen invasion. However, their aberrant activation has contributed to the pathogenesis of many autoimmune diseases (e.g., rheumatoid arthritis, systemic lupus erythematosus, uveitis, multiple sclerosis, psoriasis, Crohn's disease, and type I diabetes)The basis of theory. Initial CD4⁺T cells can differentiate into functional subsets including Th1, Th2, Th17, Treg, Tfh, etc. This process is synergistically regulated by activation of major transcriptional regulators triggered by extracellular stimuli and chromatin accessibility co-determined by epigenome. Although a number of key steps for specifying transcriptional and epigenetic control of Th have been well defined in the last two decades, there remains a need to develop a trimmable CD4⁺A method of treatment of a T cell mediated inflammatory response, in order to treat an autoimmune disease.

Inflammatory Th17 cells play a critical immunopathogenic role in several autoimmune diseases. Therefore, molecules that target Th17 cells and mediate both the differentiation and inflammatory functions of these cells are a viable therapy for the treatment of autoimmune diseases. Biologics (monoclonal antibodies) targeting IL-17 and IL-23, as well as ROR γ t inhibitors, have shown strong efficacy in treating certain diseases (such as psoriasis and rheumatoid arthritis), but are ineffective against other diseases such as uveitis and crohn's disease.

Autoimmune Uveitis (AU) is a common intractable ophthalmopathy caused by various reasons such as autoimmune imbalance and the like, and the disease is developed in young and middle-aged, the number of patients in China is over 500 ten thousand, the blindness rate is as high as 35 percent, and the autoimmune uveitis becomes an increasingly prominent major blindness-causing ophthalmopathy in China. Patients show repeated attacks of local ocular inflammation accompanied by systemic tissue-organ inflammatory reactions that severely affect normal life, and therefore medical intervention becomes of considerable importance. At this stage (or prior to this stage), the conventional clinical treatment is hormone-complexed immunosuppressants, and autoimmune uveitis is treated by systemic immune function suppression. Current conventional autoimmune uveitis treatment drugs are prone to adverse side effects in patients.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention provides the application of a compound with a general formula I and pharmaceutically acceptable salts, esters, prodrugs and solvates thereof in preparing medicaments for preventing and/or treating autoimmune diseases,

wherein R is₁-R₅Independently selected from: hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkylalkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted aryl, substituted or unsubstituted aralkyl, substituted or unsubstituted heterocyclyl, substituted or unsubstituted heterocyclylalkyl, -COR₆、-C(O)OR₆、-C(O)NR₆R₇、-CH＝NR₆、-CN、-OR₆、-OC(O)R₆、-S(O)_t-R₆、-NR₆R₇、-NR₆C(O)R₇、-NO₂、-N＝C₁₆R₇And halogen;

t is 0,1 or 2;

R₆and R₇Independently selected from: hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted aryl, substituted or unsubstituted heterocyclyl and halogen.

Specifically, R_1-5Independently selected from: hydrogen, substituted OR unsubstituted alkyl, halogen, -OR₆。

In one embodiment of the invention, R₁Is hydrogen.

In one embodiment of the invention, R₂Is hydrogen.

In one embodiment of the invention, R₃Is hydrogen.

In one embodiment of the invention, R₄Is hydrogen.

In one embodiment of the invention, R₅Is hydrogen.

In one embodiment of the invention, the compound is IOX1, having the structure:

in one embodiment of the present invention, the autoimmune disease is Th 17-mediated autoimmune disease.

In one embodiment of the present invention, the autoimmune disease comprises inflammation, such as inflammation in vivo and/or inflammation of the body surface, in particular inflammation in vivo.

In one embodiment of the present invention, the autoimmune disease is an ocular inflammatory disease.

In one embodiment of the present invention, the above-mentioned ocular inflammatory disease is uveitis and its complications.

Specifically, the uveitis may be anterior uveitis, posterior uveitis, intermediate uveitis, or panuveitis.

Specifically, the complications of uveitis include: zonal corneal degeneration, cataracts, macular and optic disc edema, macular surface fold-like changes, corneal edema, glaucoma, retinal detachment, and the like.

The invention also provides application of the compound of the general formula I and pharmaceutically acceptable salts, esters, prodrugs and solvates thereof in preparing anti-inflammatory drugs.

In particular, in the above applications, the compounds of the general formula I have the corresponding definitions of the invention as described above.

In particular, the inflammation may be a non-infectious inflammation or an infectious inflammation, in particular a non-infectious inflammation, such as an inflammation caused by an autoimmune disease.

In particular, the inflammation may be in vivo and/or in vitro, in particular in vivo.

Specifically, the inflammation is Th 17-mediated inflammation.

In one embodiment of the present invention, the inflammation is an ocular inflammation.

In one embodiment of the present invention, the ocular inflammation comprises uveitis.

The invention also provides application of the compound of the general formula I and pharmaceutically acceptable salts, esters, prodrugs and solvates thereof in preparing medicines for preventing and/or treating ocular inflammatory diseases.

In particular, the above-mentioned ocular inflammatory disease may be an infectious ocular inflammatory disease or a non-infectious ocular inflammatory disease, in particular a non-infectious ocular inflammatory disease, such as an autoimmune ocular inflammatory disease, in particular a Th 17-mediated autoimmune ocular inflammatory disease.

Specifically, the uveitis is autoimmune uveitis.

In the above applications of the present invention, the compounds of the above general formula I and pharmaceutically acceptable salts, esters, prodrugs, solvates thereof may be administered systemically, e.g., intravenously, intramuscularly, subcutaneously, intraperitoneally, etc., or locally, e.g., intraocularly, etc.

In the above applications of the present invention, the compounds of the above general formula i and pharmaceutically acceptable salts, esters, prodrugs, solvates thereof may be formulated into pharmaceutical preparations in the form of: tablets (including sugar-coated tablets, film-coated tablets, sublingual tablets, orally disintegrating tablets, buccal tablets, and the like), pills, powders, granules, capsules (including soft capsules, microcapsules), troches, syrups, liquids, emulsions, suspensions, controlled release formulations (e.g., immediate release formulations, sustained release microcapsules), aerosols, films (e.g., orally disintegrating films, oral mucosa-adherent films), injections (e.g., subcutaneous injection, intravenous injection, intramuscular injection, intraperitoneal injection), intravenous drip, transdermal absorption preparations, ointments, lotions, adherent preparations, suppositories (e.g., rectal suppositories, vaginal suppositories), pellets, nasal preparations, pulmonary preparations (inhalants), eye drops, and the like, particularly injections. The above various dosage forms can be prepared according to conventional production methods in the pharmaceutical field. For example, the active ingredient may be mixed with one or more excipients and then formulated into the desired dosage form.

In preparing injections, any of the carriers commonly used in the art may be used, for example: water, ethanol, propylene glycol, ethoxylated isostearyl alcohol, polyethoxylated isostearyl alcohol, and fatty acid esters of polyethylene sorbitan, and the like. In addition, conventional solubilizing agents and buffers may be added.

In particular, the pharmaceutical formulation may be in unit dosage form. In this form, the preparation is subdivided into unit doses containing appropriate quantities of the active component. The unit dosage form can be injection, eye drop or any dosage form; alternatively, the unit dosage form may be a packaged preparation such as an injection, eye drops, and powder packaged in a vial or ampoule, or the like.

In one embodiment of the present invention, in the above-mentioned medicament, the compound of formula i and pharmaceutically acceptable salts, esters, prodrugs, solvates thereof are the only active ingredient.

