CN114058643A

CN114058643A - Recombinant vaccinia virus vector capable of escaping existing anti-vaccinia virus neutralizing antibody existing in vivo

Info

Publication number: CN114058643A
Application number: CN202110690096.9A
Authority: CN
Inventors: 徐建青; 李雪; 黄杨
Original assignee: Vacdiagn Biotechnology Co ltd
Current assignee: Vacdiagn Biotechnology Co ltd
Priority date: 2021-06-22
Filing date: 2021-06-22
Publication date: 2022-02-18

Abstract

The invention relates to the technical field of molecular biology and immunology, in particular to a recombinant vaccinia virus vector which can escape existing anti-vaccinia virus neutralizing antibodies existing in vivo; the recombinant vaccinia virus vector has L1R and D8L homologous recombination arm sequences, and is a vaccinia virus vector which can be used for constructing a vaccinia virus vector inserted with exogenous genes in L1R and D8L gene regions of vaccinia virus; the invention provides a recombinant vaccinia virus vector capable of escaping existing anti-vaccinia virus neutralizing antibodies existing in vivo, wherein coding genes of L1R and D8L of the recombinant vaccinia virus vector are knocked out or damaged, and genes of L1R and D8L cannot be normally expressed, and the vaccinia virus vector can be used as a tumor vaccine or a gene therapy vector and can be used for preventing or treating various tumors.

Description

Recombinant vaccinia virus vector capable of escaping existing anti-vaccinia virus neutralizing antibody existing in vivo

Technical Field

The invention relates to the technical field of molecular biology and immunology, in particular to a recombinant vaccinia virus vector capable of escaping existing anti-vaccinia virus neutralizing antibodies existing in vivo.

Background

Vaccinia Virus (Vaccinia Virus) belongs to the genus Orthomyxovirus of the family Poxviridae and has been widely used worldwide as a vaccine for the prevention of smallpox infection, making smallpox the first malignant infectious disease to be completely eradicated by humans (Riva, G.et. al., 1979. Amilestrone in the history of infection. eradication of smallpox. MMW Munch Meachenschr, 121(50), 1669-70). In the last two decades, with the rapid development of genetic engineering techniques, vaccinia viruses have been used in research to design gene expression vectors, or in the development of recombinant live virus vaccines (Moss, B.1996.genetic engineering viruses for recombinant gene expression, vaccination, and safety. ProcNatl Acad Sci USA 93(21), 11341-8; Paoletti, E.et al, 1996.Applications of pox viruses vectors to vaccination: an update. Proc Natl Acad Sci USA 93(21), 11349-53). Various recombinant vaccinia virus vaccines have been used successfully to express rabies virus, Japanese encephalitis virus, and other viral antigens and to control animal infections (Kieny, M.P. et al, 1984.expression of viruses from a recombinant vaccine virus. Nature312(5990), 163-6; Konishi, E.et al, 1992.A high expressed family-restricted vaccine strain, NYVAC, encoding the prM, E, and NS1genes of Japanese infectious virus precursors JEV virus strain 190(1), 454-8). There have also been many important advances in human recombinant live virus vaccines, including preliminary human immune observations including measles, EBV, HAV, HBV, HPV, HIV and rabies viruses (Guofei et al, 2001, The construction of expression vectors for non-replicating recombinant vaccinia virus Tiantan strain C-K deletion region and The study of biological properties of recombinant viruses. viral acta 17(1), 24-28; McMichael, A.et al, 2002.The request for AIDS vaccine: is The CD8+ T-cell ap pro plasmid Nat Rev Immunol 2(4), 283-91; Moss, B.1996.genetic engineering for gene expression vector expression, vaccination, and safety. Proc. Natl Acad Sci 93(21), 11341-8; ZJ.J.J.65. vaccine, see 141. 7. and 141. biological genes).

The vaccinia virus Tiantan strain is a peculiar vaccinia virus strain in China, has been used for a long time in a large number of people in China as a vaccine strain for preventing smallpox infection, has the characteristics of relatively weak toxicity and safe use, and is an ideal strain for developing a genetic engineering virus vector and a recombinant live vaccine suitable for China. The sequencing of the whole genome of the Chinese vaccinia virus Tiantan strain was completed in 1997, which provides important background data for the research and elucidation of the unique biological characteristics of the vaccinia virus Tiantan strain and the genetic engineering modification (King et al, 1997, analysis of the whole genome structural characteristics of the vaccinia virus Tiantan strain, China science (C edition) 27(6), 562 and 567).

With the development of molecular biology, some viruses have been widely researched and developed as recombinant viral vectors due to their characteristics of good safety, strong immunogenicity, and convenience for gene manipulation. At present, the method is mainly applied to the medical fields of vaccines, gene therapy and the like. The poxvirus vector is large, the genome of the poxvirus vector is about 180k, and the poxvirus vector can accommodate large exogenous gene segments, so that the poxvirus vector can be used as an excellent viral vector for mediating the delivery of target proteins or coding genes thereof in vivo.

However, vaccinia virus, as a recombinant viral vector, has a strong vector response that can be activated to produce a strong immune response against vaccinia virus itself, including a strong neutralizing antibody response. Moreover, the response is long lasting and the neutralizing antibody response is provided for the lifetime of the individual vaccinated with the vaccinia virus vector. Thus, the presence of high levels of neutralizing antibodies in vivo will greatly affect reinfection with the recombinant vaccinia virus vector of interest, thereby affecting the effectiveness of viral vector drug delivery. This feature also limits the repeated or multiple applications of vaccinia virus vectors.

Disclosure of Invention

In view of the above-mentioned disadvantages of the prior art, the present invention provides a recombinant vaccinia virus vector that can escape the existing neutralizing antibody against vaccinia virus present in vivo, and the recombinant virus vector can escape the existing neutralizing antibody against vaccinia virus present in vivo, wherein the genes encoding L1R and D8L of the recombinant vaccinia virus vector of the present invention are knocked out or destroyed, and do not normally express the genes L1R and D8L, and the vaccinia virus vector can be used as a tumor vaccine or a gene therapy vector, and can be used for preventing or treating various tumors.

For the purposes of the present invention, the following terms are defined below.

The invention relates to a gene knockout or a knockout technology, which is a genetic engineering technology and refers to a technology or a method for replacing an endogenous normal homologous gene by using an exogenous mutated gene through a homologous recombination method, so that the endogenous gene is inactivated to express the character of a mutant. In the invention, the L1R and D8L knockouts are achieved by respectively replacing the endogenous normal L1R and D8L genes of vaccinia virus by homologous recombination through introducing mutations in the L1R and D8L genes, so that the L1R and D8L genes cannot be normally expressed.

The "Recombinant virus vector" or "Recombinant virus" as referred to herein is a vector produced by a DNA recombination technique and used for producing a viral vaccine or producing a gene therapy.

The term "Recombinant vaccinia virus vector" or "Recombinant vaccinia virus" as used herein refers to a vaccinia virus vector or vaccinia virus produced by Recombinant DNA techniques, and can be used for producing viral vaccines or vectors for gene therapy. In the present invention, a "recombinant vaccinia virus vector" or "recombinant vaccinia virus" is produced by homologous recombination of a shuttle vector having a homologous arm sequence of a target gene with vaccinia virus in a target cell, and then purified by selection of a reporter gene or a resistance gene carried by the recombinant vaccinia virus.