In another embodiment of the present invention, the above-mentioned medicament further comprises a second active ingredient for preventing and/or treating the same diseases as the present invention or other diseases.

The present invention also provides a method for preventing and/or treating autoimmune diseases, which comprises the step of administering to a subject in need thereof an effective amount of a compound of formula i, and pharmaceutically acceptable salts, esters, prodrugs, solvates thereof, or the above-mentioned medicaments of the present invention.

In particular, in the above method, the compounds of formula i, autoimmune diseases have the above definitions of the present invention.

In one embodiment of the present invention, the subject is a mammal, particularly a human.

The present invention also provides a method for preventing and/or treating ocular inflammatory diseases, which comprises the step of administering to a subject in need thereof an effective amount of a compound of formula i and pharmaceutically acceptable salts, esters, prodrugs, solvates thereof or the above-mentioned medicaments of the present invention.

Specifically, in the above method, the compounds of formula I, ocular inflammatory diseases have the above definitions of the present invention.

The inventors screened a pool of epigenetic compounds for inhibitors of IFN-. gamma.and IL-17 expression in Th1 and Th17 cultures by using an in vitro culture system to determine that IOX1 is CD4⁺Effective inhibitors of IL-17 expression in T cells, in addition, IOX1 was found to inhibit IL17a expression by directly targeting the activity of TET2 on the promoter in Th17 cells. The inventors, using two uveitis models for further analysis, demonstrated that IOX1 exerts an anti-inflammatory effect in vivo by modulating the migration and function of Th17 cells, and IOX1 can be an effective therapeutic agent for Th 17-mediated in vivo inflammation, such as ocular inflammatory diseases (e.g., uveitis).

Drawings

Figure 1 shows the screening of a "library of epigenetic compounds" of anti-inflammatory molecules targeting helper T cells. (A) Schematic of the in vitro compound screening and in vivo validation process for determining IOX1 as a Th17 cell inhibitor. (B) Left panel: hierarchical clustering of fold-changes in cytokine (IFN- γ and IL-17) and Foxp3 positive cell frequency in Th1, Th17 and iTreg cells after low-dose or high-dose drug treatment; right panel: hierarchical clustering of viability changes of Th1, Th17 and iTreg cells after low-dose or high-dose drug treatment. Sample number: replicate samples for each drug dose used in the screening.

Figure 2 shows the confirmation of the anti-inflammatory effect of five compounds as determined by the screening process. (A) OVA-stimulated OTII Th1 cultures were treated with five drug candidates and then IFN- γ⁺The frequency of the cells. (B) OVA-stimulated IL-17 in OTII Th17 cultures after treatment with five drug candidates⁺The frequency of the cells. IFN-gamma in human CD4+ T cell culture after treatment with low, medium, and high doses of five drug candidates⁺(C) And IL-17⁺(D) The frequency of the cells.

FIG. 3 shows IOX1 vs murine and human CD4⁺In vitro effects of T cells. (A) Structural illustration of IOX 1. (B) After treatment with various doses of IOX1, after being derived from most of the peripheral CD4⁺Representative FACS staining of IFN- γ and IL-17 in murine Th1 and Th17 cultures of T cells (stimulated by anti-CD 3/CD28 antibody) over 72 hours. IFN-gamma in murine Th1(C) and Th17(D) (stimulated by anti-CD 3/CD28 antibodies) cultures⁺And IL-17⁺Cell frequency summary (N ═ 6 in each case). (E) Peripheral human CD4 stimulated by anti-CD 3/CD28 coated microbeads after treatment with various doses of IOX1⁺Representative FACS staining of IFN-. gamma.IL-17 and CFSE in T cells on day 5. (F) Human CD4 stimulated by anti-CD 3/CD28 coated microbeads after IOX1 treatment⁺IFN-gamma in T cells⁺And IL-17⁺Cell frequency summary (N ═ 6 in each case). Significance levels of the Mann-Whitney U test are indicated by asterisks (. about.P)<0.05，**P<0.01)。

FIG. 4 shows that IOX1 inhibited polarization of murine Th1 and Th17 in a dose-dependent manner in 48, 72 and 96 hour cultures (A) without affecting cell viability and proliferation in Th1(B-C) and Th17(D-E) cultures.

FIG. 5 shows that IOX1 inhibits polarization of Th1 and Th 17. (A) Representative FACS staining of IFN-. gamma.and IL-17 in 72 hours in initially derived murine Th1 and Th17 cultures (stimulated by anti-CD 3/CD28 antibodies) after treatment with various doses of IOX 1. (B) IFN-gamma in murine Th1 and Th17 (stimulated by anti-CD 3/CD28 antibody) cultures⁺And IL-17⁺Summary of cell frequencies (N ═ 5 in each case). Cell viability (C) and proliferation (D) (E) at 72 hours in initially derived Th1 and Th17 cultures after treatment with various doses of IOX1 IFN-. gamma.and IL-17 in OTII Th1 and Th17 cultures (stimulated by OVA) at 72 hours after treatment with various doses of IOX1Representative FACS staining in (1). Significance levels of the Mann-Whitney U test are indicated by asterisks (. about.P)<0.01)。

FIG. 6 shows the gene program for IOX1 regulation in Th17 cells. (A) DEG was shown to change at least two-fold in the volcano plot after treatment with IOX1, P < 0.05. (B) The route of enrichment in DEG induced by IOX1 was analyzed using IPA. (C) Potential upstream regulators of IOX 1-induced DEG were analyzed using IPA. Th17 cells were collected at 72 hours. CETSA was performed to analyze potential associations between IOX1 and JMJD3, KDM3A, KEM4E (D) and between IOX1 and TET2, TET3 (E). The red rectangle highlights the changes identified in CETSA of TET 2.

FIG. 7 shows that IOX1 directly regulates expression of Il17a by direct association with TET2 on the Il17a promoter. (A) DNA methylation status was determined using bisulfite sequencing to analyze CpG sites on the proximal promoter of Il17a in murine Th17 cells. CpG sites are numbered 1 to 12. A total of 36 clones from four independent experiments were sequenced. The methylation status of CpG sites #7 and #8 was found to be statistically different between DMSO and IOX1 treated Th17 cells (Fisher's exact test,. about.P)<0.05). (B) Summary of demethylated CpG site frequencies on Il17a promoter. (C) TET2 binds to the CpG-5 and CpG-6-8 sites of the II17a promoter after treatment with IOX1 as determined by ChIP. (D) IOX1 bound to the CpG-5 and CpG-6-8 sites of the Il17a promoter after treatment with IOX1 as determined by Chem-IP. (E) WT (CD 4) under the action of IOX1 (20. mu.M)^Cre) And TET2 deficient (CD 4)^CreTet2^f/f) Representative FACS analysis of IL-17 expression in Th17 cells. (F) In WT (CD 4)^Cre) And TET2 deficient (CD 4)^CreTet2^f/f) Summary of IOX 1-induced IL-17 inhibition in Th17 cells (N ═ 3). (G) In WT (CD 4)^Cre) And TET2 deficient (CD 4)^CreTet2^f/f) IL-17 induced by IOX1 in Th17 cells⁺Fold inhibition of cellular frequency (N ═ 3). Significance levels of the Mann-Whitney U test are indicated by asterisks (. about.P)<0.05，**P<0.01)。

FIG. 8 shows: (A) a schematic of biotinylated IOX1 was generated for Chem-IP analysis. (B) In WT (CD 4)^Cre) (N ═ 4) and TET2 deficient (CD 4)^CreTet2^f/f) Inhibition of IOX 1-induced CCL20 expression in (N-3) Th17 cells (in culture supernatants, measured by ELISA) was summarized. (C) In WT (CD 4)^Cre) (N ═ 4) and TET2 deficient (CD 4)^CreTet2^f/f) IOX 1-induced inhibition of CCL20 expression in (N-3) Th17 cells. Significance levels of the Mann-Whitney U test are indicated by asterisks (. about.P)<0.05)。

FIG. 9 shows the effect of IOX1 on murine EAU. (A) Mice receiving DMSO or IOX1(12.5mg/kg twice daily) body weight (N ═ 10 for each DMSO and IOX1 treated mouse) 13 days post immunization. (B) Representative fundus photographs and OCT showing the severity of ocular inflammation on

days

7, 9, 11 and 13 post-immunization. (C) Summary of EAU clinical scores (N10 for each DMSO and IOX1 treated mouse). (D) Representative FACS staining of retinal cells. (E) Retina CD45⁺CD4⁺The number of cells. (F) Retinal CD45 in all living cells of each retinal tissue⁺CD4⁺The frequency of the cells. (G) Retinal CD45 in all living cells of each retinal tissue⁺CD4⁺IL-17⁺The frequency of the cells. (H) Retinal CD45 in all living cells of each retinal tissue⁺CD4⁺IFN-γ⁺The frequency of the cells. (I) Retinal CD45 in all living cells per retinal tissue⁺CD4⁺IL-17⁺IFN-γ⁺The frequency of the cells. (for each mouse treated with DMSO and IOX1, N ═ 10). Significance levels of the Mann-Whitney U test are indicated by asterisks (. about.P)<0.05，**P<0.01)。

FIG. 10 shows the CD4 pattern of IOX1 versus typical murine EAU model lymph nodes at day 14 post immunization⁺Effects of T cells. (A) Representative FACS staining of ocular draining lymph nodes. CD45 in all living cells of the draining lymph nodes of the eye⁺CD4⁺(B)、CD45⁺CD4⁺IL-17⁺(C)、CD45⁺CD4⁺IFN-γ⁺(D) And CD45⁺CD4⁺IL-17⁺IFN-γ⁺(E) The frequency of the cells. (F) Representative FACS staining of inguinal lymph nodes. CD45 in all viable cells of inguinal lymph node⁺CD4⁺(G)、CD45⁺CD4⁺IL-17⁺(H)、CD45⁺CD4⁺IFN-γ⁺(I) And CD45⁺CD4⁺IL-17⁺IFN-γ⁺(J) The frequency of the cells. (K) Representative FACS staining of spleen. CD45 in all live cells per spleen⁺CD4⁺(L)、CD45⁺CD4⁺IL-17⁺(M)、CD45⁺CD4⁺IFN-γ⁺(N) and CD45⁺CD4⁺IL-17⁺IFN-γ⁺(O) frequency of cells. (N-7 for each DMSO and IOX1 treated mouse). Significance levels of the Mann-Whitney U test are indicated by asterisks (. about.P)<0.05)。

FIG. 11 shows IOX1 versus adoptively transferred CD4⁺Effects of T cell-induced intraocular inflammation. (A) Adoptive transfer of CD4 treated with IOX1 or DMSO⁺Schematic representation of T cell generation of EAU mice. (B) Representative fundus photographs and OCT showing the severity of ocular inflammation on

days

5, 7, 9, and 11 post-cell transfer. (C) Summary of EAU clinical scores (N10 for each DMSO and IOX1 treated mouse). (D) Representative FACS staining of retinal cells. (E) Retina CD45⁺CD4⁺The number of cells. (F) Retinal CD45 in all living cells of each retinal tissue⁺CD4⁺The frequency of the cells. (G) Retinal CD45 in all living cells of each retinal tissue⁺CD4⁺IL-17⁺The frequency of the cells. (H) Retinal CD45 in all living cells of each retinal tissue⁺CD4⁺IFN-γ⁺The frequency of the cells. (I) Retinal CD45 in all living cells per retinal tissue⁺CD4⁺IL-17⁺IFN-γ⁺The frequency of the cells. (for each mouse treated with DMSO and IOX1, N ═ 10). Significance levels of the Mann-Whitney U test are indicated by asterisks (. about.P)<0.05，**P<0.01，***P<0.001，****P<0.0001)。

FIG. 12 shows IOX1 vs. CD4 in adoptively transferred murine EAU model lymph nodes at day 10 post-cytofection⁺Effects of T cells. (A) Representative FACS staining of ocular draining lymph nodes. CD45 in all living cells of the draining lymph nodes of the eye⁺CD4⁺(B)、CD45⁺CD4⁺IL-17⁺(C)、CD45⁺CD4⁺IFN-γ⁺(D) And CD45⁺CD4⁺IL-17⁺IFN-γ⁺(E) The frequency of the cells. (F) Representative FACS staining of inguinal lymph nodes. CD45 in all viable cells of inguinal lymph node⁺CD4⁺(G)、CD45⁺CD4⁺IL-17⁺(H)、CD45⁺CD4⁺IFN-γ⁺(I) And CD45⁺CD4⁺IL-17⁺IFN-γ⁺(J) The frequency of the cells. (K) Representative FACS staining of spleen. CD45 in all live cells per spleen⁺CD4⁺(L)、CD45⁺CD4⁺IL-17⁺(M)、CD45⁺CD4⁺IFN-γ⁺(N) and CD45⁺CD4⁺IL-17⁺IFN-γ⁺(O) frequency of cells. (N-7 for each DMSO and IOX1 treated mouse). Significance levels of the Mann-Whitney U test are indicated by asterisks (. about.P)<0.05)。

Detailed Description

Unless defined otherwise, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

In the context of the present invention, the following terms have the meanings as detailed below.

The term "alkyl" refers to a hydrocarbon chain radical that is straight or branched and free of unsaturation, and that is attached by a single bond to the rest of the molecule. Typical alkyl groups contain 1 to 12 (e.g., 1,2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12), 1 to 8, 1 to 6, or 1 to 3 carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, n-pentyl, and the like. If an alkyl group is substituted with a cycloalkyl group, it is correspondingly "cycloalkylalkyl", such as cyclopropylmethyl. If an alkyl group is substituted with an aryl group, it is correspondingly "aralkyl", such as benzyl, benzhydryl or phenethyl. If an alkyl group is substituted with a heterocyclyl group, it is correspondingly "heterocyclylalkyl".

The term "alkenyl" refers to a straight or branched hydrocarbon chain radical containing at least two carbon atoms, at least one unsaturated bond, and which is attached to the rest of the molecule by a single bond. Typical alkenyl groups contain 2 to 12 (e.g., 2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12), 2 to 8, 2 to 6, or 2 to 4 carbon atoms. In a particular embodiment, the alkenyl group is vinyl, 1-methyl-vinyl, 1-propenyl, 2-propenyl, or butenyl.

The term "cycloalkyl" refers to an alicyclic hydrocarbon. Typical cycloalkyl groups contain 1 to 4 mono-and/or fused rings, 3 to 18 carbon atoms, preferably 3 to 10 (e.g. 3, 4, 5, 6, 7, 8, 9, 10) carbon atoms, such as cyclopropyl, cyclohexyl or adamantyl. In particular embodiments, the cycloalkyl group contains 3 to about 6 carbon atoms.