The term "shuttle plasmid vector" or "shuttle vector" as used herein refers to an intermediate plasmid vector for introducing a gene sequence of interest into the genome of another species. In the present invention, the "shuttle plasmid vector" or "shuttle vector" refers to an intermediate plasmid vector for introducing a target gene sequence into a vaccinia virus vector by homologous recombination, characterized in that the shuttle vector contains two homologous recombination arms having the same sequence as a partial sequence of a vaccinia virus genome.

The term "homologous recombination arm" or "homology arm" as used herein refers to a nucleic acid sequence that is identical to a vaccinia virus endogenous gene.

A recombinant vaccinia virus vector that can escape existing anti-vaccinia virus neutralizing antibodies present in vivo, which has the genes encoding L1R and D8L knocked out and is incapable of normally expressing the genes L1R and D8L.

The invention is further configured to: the vaccinia virus vector is a replicative vaccinia virus vector or a non-replicative vaccinia virus vector.

The invention is further configured to: the L1R and D8L knockouts were made by homologous recombination by introducing mutations into the L1R and D8L genes, respectively, to replace endogenous normal L1R and D8L genes of vaccinia virus, such that the L1R and D8L genes were not normally expressed.

The invention is further configured to: the L1R and D8L knockouts are performed by mutating the L1R and D8L genes by inserting a nucleic acid sequence comprising at least one vaccinia virus promoter element, or at least one reporter gene or one resistance gene, and further comprising one or more foreign genes other than the reporter gene or resistance gene, into the nucleic acid sequences at both ends of L1R and D8L, respectively.

The invention is further configured to: the vaccinia virus promoter element is P7.5 or PE/L.

The invention is further configured to: the reporter gene is a fluorescent protein coding gene or a galactosidase coding gene.

The invention is further configured to: the resistance gene is a neomycin encoding gene, and selective pressure is applied when the resistance gene is used for purifying a recombinant vaccinia virus vector.

The invention is further configured to: the exogenous gene is a non-vaccinia virus-derived gene other than the reporter gene or the resistance gene.

The invention is further configured to: the nucleic acid sequences at two ends of the L1R are respectively an L1R-L homologous recombination arm and an L1R-R homologous recombination arm.

The invention is further configured to: the nucleic acid sequences at two ends of the D8L are a D8L-L homologous recombination arm and a D8L-R homologous recombination arm respectively.

The invention is further configured to: the recombinant vaccinia virus vector knocked out by L1R and D8L is characterized in that a nucleic acid sequence is inserted into the homologous recombination arm sequences of L1R and D8L.

The invention is further configured to: the recombinant vaccinia virus vector knocked out by L1R and D8L is rvv-delta L1R/G-D8L/R.

The invention is further configured to: the recombinant vaccinia virus vector capable of escaping the existing anti-vaccinia virus neutralizing antibody existing in vivo is a recombinant vaccinia virus vector with L1R and D8L gene knocked out.

The invention is further configured to: the L1R and D8L gene knockout recombinant vaccinia virus vector contains an L1R-L homologous recombination arm sequence, and the L1R and D8L gene knockout recombinant vaccinia virus vector also contains an L1R-R homologous recombination arm sequence.

The invention is further configured to: the recombinant vaccinia virus vector with the knocked-out L1R and D8L genes contains a D8L-L homologous recombination arm sequence, and the recombinant vaccinia virus vector with the knocked-out L1R and D8L genes also contains a D8L-R homologous recombination arm sequence.

A shuttle vector for constructing recombinant vaccinia virus vectors with L1R and D8L gene knockout, the shuttle vector comprising L1R or D8L homologous recombination arm sequences.

The shuttle vector comprises a first shuttle vector and a second shuttle vector, wherein the first shuttle vector contains an L1R homologous recombination arm sequence, and the second shuttle vector contains a D8L homologous recombination arm sequence.

The invention is further configured to: the first shuttle vector contains the L1R-L homologous recombination arm sequence.

The invention is further configured to: the first shuttle vector also contains the L1R-R homologous recombination arm sequence.

The invention is further configured to: the second shuttle vector contains the D8L-L homologous recombination arm sequence.

The invention is further configured to: the second shuttle vector also contains the D8L-R homologous recombination arm sequence.

The invention is further configured to: the first shuttle vector further has inserted between the L1R homologous recombination arm sequences a nucleic acid sequence comprising at least one vaccinia virus promoter element, or at least one reporter gene or one resistance gene, and one or more foreign genes other than the reporter gene or the resistance gene.

The invention is further configured to: the second shuttle vector further inserts a nucleic acid sequence between the homologous recombination arm sequences of D8L, wherein the nucleic acid sequence comprises at least one vaccinia virus promoter element, or at least one reporter gene or one resistance gene, and the nucleic acid sequence further comprises one or more exogenous genes except the reporter gene or the resistance gene.

The invention is further configured to: the shuttle vector also inserts a nucleic acid sequence into the L1R or D8L homologous recombination arm sequence, wherein the first shuttle vector also inserts a nucleic acid sequence into the L1R homologous recombination arm sequence, and the second shuttle vector also inserts a nucleic acid sequence into the D8L homologous recombination arm sequence.

The invention is further configured to: the first shuttle vector is p delta L1R-GFP, and the second shuttle vector is p delta D8L-DsRed.

A preparation method for constructing recombinant vaccinia virus vector with L1R and D8L gene knockout comprises the following steps:

s1, designing primers, and respectively amplifying two homologous recombination arms of L1R by PCR.

S2, inserting the two homologous recombination arms into a target shuttle vector to construct a shuttle vector containing the L1R homologous recombination arm sequence.

S3, transfecting the shuttle vector into the vaccinia virus infected cell.

S4, collecting the recombinant vaccinia virus vector from the cell, and carrying out single-spot purification on a new cell to obtain the recombinant vaccinia virus vector with the L1R gene knocked out.

S5, designing primers, and respectively amplifying two homologous recombination arms of D8L by PCR.

S6, inserting the two homologous recombination arms into a target shuttle vector to construct a shuttle vector containing the D8L homologous recombination arm sequence.

S7, transfecting the shuttle vector into an L1R gene knockout vaccinia virus infected cell.

S8, collecting the recombinant vaccinia virus vector from the cell, and carrying out single-spot purification on a new cell to obtain the recombinant vaccinia virus vector with the L1R and D8L gene knocked-out.

Advantageous effects

Compared with the known public technology, the technical scheme provided by the invention has the following beneficial effects:

the recombinant vaccinia virus vector of the invention can escape the existing anti-vaccinia virus neutralizing antibody, the coding genes of L1R and D8L of the recombinant vaccinia virus vector are knocked out or damaged, and the genes of L1R and D8L cannot be normally expressed, and the vaccinia virus vector can be used as a tumor vaccine or a gene therapy vector, can be used for preventing or treating various tumors, and can increase the use frequency of the recombinant vaccinia virus vector in vivo.

Drawings

FIG. 1 is a plasmid map of shuttle vector p.DELTA.L 1R-GFP with L1R-L and L1R-R homologous recombination arm sequences;

FIG. 2 is a diagram showing the double restriction enzyme identification of a shuttle vector p.DELTA.L1R-GFP with L1R-L and L1R-R homologous recombination arm sequences;

FIG. 3 is a diagram showing the identification of recombinant vaccinia virus vector rvv- Δ L1R/G by PCR amplification;

FIG. 4 shows an expression identification chart of recombinant vaccinia virus vector rvv-. DELTA.L 1R/G;

FIG. 5 is a plasmid map of shuttle vector p.DELTA.D8L-DsRed with homologous recombination arm sequences of D8L-L and D8L-R;

FIG. 6 is a double restriction enzyme map of shuttle vector p.DELTA.D8L-DsRed with homologous recombination arm sequences of D8L-L and D8L-R;

FIG. 7 shows the PCR amplification identification of the recombinant vaccinia virus vector rvv- Δ L1R/G- Δ D8L/R;

FIG. 8 shows the expression patterns of recombinant vaccinia virus vector rvv- Δ L1R/G- Δ D8L/R;

FIG. 9 is also a diagram showing the expression identification of recombinant vaccinia virus vector rvv-. DELTA.L 1R/G-. DELTA.D 8L/R;

FIG. 10 shows the results of detection of neutralizing antibodies in example 9;

FIG. 11 shows the results of the virus replication kinetics in example 10.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. It is to be understood that the embodiments described are only a few embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The present invention will be further described with reference to the following examples.

Referring to FIGS. 1-11: the invention aims to provide a recombinant vaccinia virus vector capable of escaping existing anti-vaccinia virus neutralizing antibodies in vivo, wherein genes encoding L1R and D8L of the recombinant vaccinia virus vector are knocked out, and genes encoding L1R and D8L cannot be normally expressed.

In one embodiment of the invention, the Vaccinia virus vector is a replicating Vaccinia virus vector, such as a Vaccinia virus Tiantan strain, e.g., strain 752-1, or a non-replicating Vaccinia virus vector, such as a Vaccinia virus attenuated vaccine Ankara strain (Modified Vaccinia Ankara, MVA).

In one embodiment of the invention, the L1R and D8L knockout refers to the replacement of the endogenous normal L1R and D8L genes of vaccinia virus by homologous recombination by introducing mutations into the L1R and D8L genes, respectively, of vaccinia virus genes L1R and D8L, so that the L1R and D8L genes cannot be normally expressed.

In one embodiment of the invention, the L1R and D8L knockouts are performed by mutating the L1R and D8L genes by inserting a nucleic acid sequence comprising at least one vaccinia virus promoter element, or at least one reporter gene or one resistance gene, and further comprising one or more foreign genes other than the reporter gene or the resistance gene, into the nucleic acid sequences at both ends of L1R and D8L, respectively.

In one embodiment of the invention, the vaccinia virus promoter element is P7.5 or PE/L, preferably P7.5 is as shown in SEQ ID NO. 13 and PE/L is as shown in SEQ ID NO. 14.

In one embodiment of the present invention, the reporter gene is a fluorescent protein-encoding gene or a galactosidase-encoding gene (Lac Z), preferably, the fluorescent protein-encoding gene is a green fluorescent protein-encoding gene, a yellow fluorescent protein-encoding gene, a red fluorescent protein-encoding gene or a blue fluorescent protein-encoding gene, more preferably, the fluorescent protein-encoding gene is a green fluorescent protein-Encoding Gene (EGFP), and the nucleic acid-encoding sequence thereof is shown in SEQ ID NO. 15.

In one embodiment of the invention, the resistance gene is a neomycin encoding gene and selective pressure is applied when the resistance gene is used in the purification of recombinant vaccinia virus vectors.

In one embodiment of the present invention, the foreign gene is a gene derived from non-vaccinia virus itself except for a reporter gene or a resistance gene, and the target antigen or immunogen-encoding gene selected according to the purpose of use may be any one or more immunogens of interest, preferably, the target immunogen is a peptide, an antigen, a hapten, a carbohydrate, a protein, a nucleic acid, an allergen, a virus or a part of a virus, a bacterium, a parasite or other intact microorganism, and further, the target antigen or immunogen is a tumor antigen or an infection-associated antigen.

In one embodiment of the invention, the nucleic acid sequences at the two ends of L1R are respectively L1R-L homologous recombination arm and L1R-R homologous recombination arm, preferably, the sequence of the L1R-L homologous recombination arm is shown as SEQ ID NO. 1, and the sequence of the L1R-R homologous recombination arm is shown as SEQ ID NO. 2.The nucleic acid sequences at two ends of D8L are respectively a D8L-L homologous recombination arm and a D8L-R homologous recombination arm, preferably, the sequence of the D8L-L homologous recombination arm is shown as SEQ ID NO. 18, and the sequence of the D8L-R homologous recombination arm is shown as SEQ ID NO. 19.

In one embodiment of the invention, the L1R and D8L knockout recombinant vaccinia virus vectors further have a nucleic acid sequence as shown in SEQ ID NO. 16 inserted into the L1R homologous recombination arm sequence, respectively.

In one embodiment of the invention, the L1R and D8L knockout recombinant vaccinia virus vectors further have a nucleic acid sequence as shown in SEQ ID NO. 27 inserted into the homologous recombination arm sequence of D8L, respectively.

In one embodiment of the invention, the L1R and D8L knock-out recombinant vaccinia virus vector is rvv- Δ L1R/G-D8L/R.

In one embodiment of the invention, the L1R and D8L gene knockout recombinant vaccinia virus vector comprises a L1R-L homologous recombination arm sequence, the L1R and D8L gene knockout recombinant vaccinia virus vector further comprises a L1R-R homologous recombination arm sequence, preferably, the L1R-L homologous recombination arm sequence is shown in SEQ ID NO:1, the L1R-R homologous recombination arm sequence is shown in SEQ ID NO:2, furthermore, the L1R and D8L gene knockout recombinant vaccinia virus vector further comprises a D8L-L homologous recombination arm sequence, the L1R and D8L gene knockout recombinant vaccinia virus vector further comprises a D8L-R homologous recombination arm sequence, preferably, the D8L-L homologous recombination arm sequence is shown in SEQ ID NO:18, and the D8L-R homologous recombination arm sequence is shown in SEQ ID NO: 19.

The invention also provides a shuttle vector for constructing the recombinant vaccinia virus vector with the knock-out genes of L1R and D8L, wherein the shuttle vector contains the homologous recombination arm sequences of L1R or D8L.

In one embodiment of the present invention, the shuttle vector comprises a first shuttle vector comprising the L1R homologous recombination arm sequence and a second shuttle vector comprising the D8L homologous recombination arm sequence.

In one embodiment of the invention, the first shuttle vector comprises the L1R-L homologous recombination arm sequence, preferably the L1R-L homologous recombination arm sequence is shown in SEQ ID NO 1.

In one embodiment of the invention, the shuttle vector further comprises an L1R-R homologous recombination arm sequence, preferably the L1R-R homologous recombination arm sequence is shown in SEQ ID NO. 2.

In one embodiment of the invention, the second shuttle vector comprises the D8L-L homologous recombination arm sequence, preferably the D8L-L homologous recombination arm sequence is shown in SEQ ID NO: 18.

In one embodiment of the invention, the shuttle vector further comprises a D8L-R homologous recombination arm sequence, preferably, the D8L-R homologous recombination arm sequence is shown in SEQ ID NO: 19.

In one embodiment of the present invention, the first shuttle vector further comprises a nucleic acid sequence comprising at least one vaccinia virus promoter element, or at least one reporter gene or one resistance gene, and one or more foreign genes other than the reporter gene or the resistance gene, inserted between the L1R homologous recombination arm sequences.

In one embodiment of the present invention, the second shuttle vector further comprises a nucleic acid sequence comprising at least one vaccinia virus promoter element, or at least one reporter gene or one resistance gene, and one or more foreign genes other than the reporter gene or the resistance gene, inserted between the sequences of the homologous recombination arms of D8L.