The term "aryl" refers to a monocyclic or polycyclic radical, including polycyclic radicals containing monoaryl groups and/or fused aryl groups. Typical aryl groups contain 1 to 3 monocyclic or fused rings and 6 to about 18 carbon ring atoms, preferably 6 to about 14 (e.g., 6, 8, 10, 12, 14) carbon ring atoms, such as phenyl, naphthyl, biphenyl, indenyl, phenanthryl, or anthracyl.

The term "heterocyclyl" includes heteroaromatic and heteroalicyclic groups containing 1 to 3 single and/or fused rings and 3 to 18 ring atoms. Preferred heteroaromatic and heteroalicyclic groups contain 5 to 10 (e.g. 5, 6, 7, 8, 9, 10) ring atoms. Suitable heteroaryl groups in the compounds of the invention contain 1,2 or 3 heteroatoms selected from N, O or S atoms. Heteroaryl groups include, for example, coumarin, including 8-coumarin, quinolyl, including 8-quinolyl, isoquinolyl, pyridyl, pyrazinyl, pyrazolyl, pyrimidinyl, furyl, pyrrolyl, thienyl, thiazolyl, isothiazolyl, triazolyl, tetrazolyl, isoxazolyl, oxazolyl, imidazolyl, indolyl, isoindolyl, indazolyl, indolizinyl, phthalazinyl, pteridinyl, purinyl, oxadiazolyl, thiadiazolyl, furazanyl, pyridazinyl, triazinyl, cinnolinyl, benzimidazolyl, benzofuranyl, benzofurazanyl, benzothiophenyl, benzothiazolyl, benzoxazolyl, quinazolinyl, quinoxalinyl, naphthyridinyl, and furopyridyl. Suitable heteroalicyclic groups in the compounds of the invention contain 1,2 or 3 heteroatoms selected from N, O or S atoms and include, for example, pyrrolidinyl, tetrahydrofuryl, dihydrofuran, tetrahydrothienyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, oxathienylhexyl, piperazinyl, azetidinyl, oxetanyl, thietanyl, homopiperidinyl, oxetanyl, thietanyl, azepinyl, oxazepinyl, diazepinyl, triazepinyl, 1,2,3, 6-tetrahydropyridinyl, 2-pyrrolinyl, 3-pyrrolinyl, indolinyl, 2H-pyranyl, 4H-pyranyl, dioxanyl, 1, 3-dioxolanyl, pyrazolinyl, dithianyl, azetidinyl, piperidinyl, azetidinyl, thienyl, etc, Dithiolyl, dihydropyranyl, dihydrothienyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, 3-azabicyclo [3.1.0] hexyl, 3-azabicyclo [4.1.0] heptyl, 3H-indolyl and quinolizinyl.

The term "halogen" or "halo" refers to bromo, chloro, iodo or fluoro.

The term "salt" is to be understood as any form of the compound of general formula i according to the invention, wherein the compound is in ionic form or is charged and coupled with an oppositely charged ion (cation or anion) or is in solution. Also included within this definition are quaternary ammonium salts and complexes of the molecule with other molecules and ions, particularly complexes formed by ionic interactions.

The term "ester" is understood to mean a compound formed by the reaction of an acid with the hydroxyl group of a compound of the general formula I according to the invention.

The term "solvate" is understood to mean any form of the compound of the invention in which the compound is attached to another molecule by non-covalent bonds (usually a polar solvent), including in particular hydrates and alcoholates, such as methanolate.

The term "prodrug" is used in its broadest sense and encompasses derivatives that are convertible in vivo to the compounds of the invention. Examples of prodrugs include, but are not limited to, derivatives and metabolites of the compounds of formula (I), including biohydrolyzable moieties such as biohydrolyzable amides, biohydrolyzable esters, biohydrolyzable carbamates, biohydrolyzable carbonates, biohydrolyzable ureides, and biohydrolyzable phosphate analogs. Preferably, the prodrug having a carboxyl functional group is a lower alkyl ester of a carboxylic acid. The carboxylic acid esters are readily esterified from any carboxylic acid moiety present in the molecule. Prodrugs can generally be prepared by known methods, such as those described in Burger "Medicinal Chemistry and Drug Discovery sixth edition (Donald J. Abraham ed., 2001, Wiley) and" Design and Applications of drugs "(H.Bundgaard ed., 1985, Harwood Academic Publishers).

The term "autoimmune disease" refers to a disease caused by the body's immune response to self-antigens resulting in damage to its tissues. Autoimmune diseases are the result of inappropriate and excessive responses to self-antigens. Examples of autoimmune diseases include, but are not limited to, Addison's disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune mumps, Crohn's disease, diabetes (type 1), dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves ' disease, Guillain-Barre syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjogren's syndrome, spondyloarthropathies, thyroiditis, vasculitis, vitiligo, myxoedema, pernicious anemia, ulcerative colitis, and the like.

The term "inflammation", which is often referred to as "inflammation", is a defense response of the body to stimuli, manifested by redness, swelling, heat, pain, and dysfunction; it may be infectious inflammation caused by infection, or non-infectious inflammation not caused by infection, such as inflammation caused by immune reaction (such as various types of hypersensitivity, inflammation caused by some autoimmune diseases). Inflammatory lesions may occur on the body surface and/or in the body.

The term "Ocular Inflammatory Disease (OID)" is a generic term that includes a variety of diseases and conditions in which inflammation affects the eye or surrounding tissues. Generally, the diagnostic name of OID is given based on the location of ocular inflammation, for example, uveitis is an inflammation of uvea, scleritis an inflammation of sclera, pars plana inflammation (pars planitis) is an inflammation of pars plana (pars plana), and the like. The causes of OID can be divided into infectious and non-infectious, wherein infectious OID is caused by infection of pathogens such as bacteria, viruses, fungi, rickettsia, parasites and the like; noninfectious diseases can be classified into exogenous diseases and endogenous diseases, wherein the exogenous OID mainly comprises the diseases caused by physical injuries such as trauma and operation, chemical injuries such as acid, alkali and medicaments, blood-eye barrier damage and increase of vascular permeability; endogenous OIDs are mainly due to autoimmune reactions. OID is often a manifestation of systemic autoimmune disease.

The term "uveitis," also known as uveitis, is a generic term for inflammation of iris, ciliary body, and choroidal tissues. According to the disease part, the disease can be divided into anterior uveitis, posterior uveitis, intermediate uveitis and panuveitis; wherein the anterior uveitis comprises iritis, anterior ciliary body inflammation, and iridocyclitis; choroid and retinal tissues behind the vitreous membrane are involved in posterior uveitis inflammation; inflammation of intermediate uveitis affects the pars plana, peripheral retina, basal vitreous; panuveitis refers to mixed form of anterior, intermediate and posterior uveitis. "acute" uveitis is a form of uveitis in which signs and symptoms occur suddenly and persist for up to about six weeks. "chronic" uveitis is a form of uveitis that is asymptotic and persists for a prolonged period of time exceeding about six weeks.

The clinical manifestations of uveitis mainly include: redness, pain, photophobia, tearing, blurred vision, hypopsia, a floating black image before the eye, deformation of the vision, and even complete loss of vision. Uveitis can cause a number of complications, common ones being zonal corneal degeneration, cataracts, macular and optic disc edema, macular surface fold-like changes, corneal edema, glaucoma, retinal detachment, and the like.