In one embodiment of the invention, the promoter element of vaccinia virus is P7.5 or PE/L, the sequence of P7.5 is shown as SEQ ID NO. 13, and the sequence of PE/L is shown as SEQ ID NO. 14.

In one embodiment of the present invention, the reporter gene is a fluorescent protein-encoding gene or a galactosidase-encoding gene (Lac Z), preferably, the fluorescent protein-encoding gene is a green fluorescent protein-encoding gene, a yellow fluorescent protein-encoding gene, a red fluorescent protein-encoding gene or a blue fluorescent protein-encoding gene, more preferably, the fluorescent protein-encoding gene is a green fluorescent protein-Encoding Gene (EGFP), the nucleic acid-encoding sequence of which is shown in SEQ ID NO:15, and more preferably, the fluorescent protein-encoding gene is a red fluorescent protein-encoding gene DsRed, the nucleic acid-encoding sequence of which is shown in SEQ ID NO: 26.

In one embodiment of the present invention, the nucleic acid sequences at both ends of first shuttle vector L1R are L1R-L homologous recombination arm and L1R-R homologous recombination arm, preferably, the sequence of L1R-L homologous recombination arm is shown as SEQ ID NO. 1, and the sequence of L1R-R homologous recombination arm is shown as SEQ ID NO. 2.

In one embodiment of the present invention, the first shuttle vector further has a nucleic acid sequence as shown in SEQ ID NO. 16 inserted into the L1R homologous recombination arm sequence.

In one embodiment of the present invention, the nucleic acid sequences at both ends of the second shuttle vector D8L are D8L-L homologous recombination arm and D8L-R homologous recombination arm, preferably, the sequences of the D8L-L homologous recombination arm are shown in SEQ ID NO:18, and the sequences of the D8L-R homologous recombination arm are shown in SEQ ID NO: 19.

In one embodiment of the present invention, the second shuttle vector further has a nucleic acid sequence inserted into the homologous recombination arm sequence of D8L, and the nucleic acid sequence is shown as SEQ ID NO. 27.

In one embodiment of the present invention, the first shuttle vector is p.DELTA.L 1R-GFP, the sequence of which is shown in SEQ ID NO:17, and the second shuttle vector is p.DELTA.D 8L-DsRed, the sequence of which is shown in SEQ ID NO: 28.

The invention also provides a preparation method for constructing the L1R and D8L gene knockout recombinant vaccinia virus vector, which comprises the following steps:

step one, designing primers, and respectively amplifying two homologous recombination arms of L1R by using PCR.

And step two, inserting the two homologous recombination arms into a target shuttle vector to construct a shuttle vector containing the L1R homologous recombination arm sequence.

And step three, transfecting the shuttle vector into the vaccinia virus infected cell.

And step four, collecting the recombinant vaccinia virus vector from the cell, and performing single-spot purification on the new cell to obtain the recombinant vaccinia virus vector with the L1R gene knocked out.

And step five, designing primers, and respectively amplifying two homologous recombination arms of D8L by using PCR.

And step six, inserting the two homologous recombination arms into a target shuttle vector to construct a shuttle vector containing the D8L homologous recombination arm sequence.

And seventhly, transfecting the shuttle vector into the L1R gene knockout vaccinia virus infected cells.

And step eight, collecting the recombinant vaccinia virus vector from the cell, and performing single-spot purification on the new cell to obtain the recombinant vaccinia virus vector with the L1R and D8L gene knocked-out.

Wherein, the primer is a primer sequence which can be combined with two ends of L1R, and is preferably a primer of SEQ ID NO. 3L1R-LC-F, 4L1R-LC-R, 5L1R-RC-F or 6L 1R-RC-R.

Wherein, the primer is a primer sequence which can be combined with two ends of D8L, and is preferably SEQ ID NO. 20D8L-LC-F primer, SEQ ID NO. 21D8L-LC-R primer, SEQ ID NO. 22D8L-RC-F primer or SEQ ID NO. 23D8L-RC-R primer.

The shuttle vector is characterized by containing L1R or D8L homologous recombination arm sequences.

In one embodiment of the present invention, the shuttle vector is two shuttle vectors. Wherein the first shuttle vector comprises an L1R homologous recombination arm sequence and the second shuttle vector comprises a D8L homologous recombination arm sequence.

In one embodiment of the present invention, the first shuttle vector further comprises an L1R-R homologous recombination arm sequence, preferably, the L1R-R homologous recombination arm sequence is shown in SEQ ID NO. 2.

In one embodiment of the invention, the second shuttle vector further comprises a D8L-R homologous recombination arm sequence, preferably, the D8L-R homologous recombination arm sequence is shown in SEQ ID NO: 19.

In one embodiment of the present invention, the shuttle vector further comprises a nucleic acid sequence inserted between the L1R or D8L homologous recombination arm sequences, preferably the nucleic acid sequence comprises at least one vaccinia virus promoter element, or at least one reporter gene or one resistance gene, and in one embodiment of the present invention, the nucleic acid sequence may further comprise one or more other exogenous genes in addition to the reporter gene or the resistance gene.

In one embodiment, the vaccinia virus promoter element is P7.5 or PE/L, preferably P7.5 is as set forth in SEQ ID NO. 13 and PE/L is as set forth in SEQ ID NO. 14.

In one embodiment, the reporter gene is a fluorescent protein-encoding gene or a galactosidase-encoding gene (Lac Z), preferably the fluorescent protein-encoding gene is a green fluorescent protein-encoding gene, a yellow fluorescent protein-encoding gene, a red fluorescent protein-encoding gene or a blue fluorescent protein-encoding gene, and more preferably the fluorescent protein-encoding gene is a green fluorescent protein-Encoding Gene (EGFP), the nucleic acid-encoding sequence of which is shown in SEQ ID NO: 15.

In the present invention, the resistance gene is, for example, a Neomycin (Neomycin) encoding gene, and can be used for applying selective pressure when purifying a recombinant vaccinia virus vector.

In the present invention, the other foreign gene is a gene derived from the non-vaccinia virus itself other than the reporter gene or the resistance gene, and may be any one or more of the immunogens according to the target antigen or immunogen-encoding gene selected for use. Preferably, the immunogen of interest is a peptide, antigen, hapten, carbohydrate, protein, nucleic acid, allergen, virus or part of a virus, bacterium, parasite or other whole microorganism. In addition, the antigen or immunogen of interest is a tumor antigen or an infection-associated antigen.

Among them, the Vaccinia virus is preferably a replicative Vaccinia virus vector such as Vaccinia virus Tiantan strain, e.g., 752-1 strain, or a non-replicative Vaccinia virus vector such as Vaccinia virus attenuated vaccine Ankara strain (Modified Vaccinia Ankara, MVA).

The cells are eukaryotic cell lines, preferably mammalian cell lines, such as 293T cells, 143B cells, Vero cells or BHK-21 cell lines.

Transfection is a technique well known in the art, i.e., delivery of the plasmid DNA of interest into cells, and includes, but is not limited to, physical methods (e.g., electroporation, cell extrusion, nanoparticles, and magnetic transfer), or chemical methods (e.g., calcium phosphate transfection, lipofection, DEAE-dextran or polyethyleneimine transfection), preferably, transfection is polyethyleneimine transfection, such as Turbofect (Thermo Fisher Scientific, R0531) transfection reagent.