The term "pharmaceutically acceptable" means that the indicated material is not of a nature that would cause reasonable caution to a physician avoiding administration of the material to a patient, taking into account the disease to be treated and the corresponding route of administration. For example, it is often desirable that such materials be substantially sterile.

The term "treating" refers to preventing, curing, reversing, attenuating, alleviating, minimizing, inhibiting, arresting and/or stopping one or more clinical symptoms of a disease after its onset.

The term "prevention" refers to treatment to avoid, minimize or make difficult the onset or progression of a disease prior to its onset.

The terms "patient" or "subject" and the like are used interchangeably herein and refer to any animal or cell thereof, whether in vitro or in situ, treated according to the methods described herein. Specifically, the aforementioned animals include mammals, for example, rats, mice, guinea pigs, rabbits, dogs, monkeys or humans, particularly humans.

The term "effective amount" refers to an amount that provides a therapeutic or prophylactic benefit, including the amounts of the following compounds: when administered, it is sufficient to prevent the development of, or alleviate to some extent, one or more of the signs or symptoms of the disease being treated. The "effective amount" will vary depending on the compound, the disease and its severity, and the age, weight, etc. of the subject to be treated.

The disclosures of the various publications, patents, and published patent specifications cited herein are hereby incorporated by reference in their entirety.

The technical solutions of the present invention will be described clearly and completely with reference to the following embodiments of the present invention, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The materials and methods used in the examples of the invention were as follows:

material

An epigenetic compound library (classification number L1900) containing 128 compounds was purchased from Selleck, usa. All compounds were initially placed in DMSO solution (stock concentration 10mM) and further diluted as working solution according to the instructions in each experiment. Murine anti-CD 3, anti-CD 28, anti-IL-4, and anti-IFN- γ antibodies for cell culture were purchased from eBioscience, USA. Murine anti-IL-17, anti-IFN- γ, anti-CD 3, anti-CD 4, anti-CD 44, and anti-CD 62L antibodies for FACS analysis or sorting were purchased from Biolegend, USA. Human anti-IL-17, anti-IFN- γ antibodies for FACS were purchased from Biolegend, USA. Recombinant murine mIL-2 was purchased from PeproTech, USA. Recombinant murine mIL-6, mIL-12 and recombinant human hTGF- β 1 were purchased from U.S. R & D Systems. anti-TET 2 (class No. 45010), anti-TET 3(ab139311), anti-JMJD 3 (class No. 3457), anti-KDM 3A (class No. 12835-1-AP) and anti-KDM 4E (class No. TA337374) antibodies were purchased from Central Merck, Abcam, United kingdom, Proteintech, OriGene, USA.

Mouse

Female C57BL6/J, B10.RIII or OT-II (8-10 weeks) mice were purchased from Charles River, UK or Guangdong province center for medical laboratory animals (China). CD4^CreTet2^f/fThe mice are gifts from the national professor of shanghai transportation university. All animals were housed in SPF facilities at university of bristol, center of ophthalmology or center of cancer at university of zhongshan. All animal experiments have been approved by the institutional animal care and use committee of the university of bristol, the center of ophthalmology, or the center of cancer, the university of zhongshan. All animal-related work was performed according to ARVO statement on animal use in ophthalmic and vision studies.

Murine CD4⁺T cell culture

Murine lymph nodes and spleens were dissected and processed into single cell suspensions. Total CD4 was isolated using CD4(L3T4) microbeads (Miltenyi Biotec, Germany) according to the manufacturer's instructions⁺T cells. Alternatively, CD62L was sorted using a BD Asia sorter⁺CD44^-Initial CD4⁺The T cells were FACS sorted. Obtained CD4⁺The purity of the T cells was greater than 95%. Separating CD4⁺T cells were seeded on anti-C precoated with 5. mu.g/mlD3 and 2. mu.g/ml anti-CD 28 in 96-well plates (10 ten thousand cells/well). The T helper cells were polarized under the following conditions: th1(20ng/ml mIL-12 and 100ng/ml anti-IL-4), Th17(20ng/ml mIL-6, 1ng/ml hTGF-beta 1, 100ng/ml anti-IL-4 and 100ng/ml anti-IFN-. gamma.) and iTreg (50ng/ml mIL-2 and 10ng/ml hTGF-beta 1) all cells contained 5% CO at 37 ℃₂The humidified incubator of (4) was cultured in RPMI-1640 containing 10% FCS, Pen/Strep and 2-mercaptoethanol. In the screening experiments, 128 epigenetic compounds were added to the culture at the beginning of cell polarization, where the concentrations were determined from published data or preliminary experiments. In OTII experiments, splenocytes from 57BL6/J mice were collected and irradiated into APCs; isolation of CD4 from 57BL6 OT-II Tg mice⁺T cells and inoculated with APC (1CD 4: 10APC) under polarized culture conditions (Th 1: 4ng/ml mIL-12 and 4. mu.g/ml anti-IL-4 mAb; Th 17: 4. mu.g/ml anti-IL-4 mAb, 1.2ng/ml hTGF-beta, 4ng/ml mIL-6, 2ng/ml mIL-1. alpha., 4. mu.g/ml anti-IL-12 mAb and 8. mu.g/ml anti-IFN-. gamma.mAb) and OVA peptide (2. mu.g/ml).

Human peripheral blood CD4⁺Isolation and processing of T cells

Negative selection was performed in peripheral blood of Healthy Controls (HC) (N6; 5 women and 1 male; average age 32.83 years) at the British university Hospital, trusted Foundation (04/Q2002/84) to obtain CD4 after obtaining informed consent according to the protocol approved by the national institutes of health services research ethics Committee⁺T cells. Written informed consent was obtained from all study participants. Up to 80ml of uncoagulated peripheral blood was combined with RosetteSeep human CD4 according to the manufacturer's instructions⁺Incubation of the T cell enrichment mixture (STEMCELL Technologies, Canada) with Ficoll-Paque PLUS (GE Healthcare, USA) yielded CD4⁺T cells. Removal of enriched CD4 by density gradient⁺T cells and washed in RPMI-1640(Thermofisher, usa) supplemented with 10% fetal bovine serum (Gibco, usa). Human CD4⁺The purity of the T cells was greater than 95%.

Stimulation of CD4 with immunomagnetic beads human T activator CD3/CD28(Gibco, USA)⁺T cells, and seeded in 96-well microplates (10 ten thousand cells/well) with or without DMSOOr IOX1 concentration in whole RPMI1640 medium. Cells were stimulated with PMA and ionomycin for 4 hours prior to day 5 acquisition, and analyzed for proliferation and intracellular cytokine staining.

Flow cytometry

DEAD cells were excluded using LIVE/DEAD immobilized cell Fuel kit (Thermofeisher Scientific, USA). In FACS analysis, non-specific antibody binding was blocked using Fc γ RII/III (24G 2; supernatant). Cells were incubated with primary antibodies against Cell surface markers and then subjected to intracellular cytokine staining using the protocol described previously (Zou, Y.et al. the DNA Methylation Inhibitor Zebuline Controls CD4(+) T Cell media infection. frontiers in immunology 10,1950, doi:10.3389/fimmu.2019.01950 (2019)). All samples were analyzed using a BD LSR II or BD LSR Fortessa X-20(BD Bioscience, usa) flow cytometer and FCS data were analyzed using FlowJo v10(Tree Star inc., usa).