For a better description of the invention, see examples 1-10:

example 1 p.DELTA.L 1R-GFP shuttle vector construction.

Primers (Table 1) were designed on the genomic sequence of the Tiantan strain poxvirus TP5 clone (Genbank: KC207811) by using rvv-WT genomic DNA (preparation method reference example 3) as a template (L1R-L (SEQ ID NO:1) and L1R-R (SEQ ID NO:2) fragments were amplified respectively, wherein the L1R-LC-F and L1R-LC-R primer pairs were used for amplifying the L1R-L fragment, and the L1R-RC-F and L1R-RC-R primer pairs were used for amplifying the L1R-R fragment.

Table 1: primers in example 1

In step 1, an intermediate vector p delta L1R-L-GFP with L1R-L homologous recombination arms is constructed. First, a linearized vector of about 5kbp was PCR-amplified using pSC65-GFP vector (obtained by replacing LacZ expressing galactosidase on pSC65 vector with EGFP gene expressing green fluorescent protein, supplied by Soviken Tokyo Biotech Co., Ltd.) modified from pSC65 shuttle vector (addge, cat # 30327) as a template, and TKL-F and TKL-R (Table 1) primers. The linearized vector was then subjected to homologous recombination with the L1R-L fragment using the EasyGeno Rapid cloning kit (Tiangen, VI201), methods referenced in the kit instructions. The vector p.DELTA.L 1R-L-GFP with the L1R-L homology arm sequence was then constructed using recombinant transformation methods well known in the art.

In step 2, a shuttle vector p.DELTA.L 1R-GFP was constructed. Using the intermediate vector p.DELTA.L 1R-L-GFP constructed in step 1 as a template, a linearized vector of about 5kbp was amplified using TKR-F and TKR-R primer set (Table 1). The linearized vector was then subjected to homologous recombination with the L1R-R fragment using the EasyGeno Rapid cloning kit (Tiangen, VI201), methods referenced in the kit instructions. Then, a vector p delta L1R-GFP (a plasmid map is shown in a figure 1) with L1R-L and L1R-R homologous arm sequences is constructed by a recombinant transformation method well known in the art, and is stored in a warehouse after being sequenced and identified correctly. The vector p.DELTA.L 1R-GFP (restriction system shown in Table 2) was identified by using restriction endonucleases Not and Kpn I, and its cleavage verification map is shown in FIG. 4.

Table 2: plasmid p.DELTA.L 1R-GFP restriction enzyme identification System (restriction enzyme for 2 hours at 37 ℃ C.)

Enzyme digestion system	Volume of
		Plasmid p.DELTA.L 1R-GFP	3 μ L, about 1 μ g
Not I (Baoyuan, goods number 1166A)	1μL
		Kpn I (Baozi, cat No. 1068A)	1μL
Enzyme digestion buffer solution	1μL
		ddH2O	Make up to 10 mu L

Example 2 recombinant vaccinia virus vector rvv- Δ L1R/G was constructed.

Recombinant vaccinia virus vectors were obtained in 293T cells as follows. On day 1, 293T cells were plated in 6-well cell culture plates (JET, TCP-010-⁶Well, incubated overnight at 37 ℃ in a carbon dioxide cell incubator. The following day, at 0.05MOI (i.e., 5X 10)⁴PFU (plaque forming Unit)/well) was added vaccinia virus wild strain rvv-WT (supplied by Beijing biologicals) and incubated in a 37 ℃ carbon dioxide cell incubator for two hours during which the shuttle vector/transfection reagent complex was prepared. Wherein the shuttle vector is p.DELTA.L 1R-GFP obtained in example 1, the transfection reagent is Turbofect (Thermo Fisher Scientific, R0531), and the transfection dose and the compounding method can be found in the specification of the transfection reagent. After completion of the complexing system, the 293T cell supernatant was changed to 2 mL/well DMEM maintenance medium containing 2% Fetal Bovine Serum (FBS), and then the shuttle vector/transfection reagent complex was added. 48 hours after transfection, supernatant was removed, cells were harvested and resuspended in 0.5mL maintenance medium, freeze-thawed three times repeatedly, and recombinant cell lysate was then inoculated into Vero cells (R: (R) (R))

CCL-81) and incubated at 37 ℃ for 1 to 2 days. During which cytopathic effects are observedSingle plaque purification is performed when the appropriate number of viral plaques are present (less than 20 plaques/well).

Single-spot purification:

and (3) observing virus plaques expressing green fluorescence under a fluorescence microscope, and marking.

Remove the supernatant, pick several well-dispersed green fluorescent plaques per well, and transfer to centrifuge tubes containing 0.5mL of maintenance medium, respectively.

Shaking and mixing the centrifuge tube containing the virus, repeatedly freezing and thawing for three times (about 5 minutes at minus 80 ℃ in a refrigerator and about 2 minutes at room temperature), finally shaking and mixing the mixture, and freezing and storing the mixture at minus 80 ℃.

Vero cells (T) were prepared on 6-well cell culture plates (JET, TCP-010-

CCL-81), virus was then removed from the-80 ℃ freezer, seeded onto Vero cells in 10 μ L each, and incubated at 37 ℃ for 2 to 3 days. During which cytopathic effects are observed and the next round of single plaque purification is performed when the appropriate number of viral plaques are present (less than 20 plaques/well).

At least six rounds of single-spot purification were repeated until the purity reached 100%.

Example 3 identification of recombinant vaccinia virus vector rvv- Δ L1R/G.

The purified poxvirus vector rvv-. DELTA.L 1R/G was seeded onto Vero cells (1X 10)⁷Cells) were observed after 48 hours, and when 80% or more of the cells were infected, the cells were collected, centrifuged at 1800g for 5 minutes, and the supernatant was removed. Then extracting the poxvirus genomic DNA by using a genomic DNA extraction kit (TRAN, EE101-02), wherein the specific method refers to the kit specification, and finally obtaining 100 mu L of genomic DNA and freezing and storing at-20 ℃.

The poxvirus genomic DNA was PCR amplified using the primer pairs L1R-F and L1R-R (Table 3) at both ends of the L1R gene, and the target band of 2394bp was amplified in the recombinant poxvirus vector rvv-. DELTA.L 1R/G genomic DNA as shown in FIG. 3. And (3) sending a PCR amplification product sample to Jinzhi corporation for sequencing, wherein the sequence result is in line with the expectation, and the L1R fragment is successfully knocked out.

Table 3: primers for identification in example 3

Similarly, the purified poxvirus vector rvv-. DELTA.L 1R/G was seeded onto Vero cells (1X 10)⁷Cells) were observed after 48 hours, and when 80% or more of the cells were infected, the cells were collected, centrifuged at 1800g for 5 minutes, and the supernatant was removed. SDS-PAGE samples were then prepared and subjected to immunoblot hybridization experiments (anti-GFP monoclonal antibody-HRP (Santacruz, sc-9996HRP) as the primary antibody). As shown in FIG. 4, there is a specific band around 25kD, which is consistent with the expected molecular weight position, while the control sample (rvv-WT) has no band at the corresponding molecular weight position, indicating that rvv- Δ L1R/G has been constructed to correctly express the inserted foreign gene GFP target antigen.

Example 4 recombinant vaccinia virus vector rvv- Δ L1R/G amplification preparation and titration.

The recombinant vaccinia virus vector rvv- Δ L1R/G and the wild strain of vaccinia virus (rvv-WT) constructed in example 2 were amplified on Vero cells, respectively, as follows:

on the previous day, Vero monolayers (1X 10) with 100% confluency were prepared⁷Cells/dish) for a total of 10 dishes.

The supernatant was removed and replaced with maintenance medium, the poxvirus to be amplified was inoculated onto the cells (0.01 PFU/cell) and incubated in an incubator at 37 ℃ for 2-3 days, and the lesions were observed.

The cells were scraped and collected, 1800g centrifuged for 5 minutes and the supernatant removed.

Resuspending with 5mL of maintenance medium, and sonicating with a sonicator cell disruptor on ice under the following conditions: 50 watts, 5 seconds sonication/5 seconds interval for 15 minutes.

Repeatedly freezing and thawing twice (about 5 minutes at 80 ℃ in a refrigerator and about 2 minutes at room temperature), and finally oscillating and uniformly mixing;

subpackaging in a secondary biological safety cabinet into 1.5mL centrifuge tubes, and freezing at-80 ℃ for 1 mL/tube.

The infectious titer of the amplified vaccinia virus is titrated on Vero cells by the specific method as follows:

vero cells, 3X 10, with a 100% confluency were prepared in 24-well plates on the previous day⁵A hole.

Remove supernatant and add 200 μ L of maintenance medium per well to prevent cells from drying out.

Adding 100 mu L poxvirus to be detected into 900 mu L maintenance medium, ten-fold diluting, and continuously diluting 10 times¹，10²，10³… …, up to 10⁹And (4) doubling. Note that: when dilution is performed, the tip should be replaced every time dilution is performed from high concentration to low concentration.

From small to large virus concentration (10)⁹，10⁸，……10⁴) Added to a 24-well plate at 400. mu.L dilution per well, and repeated two times, and the dilution was measured at 6 times in series. The added 24-well plate was incubated in a 37 ℃ cell incubator for 2 days.

The number of viral plaques, more than 20, was counted microscopically and scored as 20 +. Two replicate wells with a measurable number of 20 spots (including 20) were averaged by a dilution of 2.5 (1000. mu.L/400. mu.L). times.corresponding wells to obtain the recombinant virus titer (PFU/mL). The titer of vaccinia virus vectors was titrated as shown in Table 4.

Table 4: vaccinia Virus vector titer titration

Vaccinia virus	Potency (PFU/mL)
		Vaccinia virus wild type rvv-WT	1×10⁸
Recombinant vaccinia virus rvv-delta L1R/G	1×10⁸

Example 5 p.DELTA.D 8L-DsRed shuttle vector construction.

D8L-L (SEQ ID NO:18) and D8L-R (SEQ ID NO:19) fragments were amplified by designing primers (Table 5) on the genomic sequence of the Tiantan strain poxvirus TP5 clone (Genbank: KC207811) using vaccinia virus wild-type rvv-WT genomic DNA (preparation method reference example 3) as a template, respectively, wherein the D8L-LC-F and D8L-LC-R primer pairs were used to amplify the D8L-L fragment, and the D8L-RC-F and D8L-RC-R primer pairs were used to amplify the D8L-L fragment.

Table 5: primers in example 5

In step 1, an intermediate vector p delta D8L-L with a D8L-L homologous recombination arm is constructed. First, a linearized vector having a size of about 5kbp was PCR-amplified using pSC65-GFP vector (obtained by replacing LacZ expressing galactosidase on pSC65 vector with DsRed gene expressing red fluorescent protein, supplied by Sovizhou Industrial park Tokyo Biotech Co., Ltd.) modified from pSC65 shuttle vector (addge, cat # 30327) as a template, and TKL-F and TKL-R (Table 5) primers. The linearized vector was then subjected to homologous recombination with the D8L-L fragment using the EasyGeno Rapid cloning kit (Tiangen, VI201), methods referenced in the kit instructions. The vector p.DELTA.D 8L-L with the homologous arm sequence of D8L-L was then constructed using recombinant transformation methods well known in the art.

In step 2, a shuttle vector p.DELTA.D 8L-DsRed was constructed. Using the intermediate vector p.DELTA.D 8L-L constructed in step 1 as a template, a linearized vector of about 5kbp was amplified using TKR-F and TKR-R primer set (Table 5). The linearized vector was then subjected to homologous recombination with the D8L-R fragment using the EasyGeno Rapid cloning kit (Tiangen, VI201), methods referenced in the kit instructions. Then, a vector p delta D8L-DsRed (plasmid map shown in figure 5) with homologous arm sequences of D8L-L and D8L-R is constructed by a recombinant transformation method well known in the art, and is put in storage after being sequenced and identified correctly. The restriction enzymes Not I and Kpn I were used to identify the vector p.DELTA.D 8L-DsRed (the digestion system is shown in Table 6), and the digestion verification map is shown in FIG. 6.

Table 6: restriction enzyme identification System of plasmid p.DELTA.D 8L-DsRed (restriction enzyme for 2 hours at 37 ℃ C.)

Enzyme digestion system	Volume of
		Plasmid p.DELTA.D 8L-DsRed	3 μ L, about 1 μ g
Not I (Baoyuan, goods number 1166A)	1μL
		Kpn I (Baozi, cat No. 1068A)	1μL
Enzyme digestion buffer solution	1μL
		ddH₂O	Make up to 10 mu L

Example 6 recombinant vaccinia virus vector rvv- Δ L1R/G- Δ D8L/R construction.

Recombinant vaccinia virus vectors were obtained in 293T cells as follows. On day 1, 293T cells were plated in 6-well cell culture plates (JET, TCP-010-⁶Well, carbon dioxide cell culture Chamber at 37 ℃And incubated overnight. The following day, at 0.05MOI (i.e., 5X 10)⁴PFU (plaque forming Unit)/well) was added with the recombinant vaccinia virus vector rvv- Δ L1R/G prepared in example 4, and then placed in a carbon dioxide cell incubator at 37 ℃ for two hours during which the shuttle vector/transfection reagent complex was prepared. Wherein the shuttle vector is p.DELTA.D 8L-DsRed obtained in example 5, the transfection reagent is Turbofect (Thermo Fisher Scientific, R0531), and the transfection dose and the compounding method can be found in the specification of the transfection reagent. After completion of the complexing system, the 293T cell supernatant was changed to 2 mL/well DMEM maintenance medium containing 2% Fetal Bovine Serum (FBS), and then the shuttle vector/transfection reagent complex was added. 48 hours after transfection, supernatant was removed, cells were harvested and resuspended in 0.5mL maintenance medium, freeze-thawed three times repeatedly, and recombinant cell lysate was then inoculated into Vero cells (R: (R) (R))

CCL-81) and incubated at 37 ℃ for 1 to 2 days. During which cytopathic effects are observed and single plaque purification is performed when the appropriate number of viral plaques are present (less than 20 plaques/well).

Single-spot purification:

the virus plaques expressing red fluorescence were observed under a fluorescence microscope and marked.

Remove the supernatant, pick several well-dispersed red fluorescent plaques per well, and transfer to centrifuge tubes containing 0.5mL of maintenance medium, respectively.

Vero cells (T) were prepared on 6-well cell culture plates (JET, TCP-010-

Example 7 recombinant vaccinia virus vector rvv- Δ L1R/G- Δ D8L/R identification.