RNA sequencing analysis

Total RNA was extracted from either IOX1 or DMSO-treated Th17 cells (N ═ 2) using a MasterPure Complete DNA and RNA purification kit (Epicentre, uk) according to the manufacturer's instructions. A total of 100ng of RNA was sonicated into fragments with 300-400 base pairs using Bioruptor PLUS (Diagenode, Belgium). mRNA libraries were prepared using the VAHTS mRNA-seq V3 library preparation kit for Illumina (Vazyme, south china) and sequencing was performed on an Illumina HiSeq2500 sequencer (Illumina) using the HiSeq SR cluster kit V4 and HiSeq SBS kit V450 cycle kit, according to the manufacturer's protocol. The initial treatment was carried out by CASAVA (v 1.8.2). Quality control of the sequencing reads was then done by FastQC (v0.11.5) and trimmed by Cutadaptt (v1.9.1). Then, reads for quality control were subjected to Differential Expression Gene (DEG) Analysis using DEseq2, and Pathway Analysis using Induction Pathway Analysis (IPA).

Enzyme-linked immunosorbent assay (ELISA)

Supernatants were collected from DMSO or IOX1(20 μ M) treated Th17 cell cultures over 72 hours and analyzed with the CCL20 ELISA kit (classification No. ab100728, Abcam, usa) according to the manufacturer's instructions.

Bisulfite sequencing

DNA was extracted from cultured Th17 cells using Epicenter MasterPure purification kit (Epicenter, usa); the conversion was then carried out using the epitec bisulfite kit (Qiagen, germany) according to the manufacturer's instructions. After transformation, the DNA was purified and eluted into 20. mu.l of elution buffer. The Il17a promoter sequence was PCR amplified, TA cloned, and more than 30 clones were sequenced. The following primer pairs were used: bisulfite-F: TAAATATTAATAGGTTTTTTGATAATATGT, respectively; bisulfite-R: AATAAAA-CTCTCCCTAAACTCATATTTA.

Chromosome immunoprecipitation (ChIP)

ChIP analysis was performed using ChIP-IT kit (Active Motif, USA). Briefly, Th17 cells treated with IOX1 or DMSO were fixed with a fixation buffer containing 1% formaldehyde for 15 minutes at room temperature. Then, the nuclear DNA-protein complex was extracted using Bioruptor PLUS (Diagenode, belgium) and sonicated. The samples were incubated with anti-TET 2 antibody overnight at 4 ℃. The antibody-DNA complex was then captured by protein G sepharose beads. The immunoprecipitated DNA was then purified and quantified by real-time PCR. The following primer pairs were used: CpG-6-8-F: TCTGCCCTTCCCATCTAC, respectively; CpG-6-8-R: TCCCTGGACT-CATGTTTTG; CpG-5-F: TGCTCTCTAGCCAGGGAA, respectively; CpG-5-R: ATGGGAAGGGC-AGAAGTT.

Cell heat transfer analysis (CETSA)

CETSA was performed as described above (Jafari, R.et al. the cellular thermal shift assay for evaluating the target interactions in cells. Nature protocols 9,2100-2122, doi:10.1038/nprot.2014.138 (2014)). Briefly, total CD4 was isolated⁺T cells were then polarized for 3 days under Th17 conditions. IOX1(20 μ M) was added to the culture 4 hours prior to harvest. After harvest, cells were washed twice in PBS at room temperature and resuspended in PBS containing protease inhibitors in 200 μ l PCR tubes. Then, the cells were heated to different temperatures and then snap frozen in liquid nitrogen. Then, will pass throughProteins extracted from the treated cells were loaded onto 7.5% 15-well Mini-gels in the Bio-Rad Mini-Protean Tetra system and analyzed using antibodies against JMJD3, KDM3A, KDM4E, TET2 and TET 3.

Chem-IP-PCR analysis

The method is based on previous studies by Anders et al (Anders, L.et al. genome-wide localization of small molecules. Nature biotechnology 32,92-96, doi:10.1038/nbt.2776 (2014)). Briefly, biotinylated IOX1 was synthesized by Dangang Peptides Inc (china). The product was verified using liquid chromatography-mass spectrometry and nuclear magnetic resonance. Total CD4 was isolated⁺T cells were then polarized for 3 days under Th17 conditions. 3 hours before cell harvest, 20 μ M IOX 1-biotin or 20 μ M biotin was added to Th17 cells. Then, at room temperature, the cells were fixed with a fixing buffer containing 1% formaldehyde for 15 minutes, and the fixation was terminated by adding a 5-minute stop buffer. Sonication was performed using Bioruptor PLUS (Diagenode, belgium), and then all samples were incubated with streptavidin microbeads (MyOne streptavidin T1, Invitrogen) overnight at 4 ℃, washed with PBS containing 0.1% BSA, and eluted at 70 ℃ with elution buffer in the ChIP kit described above. The immunoprecipitated DNA was then purified and quantified by real-time PCR.

Experimental Autoimmune Uveitis (EAU)

B10.riii mice were immunized subcutaneously along the thigh with 100 μ L of recombinant human interphotoreceptor retinoid-binding protein (IRBP) peptide (161-180) (1mg/mL) at day 0, expressed as a 1: a ratio of 1 (v: v) was emulsified in complete Freund's adjuvant containing 2.5mg of Mycobacterium tuberculosis (Mycobacterium tuberculosis) intact H37Ra (BD Biosciences). Following immunization, each mouse was injected intraperitoneally with 1 μ g of Bordetella pertussis toxin (Tocris Bioscience). IOX1(12.5mg/kg) or DMSO solution was administered intraperitoneally twice daily from day 0 to day 13. On day 14, all mice were sacrificed for analysis. To assess the clinical score of EAU, we performed local endoscopic fundus imaging (TEFI) with a Micron III murine fundus camera (Phoenix Research Labs, usa) with simultaneous spectro-Optical Coherence Tomography (OCT) scanning. Clinical scores were given by two experienced independent observers as blind scores according to the EAU scoring criteria described previously (copy, D.A. et al. the clinical time-course of experimental automization using a topical endoscopic fusion with a facial imaging with a custom and a cellular profiling, investigative optical coherence & visual science 49, 5458-course 5465, doi: 10.1167/iov.08-2348 (2008); Chu C.J. Association. and visual scoring of biological experimental automization co-pathology, P.J. 638, D.A. J. assessment and in visual scoring 10.1371 (3.3)).

CD4⁺Adoptive transfer of T cells induced uveitis

EAU was induced in donor mice in the manner described above. On day 11, spleens and lymph nodes were harvested from donor mice and made into single cell suspensions. Culture of approximately 7.5X 10 in 25ml of intact RPMI1640 medium supplemented with 20ng/ml murine IL-23 and 10. mu.g/ml hIRBP161-180 peptide⁶Individual cells/flask. After 24 hours, 10ml of fresh medium containing murine IL-2 (final concentration 10ng/ml) was added to the culture. After 72 hours, disrupted CD4 was isolated using CD4(L3T4) microbeads (Miltenyi Biotec, Germany)⁺T cells. In total 200 ten thousand CDs 4⁺T cells (in 200. mu.l PBS) were adoptively transferred intraperitoneally into each naive recipient mouse. Clinical scores of EAUs were assessed in the manner described above.

Statistics of

Statistical analysis was performed using Prism Graphpad 7.0(Graphpad Software, USA). Mann-Whitney U test, Kruskal-Wallis test or two-way ANOVA test were used accordingly.

Example 1: in vitro CD4⁺Screening of the library of epigenetic compounds of IFN-. gamma.and IL-17A inhibitors in T cells

The inventor found in previous research that the epigenetic regulation is CD4⁺Plays a critical role in T cell differentiation. Systematic assessment of which molecular components of epigenetic mechanisms can be directly manipulated to achieve inflammatory cell differentiation in helper T cellsOptimal control of factor expression, the inventors screened a commercially available "epigenetic compound library" (purchased from Selleck in 2015) and studied its potential role in proliferation and differentiation of Th1, Th17 and Treg cells. The library collected 128 epigenetic enzyme and signal molecule inhibitors including Histone Deacetylases (HDACs), JAKs, histone demethylases, Histone Acetyltransferases (HATs), DNA and methyltransferases (Dnmts) (shown in fig. 1A). The 128 compounds were first screened for their effect on Th cell differentiation and viability using murine Th1, Th17, and inducible treg (itreg) culture systems (as shown in figure 1A). Two doses (i.e., low and high) were selected for each compound based on prior use in the relevant literature or preliminary results obtained by the inventors in murine Th cell culture (as shown in table 1). Multiple cultures were performed at 4000 times and the response of all 128 compounds was characterized for Th1, Th17 and iTreg cells. The marker cytokines IFN- γ and IL-17 and the transcription factor Foxp3, detected by FACS staining, were used as differentiation markers for Th1, Th17 and iTreg, respectively. As shown in FIG. 1B, 11 compounds (i.e., the selective aurora A inhibitor, Alisertib) were found at high doses to bind IFN- γ in Th1 cultures⁺The frequency of cells was increased at least 2-fold, while 52 compounds (i.e., the JAK2 inhibitor CEP-33779) were found to convert IFN- γ in Th1 cultures⁺The frequency of the cells is reduced by at least 2-fold. On the other hand, 10 compounds (i.e. the PARP inhibitor AZD2461) were found at high doses to bind IL-17 in Th17 cultures⁺The frequency of the cells was increased at least 2-fold, while 42 compounds (i.e., the bromodomain-containing protein inhibitor, Molibresib) were found to increase IL-17 in Th17 cultures⁺The frequency of the cells is reduced by at least 2-fold. All compounds tested failed to promote Foxp3 expression in iTreg cells. Importantly, of those inhibitors of Th1(52) and Th17(42) differentiation, the inventors found that about 62% of the inhibitors resulted in significant cell death (at least a 20% reduction in cell viability). Thus, the results indicate that inhibition of expression of key inflammatory cytokines in Th1 and Th17 cells is generally accompanied by a decrease in cell viability under the action of epigenetic drugs.

Next, the inventors selectedFive compounds that inhibit IFN- γ expression in Th1 cells and IL-17 expression in Th17 cells without affecting T cell viability, including INO-1001, AZD1208, IOX1, OTX015 and Tubastatin A. Total CD4 in peripheral blood of healthy volunteers and Th1 and Th17 cultures of OTII system stimulated with antigen-specific OVA⁺T cells, to check whether these 5 candidate compounds are still able to control IFN-. gamma.and IL-17 expression in vitro. As shown in FIGS. 2A-B, none of the five compounds inhibited IFN- γ expression in Th1 cells, whereas IOX1 and OTX015 inhibited IL-17 expression in Th17 cells. Furthermore, inhibition of IFN-. gamma.and IL-17 was observed in Th1 and Th17 cells under stimulation with high doses of AZD1208, IOX1 and OTX015 (as shown in FIGS. 2C-D). These data indicate that IOX1 and OTX015 can be candidate inhibitors of Th1 and Th17 differentiation.

TABLE 1 Compounds of the epigenetic Compounds library and their high and low dosages

Example 2: IOX1 inhibits CD4⁺IL-17 expression in T cells in vitro

Due to the limited anti-inflammatory effects of OTX015 in vivo (data not shown), the inventors focused further research on IOX1, IOX1 being a potent broad-spectrum inhibitor of 2OG oxygenase, including JmjC demethylase and DNA demethylase. In addition to the screening assays, the inventors further examined the inhibitory effect of IOX1 at two different doses on IFN-. gamma.and IL-17 expression in Th1 and Th17 cells after 48, 72 and 96 hours of culture (as shown in FIGS. 3B-D and 4A-E). The results indicate that IOX1 preferentially controls Th17 differentiation without altering CD4 in vitro⁺Viability and proliferation of T cells in total T cell culture. These results were further confirmed using naive T cell-derived Th1 and Th17 cultures (as shown in fig. 5A-D). Furthermore, using OVA-stimulated OT-II cell system, the inventors found that IOX1 only inhibited antigen-specific Th17 differentiation and did not affect Th1 differentiation (as shown in fig. 5E). Interestingly, in human CD4⁺In T cell cultures, IOX1 showed significant inhibition of both cytokine expression and cell proliferation (fig. 3E-F). The research results are that: IOX1 has anti-inflammatory effects on helper T cells (preferably on Th17 cells in vitro).

Example 3: IOX1 inhibits Il17a expression by targeting TET2 protein

To explore the overall effect of IOX1 on Th17 cells, the inventors performed RNA sequence analysis to dissect the whole genome expression changes induced by IOX1 in Th17 cells. As shown in the volcano plot (as shown in fig. 6A), IOX1 significantly down-regulated the expression of 36 genes (P <0.05, fold change >2) and only up-regulated the expression of 7 genes in Th17 cells (as shown in table 2). Expression of Th17 marker cytokines Il17a and Ccl20 were both significantly inhibited by IOX1 (as shown in fig. 6A). However, under the action of IOX1, no changes were found in the transcription factors that promote Th17 differentiation (such as Rorc, Rora, Stat3 or Irf 4). Further gene ontology Analysis using the Ingenity Pathway Analysis program revealed that 43 IOX1 response genes were significantly enriched in pathways such as IL-17A signaling and inflammasome (as shown in FIG. 6B), while various upstream regulatory factors could be responsible for the regulation of the IOX1 response gene (as shown in FIG. 6C). Therefore, transcriptomics analysis showed that IOX1 could only inhibit the expression of key cytokines in Th17 cells.

TABLE 2 Whole genome expression changes induced by IOX1 in Th17 cells

To further clarify the molecular mechanism by which IOX1 inhibits Il17a expression, the inventors next investigated the potential targets of IOX1 in Th17 cells. Potential targets for IOX1 as inhibitors of 2OG oxygenase include histone and DNA demethylase. These demethylases play a critical role in mediating the demethylation of methylated DNA and histone markers (including H3K4me3, H3K9me3 and H3K27me3), together coordinating epigenetic regulation of Th17 differentiation. Since H3K27me3 demethylase JMJD3 and DNA demethylase TET2/TET3 were demonstrated to be activators of IL-17 expression and H3K9me3 could regulate IL-17 expression, the inventors examined whether IOX1 targeted histone demethylase JMJD3, KDM3A, KDM4E and DNA demethylase TET2/TET3 to inhibit IL17a expression in Th17 cells. A cellular thermal transition assay was performed to examine whether IOX1 interacts directly with its targeted protein. As shown in fig. 6D-E, IOX1 interacted with TET2, but not JMJD3, KDM3A, KDM4E, or TET 3. The data indicate that IOX1 can function by interacting with DNA demethylase TET2 in Th17 cells.