The poxvirus vector rvv-. DELTA.L 1R/G-. DELTA.D 8L/R purified in example 6 was seeded onto Vero cells (1X 10)⁷Cells) were observed after 48 hours, and when 80% or more of the cells were infected, the cells were collected, centrifuged at 1800g for 5 minutes, and the supernatant was removed. Then extracting the poxvirus genomic DNA by using a genomic DNA extraction kit (TRAN, EE101-02), wherein the specific method refers to the kit specification, and finally obtaining 100 mu L of genomic DNA and freezing and storing at-20 ℃.

The poxvirus genomic DNA was PCR amplified using primers D8L-F and D8L-R (Table 7) from both ends of the D8L gene, and the results are shown in FIG. 7. the recombinant poxvirus vector rvv- Δ L1R/G- Δ D8L/R genomic DNA amplified a band of 1.8kb, which is significantly larger than the negative control (808bp) amplified using rvv-WT genome. And (3) sending a PCR amplification product sample to Jinzhi corporation for sequencing, wherein the sequence result is in line with the expectation, and the D8L fragment is successfully knocked out.

Table 7: identification primer in example 7

Primer and method for producing the same	Sequence of
		D8L-F(SEQ ID NO:24)	GGTAAGTATAAACACGAATACT
D8L-R(SEQ ID NO:25)	GCGATTGAAGCCGTTAGACATAC

Similarly, the purified vaccinia virus vector rvv-. DELTA.L 1R/G-. DELTA.D 8L/R was inoculated onto Vero cells (1X 10)⁷Cell)After 48 hours, the pathological changes were observed, and when more than 80% of the cells were infected, the cells were harvested, centrifuged at 1800g for 5 minutes, and the supernatant was removed. SDS-PAGE samples were then prepared and used for immunoblot hybridization experiments, and primary antibodies were anti-GFP monoclonal antibody-HRP (Santacruz, sc-9996 HRP). As shown in FIG. 8, there is a specific band around 20kD, which is consistent with the expected molecular weight position, while no band is observed in the control sample (rvv-WT), indicating that the constructed vaccinia virus vector rvv-. DELTA.L 1R/G-. DELTA.D 8L/R can correctly express the inserted foreign gene GFP target antigen. Meanwhile, the recombinant vaccinia virus vector rvv-delta D8L/G is not expressed in D8L, while wild type vaccinia virus rvv-WT has obvious expression of D8L at 35kD, indicating that the D8L gene is knocked out, as shown in FIG. 9, after the recombinant vaccinia virus vector rvv-delta D8L/G is incubated with anti-D8L-antibody (LA5, virology.2011Jan 20; 409 (271-9)) and a secondary antibody is incubated with rabbit anti-human-HRP (Boster, BA 1070).

Example 8 recombinant vaccinia virus vector rvv- Δ L1R/G- Δ D8L/R amplification preparation and titration.

The recombinant vaccinia virus vector rvv- Δ L1R/G- Δ D8L/R and the wild strain of vaccinia virus (rvv-WT) constructed in example 6 were amplified on Vero cells, respectively, as follows:

The number of viral plaques, more than 20, was counted microscopically and scored as 20 +. Two replicate wells with a measurable number of 20 spots (including 20) were averaged by a dilution of 2.5 (1000. mu.L/400. mu.L). times.corresponding wells to obtain the recombinant virus titer (PFU/mL). The titer of vaccinia virus vectors was titrated as shown in Table 8.

TABLE 8 vaccinia Virus vector titer titration

Example 9 detection of neutralizing antibodies.

The detection method of the neutralizing antibody comprises the following steps: a96-well flat-bottom plate was prepared by adding 100. mu.L of DMEM cell culture medium to all wells in column 1 (cell control) and 50 wells to all wells in columns 2-12 with ME cell culture medium (column 2 will be used as virus control). Further 30 additions of 12 controls) of cell culture medium (1: 10 initial dilution, 2-fold gradient dilution) were added to wells H3-H12. 20 human plasma samples to be tested are respectively added into H3-H12 wells. Mix all samples in row H and then transfer 50 all to row G. Mixing and transfer were repeated until row a (2-fold gradient dilution). Discarding from row A, columns 3-12 after the last transfer and mixing is completed50 are discarded. The amount of vaccinia virus was calculated and 40 PFU/well was used as the infectious dose to thaw sufficient viral stocks. When the thawing was complete, the virus was diluted to 800PFU/mL with DMEM cell culture medium. 50 μ L of virus dilution was added to all wells in 2-12 columns in a 96 well plate, the plate was covered, and incubated for 1 hour in a cell incubator. Preparing Vero cells, digesting the Vero cells with pancreatin/EDTA to obtain cell suspension, maintaining the culture medium with 2% DMEM to adjust the cell concentration to 5⁵mL, then added to a 96 well cell culture plate at 100. mu.L/well, i.e., 5X 10^4/And (4) a hole. After 48 hours, the supernatant was carefully aspirated, 0.1% crystal violet was added, 50 μ L/well, and stained for 10 minutes at room temperature. The number of plaques in each well was counted and divided by the mean of the plaques in the virus control (column 2) by 1 and then multiplied by 100 to give the percent inhibition of the sample. IC50 titers were determined as percent inhibition, and neutralizing antibody IC50 titers were expressed as percent inhibition>The reciprocal of the highest dilution of 50, the IC50 can also be calculated from a percentage inhibition fit curve.

As shown in FIG. 10, human plasma showed higher neutralizing antibody levels against vaccinia virus wild type (rvv-WT) (mean GMT of 190.3), while the neutralizing antibody levels against L1R and D8L deficient strain rvv-. DELTA.L 1R/G-. DELTA.D 8L/R were significantly reduced (mean GMT of 28.8, p < 0.05). The results show that the strains subjected to L1R and D8L knockout escape from the existing antibodies in human bodies, so that the chance of reinfection is increased, and the application possibility of vaccinia virus vectors is improved.

Example 10 virus replication kinetics.

Vero cells were prepared in 6-well plates and vaccinia virus was inoculated to each well (1.5X 10) at 0.1MOI⁵PFU), supernatants and cells were then taken at various time points post infection, frozen and thawed 3 times and titrated on Vero cells (see method for virus titration in example 4).

As a result, as shown in FIG. 11, the wild-type vaccinia virus rvv-WT was found to be replication competent, and the virus was present mainly in the cells and contained a smaller amount of supernatant than the cells. Compared with wild strains, the L1R and D8L defective strains rvv-delta L1R/G-delta D8L/R have slightly weaker replication capacity and consistent trend of replication kinetic curves, and both reach a peak at 48 hours. L1R and D8L knockouts were shown to slightly affect the replication capacity of vaccinia virus.

The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some technical features may be equivalently replaced; such modifications and substitutions do not depart from the spirit and scope of the corresponding technical solutions.

The applicant: sozhou industrial park reachability Biotechnology Limited

The invention name is as follows: recombinant vaccinia virus vector capable of escaping existing anti-vaccinia virus neutralizing antibody existing in vivo

3L1R-LC-F primer of SEQ ID NO

TATAACCAGACCGTTCAGAAAATATGCGGAACCTCGAGA

Primer SEQ ID NO. 4L1R-LC-R

ATTAATTTTTATCGATCTTAACACAGCATCCAACTGAGC

Primer SEQ ID NO 5L1R-RC-F

AGTAAGCGGCCGCGGATCTGCGTTAAACATTCAGACGAG

6L1R-RC-R primer of SEQ ID NO

TTAATAATCTCATTTCAGACAACCTAATTAATGGTCGAAG

Primer of SEQ ID NO 7 TKL-F

ATAGGTATCGATGAAGGACAG

8 TKL-R primer of SEQ ID NO

GTTGTGATCCATTTATTGATCGC

9 TKR-F primer of SEQ ID NO

CTTTTGCTCCTTCATATTCAG

10 TKR-R primer of SEQ ID NO

ATCGAGTGCGGCTACTATAAC

Primer of SEQ ID NO. 11L 1R-F

AAAATGTGATATAGAAATCGG

Primer of SEQ ID NO 12L 1R-R

AGAAGTTCTAAAGAATGTGTC

20D8L-LC-F primer of SEQ ID NO

TATAACCAGACCGTTCAGGGGTACTGTATCATTTAGCG

21D8L-LC-R primer

ATTAATTTTTATCGATCTATTTTATCTAGACAATTTGCTG

Primer SEQ ID NO 22D8L-RC-F

GCGGCCGCGGATCACTGAATCAAACGGTGCAGA

23D8L-RC-R primer

TTAATAATCTCATTTCAGATTGTAATTCCCATACTAAGAGC

Primer of SEQ ID NO 24D 8L-F

GGTAAGTATAAACACGAATACT

Primer SEQ ID NO. 25D 8L-R

GCGATTGAAGCCGTTAGACATAC

Claims

1. A recombinant vaccinia virus vector that can escape existing anti-vaccinia virus neutralizing antibodies present in vivo, wherein the genes encoding L1R and D8L of the recombinant vaccinia virus vector are knocked out and the genes L1R and D8L are not normally expressed.

2.The recombinant vaccinia virus vector of claim 1, wherein the vaccinia virus vector is a replicating vaccinia virus vector or a non-replicating vaccinia virus vector that escapes the presence of neutralizing antibodies against vaccinia virus.

3. The recombinant vaccinia virus vector of claim 2, wherein the L1R and D8L knockouts are achieved by mutating L1R and D8L genes by inserting nucleic acid sequences at both ends of L1R and D8L, respectively, wherein the nucleic acid sequences comprise at least one vaccinia virus promoter element, or at least one reporter gene or one resistance gene, and wherein the nucleic acid sequences further comprise one or more exogenous genes other than the reporter gene or the resistance gene.

4. A recombinant vaccinia virus vector according to claim 3 that can escape existing anti-vaccinia virus neutralizing antibodies present in vivo, wherein the vaccinia virus promoter element is P7.5 or PE/L, preferably the sequence of P7.5 is SEQ ID NO. 13 and the sequence of PE/L is SEQ ID NO. 14.

5. The recombinant vaccinia virus vector of claim 4, wherein the reporter gene is a fluorescent protein-encoding gene or a galactosidase-encoding gene that can escape neutralizing antibodies against vaccinia virus present in vivo.

6. The recombinant vaccinia virus vector of claim 5, wherein the nucleic acid sequences at both ends of L1R are respectively L1R-L homologous recombination arm or L1R-R homologous recombination arm, wherein the sequence of L1R-L homologous recombination arm is SEQ ID NO. 1, the sequence of L1R-R homologous recombination arm is SEQ ID NO. 2, the nucleic acid sequences at both ends of D8L are respectively D8L-L homologous recombination arm or D8L-R homologous recombination arm, wherein the sequence of D8L-L homologous recombination arm is SEQ ID NO. 18, and the sequence of D8L-R homologous recombination arm is SEQ ID NO. 19.

7. The recombinant vaccinia virus vector of claim 6, wherein the L1R and D8L knockout recombinant vaccinia virus vector has the nucleic acid sequence of SEQ ID NO 16 between the L1R homology arms and the nucleic acid sequence of SEQ ID NO 28 between the D8L homology arms.

8. A shuttle vector for constructing a recombinant vaccinia virus vector with knockout genes L1R and D8L, wherein the shuttle vector comprises a first shuttle vector and a second shuttle vector, wherein the first shuttle vector comprises an L1R homologous recombination arm sequence, and the second shuttle vector comprises a D8L homologous recombination arm sequence.

9. The shuttle vector for constructing the recombinant vaccinia virus vector with knocked-out genes L1R and D8L as claimed in claim 8, wherein the first shuttle vector comprises homologous recombination arm sequences L1R-L and L1R-R, wherein the homologous recombination arm sequence L1R-L is SEQ ID NO. 1, and the homologous recombination arm sequence L1R-R is SEQ ID NO. 2.

10. The shuttle vector of the constructed recombinant vaccinia virus vector with L1R and D8L knocked-out genes as claimed in claim 8, wherein the second shuttle vector comprises homologous recombination arm sequences of D8L-L and D8L-R, wherein the homologous recombination arm sequence of D8L-L is SEQ ID NO. 18, and the homologous recombination arm sequence of D8L-R is SEQ ID NO. 19.

11. The shuttle vector of the constructed L1R and D8L gene knockout recombinant vaccinia virus vector according to claim 9, wherein the first shuttle vector further comprises a nucleic acid sequence inserted between L1R homologous recombination arm sequences, the nucleic acid sequence comprises at least one vaccinia virus promoter element, or at least one reporter gene or one resistance gene, the nucleic acid sequence further comprises one or more exogenous genes other than the reporter gene or the resistance gene, preferably, the nucleic acid sequence inserted between L1R homologous recombination arm sequences is SEQ ID NO: 16.

12. The shuttle vector of claim 11, wherein a nucleic acid sequence comprising at least one vaccinia virus promoter element, or at least one reporter gene or one resistance gene is inserted between the homologous recombination arm sequences of D8L in the second shuttle vector, and further comprises one or more exogenous genes other than the reporter gene or the resistance gene, preferably the nucleic acid sequence inserted between the homologous recombination arm sequences of D8L is SEQ ID NO. 27.

13. The shuttle vector for constructing recombinant vaccinia virus vector with L1R and D8L gene knockout, according to claim 12, wherein the vaccinia virus promoter element is P7.5 or PE/L, preferably the sequence of P7.5 is SEQ ID NO. 13 and the sequence of PE/L is SEQ ID NO. 14.

14. The shuttle vector of claim 13, wherein the reporter gene is a fluorescent protein-encoding gene or a galactosidase-encoding gene.

15. The shuttle vector of the constructed recombinant vaccinia virus vector with L1R and D8L knocked-out genes as claimed in claim 11, wherein the first shuttle vector is pDeltaL 1R-GFP with sequence SEQ ID NO. 17.

16. The shuttle vector for constructing the recombinant vaccinia virus vector with L1R and D8L knocked-out genes as claimed in claim 12, wherein the second shuttle vector is pDELTA D8L-DsRed with the sequence of SEQ ID NO. 28.

17. A preparation method for constructing recombinant vaccinia virus vector with L1R and D8L gene knockout is characterized by comprising the following steps:

s1, designing primers, and amplifying two homologous recombination arms of L1R by PCR respectively;

s2, inserting the two homologous recombination arms into a target shuttle vector to construct a shuttle vector containing the L1R homologous recombination arm sequence;

s3, transfecting the shuttle vector into a vaccinia virus infected cell;

s4, collecting the recombinant vaccinia virus vector from the cell, and carrying out single-spot purification on a new cell to obtain the recombinant vaccinia virus vector with the L1R gene knocked out;

s5, designing primers, and respectively amplifying two homologous recombination arms of D8L by PCR;

s6, inserting the two homologous recombination arms into a target shuttle vector to construct a shuttle vector containing a D8L homologous recombination arm sequence;

s7, transfecting the shuttle vector into an L1R gene knockout vaccinia virus infected cell;