If TET2 is the target of IOX1 in Th17 cells, the DNA demethylation state of the Il17a promoter can be altered under the influence of IOX 1. Thus, the inventors next performed a bisulfite sequencing analysis to detect the frequency of DNA demethylation at all 12 CpG sites present on the Il17A promoter (-600- +200bp for the transcription start site) (as shown in FIG. 7A). The data indicate that IOX1 significantly reduced the frequency of DNA demethylation at CpG position 7 and position 8 (as shown in figure 7B). Furthermore, ChIP analysis demonstrated that TET2 directly binds to the CpG-6-8 site of the Il17a promoter, whereas Chem-IP analysis (FIG. 8A shows the chemical structure of biotinylated IOX 1) indicated that IOX1 also binds to the CpG-6-8 site of the Il17a promoter. Taken together, these results indicate that IOX1 interacts directly with TET2 on the Il17a promoter, which can counteract the DNA demethylating function of TET 2.

To verify whether IOX1 functions by targeting TET2, the inventors further investigated the IL-17 inhibitory effect of IOX1 in TET2 deficient Th17 cells. As shown in FIGS. 7C-E, CD4 deficient in TET2⁺Among T cells, Th17 cellsIs significantly affected. However, under the action of IOX1, IL-17⁺The mean fold reduction of the cells changed from 7.5 fold for wild type to 2.5 fold for TET2 deficient Th17 cells (as shown in fig. 7D-E). In addition to Il17a, RNA sequencing data also showed that IOX1 significantly reduced Ccl20 expression in Th17 cells (as shown in fig. 6A). As shown in fig. 8B-C, the mean fold reduction of CCL20 protein in Th17 culture supernatants was changed from 4.0 fold for wild type to 1.7 fold for TET2 deficient Th17 cells under the action of IOX 1. The research results are that: TET2 does play a mediating role in the inhibition of IL-17 expression by IOX 1.

Example 4: IOX1 for controlling intraocular inflammation in vivo

To investigate the anti-inflammatory effects of IOX1 in vivo, the inventors first examined whether intraperitoneal administration of IOX1 could control uveal retinitis using the classical murine EAU model (see "methods" section). No weight loss was observed in mice receiving drug treatment during IOX1 treatment (as shown in figure 9A). Local endoscopic fundus imaging (TEFI) and OCT scans were performed daily to assess the severity of intraocular inflammation in EAU mice. As shown in fig. 9B-C, retinal inflammation began on day 7 and peaked on day 13 post-immunization. The results of the evaluation demonstrate that IOX1 treatment significantly reduced the severity of intraocular inflammation, which is also evidenced by a reduction in fundus clinical score. Next, the inventors prepared single cell suspensions using eyes, eye draining lymph nodes, inguinal lymph nodes and spleen of EAU mice treated with DMSO or IOX1 on day 14 after immunization, and analyzed IFN-. gamma.and IL-17-producing CD4⁺A population of T cells. In the eye, IOX1 treatment was observed to significantly reduce total CD4 in the eye⁺、CD4⁺IFN-γ⁺、CD4⁺IL-17⁺And CD4⁺IFN-γ⁺IL-17⁺Number and frequency of T cells (as shown in FIGS. 9D-I). In contrast, outside the eye, the only change induced by IOX1 treatment was observed to be CD4 in the inguinal lymph node⁺IL-17⁺T cells were decreased (as shown in FIGS. 10A-O). Thus, these data demonstrate that systemic administration of IOX1 can control intraocular inflammation without significantly altering systemic CD4⁺A population of T cells.

Systemic administration of IOX1 can control intraocular inflammation by modulating various types of cells. Thus, the pathogenic CD4 transferred by adoptive transfer was used next⁺T cell induced EAU model (AT-EAU) to test whether IOX1 could be detected by modification of CD4 alone⁺T cells to function. Total splenocytes from EAU mice were cultured in vitro with DMSO or IOX1 for two days. Then, CD4 isolated from these cultures⁺Transfer of T cells into recipient mice induced uveoretination within 5 days (as shown in fig. 11A). Using TEFI, the inventors found that IOX 1-treated CD4 compared to DMSO-treated cell transfer⁺Pathogenic T cell-induced intraocular inflammation was significantly reduced (as shown in figure 11B). In the case of the transfer of IOX 1-treated cells, a reduction in the severity of the clinical disease in mice was accompanied by intraocular inflammatory CD4⁺A dramatic decrease in T cells (especially Th17 cells) (as shown in FIGS. 11D-I), and a decrease in Th17 cells in the draining lymph nodes of the eye (as shown in FIGS. 12A-O). The research results are that: IOX1 indeed can control Th17 mediated inflammation in vivo.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and the like that are within the spirit and principle of the present invention are included in the present invention.

The foregoing embodiments and methods described in this disclosure may vary based on the abilities, experience, and preferences of those skilled in the art.

The mere order in which the steps of a method are listed in the present invention does not constitute any limitation on the order of the steps of the method.

Claims

1. The application of a compound of a general formula I and pharmaceutically acceptable salts, esters, prodrugs and solvates thereof in preparing medicaments for preventing and/or treating autoimmune diseases,

t is 0,1 or 2;

2. The use according to claim 1, wherein the autoimmune disease is a Th 17-mediated autoimmune disease; and/or, the autoimmune disease comprises inflammation, in particular in vivo inflammation.

3. Use according to claim 1, wherein the autoimmune disease is an ocular inflammatory disease, preferably uveitis and its complications;

preferably, the uveitis is anterior uveitis, posterior uveitis, intermediate uveitis, or panuveitis;

preferably, the complication of uveitis is selected from: zonal corneal degeneration, cataracts, macular and optic disc edema, macular surface plenoptic changes, corneal edema, glaucoma, retinal detachment.

4. The application of the compound of general formula I and the pharmaceutically acceptable salt, ester, prodrug and solvate thereof in preparing anti-inflammatory drugs,

t is 0,1 or 2;

5. The use of claim 4, wherein the inflammation to which the anti-inflammatory agent is directed is a Th17 mediated inflammation;

the inflammation is in vivo inflammation and/or body surface inflammation, especially in vivo inflammation.

6. The use of claim 4, wherein the inflammation to which the anti-inflammatory agent is directed is ocular inflammation;

preferably, the ocular inflammation comprises uveitis.

7. The application of a compound of a general formula I and pharmaceutically acceptable salts, esters, prodrugs and solvates thereof in preparing medicaments for preventing and/or treating ocular inflammatory diseases,

t is 0,1 or 2;

8. The use of claim 7, wherein the ocular inflammatory disease is an infectious ocular inflammatory disease or a non-infectious ocular inflammatory disease;

preferably, the ocular inflammatory disease is a Th 17-mediated autoimmune ocular inflammatory disease.

9. The use of claim 7, wherein the ocular inflammatory disease is uveitis and its complications;

preferably, the uveitis is autoimmune uveitis;

more preferably, the uveitis is anterior uveitis, posterior uveitis, intermediate uveitis, or panuveitis;

more preferably, the complication of uveitis is selected from: zonal corneal degeneration, cataracts, macular and optic disc edema, macular surface plenoptic changes, corneal edema, glaucoma, retinal detachment.

10. The use of any one of claims 1-9, wherein R is_1-5Independently selected from: hydrogen, substituted OR unsubstituted alkyl, halogen, -OR₆；

Preferably, the compound is IOX1, having the structure: