CN114045288A

CN114045288A - Application of shRNA of targeted knockdown SIRT2 gene and precursor of nicotinamide adenine dinucleotide in preparation of medicines for treating neurodegenerative diseases

Info

Publication number: CN114045288A
Application number: CN202111229433.0A
Authority: CN
Inventors: 赵经纬; 马晓茹; 汪帆; 董昭君; 武洋; 王迪仙
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2021-10-21
Filing date: 2021-10-21
Publication date: 2022-02-15

Abstract

The utility model provides an application of a target knockdown shRNA of SIRT2 gene and a precursor of nicotinamide adenine dinucleotide in the preparation of a medicament for treating neurodegenerative diseases, wherein the precursor of nicotinamide adenine dinucleotide can promote SIRT2 to enter the nucleus of oligodendrocyte precursor cells, thereby promoting the differentiation of the oligodendrocyte precursor cells into mature oligodendrocytes, repairing myelin sheath and further realizing the treatment of demyelinating diseases, and fundamentally playing a role in treating demyelinating diseases; and has good safety, low cost and high patient compliance.

Description

Application of shRNA of targeted knockdown SIRT2 gene and precursor of nicotinamide adenine dinucleotide in preparation of medicines for treating neurodegenerative diseases

Technical Field

The disclosure relates to the technical field of genetic engineering, in particular to application of shRNA of a targeted knockdown SIRT2 gene and a precursor of nicotinamide adenine dinucleotide in preparation of a medicament for treating neurodegenerative diseases.

Background

Demyelination is one of the early events of aging of the nervous system and neurodegenerative diseases such as alzheimer's disease and huntington's disease, etc., and is the characteristic pathological basis for demyelinating diseases of the nervous system such as multiple sclerosis. After 10 to 20 years of central nervous system demyelinating disease, the clinical course of many patients gradually develops, eventually leading to impaired mobility and cognition, severely affecting the quality of life of the patient and even death.

For central nervous system demyelinating diseases, no medicine for effectively promoting myelin repair exists clinically, and the current main treatment method is to give an immunomodulator, wherein the immunomodulator has no effect on repairing myelin although the immunomodulator can slow down the disease process, cannot completely prevent the disease development, and treats the symptoms but not the root cause; in addition, immunomodulators are expensive, increasing patient economic difficulties and reducing patient compliance.

Disclosure of Invention

In view of this, the present disclosure aims to provide an application of shRNA targeting knockdown of SIRT2 gene and a precursor of nicotinamide adenine dinucleotide in preparation of a medicament for treating neurodegenerative diseases.

In view of the above, the first aspect of the present disclosure provides an shRNA targeting knockdown of SIRT2 gene, wherein the nucleotide sequence of the shRNA includes:

shRNA-F：5'—GATCCGGATGAAAGAGAAGATCTTCTTTCAAGAGAAGAAGATCTTCTCTTTCATCCTTTTTG—3'，(SEQ ID NO：1)

shRNA-R：5'—AATTCAAAAAGGATGAAAGAGAAGATCTTCTTCTCTTGAAAGAAGATCTTCTCTTTCATCCG—3'。(SEQ ID NO：2)

based on the same object, the second aspect of the present disclosure also provides the use of a precursor of nicotinamide adenine dinucleotide for the preparation of a medicament for the treatment of neurodegenerative diseases.

Optionally, the precursor of nicotinamide adenine dinucleotide comprises at least one of beta-nicotinamide mononucleotide, nicotinamide and nicotinamide ribose.

Optionally, the medicament for treating a neurodegenerative disease comprises a medicament for treating a demyelinating disease.

Optionally, the agent for treating demyelinating disease comprises an agent that promotes myelin repair.

Optionally, the agent that promotes myelin repair comprises an agent that promotes differentiation of oligodendrocyte precursor cells into mature oligodendrocytes.

Optionally, the agent that promotes differentiation of oligodendrocyte precursor cells into mature oligodendrocytes comprises an agent that promotes entry of SIRT2 into the nucleus of oligodendrocyte precursor cells.

Optionally, the neurodegenerative disease includes multiple sclerosis, alzheimer's disease, parkinson's syndrome, lateral sclerosis of the spinal cord, and huntington's disease.

Optionally, the medicament for treating neurodegenerative disease is a precursor of nicotinamide adenine dinucleotide as the only active ingredient or a pharmaceutical composition containing the precursor of nicotinamide adenine dinucleotide.

Optionally, the medicament for treating neurodegenerative diseases comprises any pharmaceutically acceptable dosage form prepared from pharmaceutically acceptable auxiliary materials; preferably, the medicament for treating neurodegenerative disease comprises at least one of decoction, powder, pill, medicated wine, lozenge, gum, tea, starter, cake, lotion, stick, thread, stick, nail, moxibustion, ointment, pellet, liposome, aerosol, injection, mixture, oral ampoule, tablet, capsule, drop pill, emulsion, membrane and sponge.

From the above, the application of the shRNA of the targeted knockdown SIRT2 gene and the precursor of nicotinamide adenine dinucleotide provided by the disclosure in preparing the medicament for treating the neurodegenerative disease can promote the SIRT2 to enter the nucleus of oligodendrocyte precursor cells, so that the oligodendrocyte precursor cells are promoted to be differentiated into mature oligodendrocytes, and the myelin sheath is repaired to realize the treatment of the demyelinating disease, thereby fundamentally playing a role in treating the demyelinating disease; and has good safety, low cost and high patient compliance.

Drawings

In order to more clearly illustrate the technical solutions in the present disclosure or related technologies, the drawings needed to be used in the description of the embodiments or related technologies are briefly introduced below, and it is obvious that the drawings in the following description are only embodiments of the present disclosure, and for those skilled in the art, other drawings can be obtained according to these drawings without creative efforts.

FIG. 1 is a schematic diagram showing the structure of a local demyelination model of a mouse corpus callosum region;

FIG. 2A shows G3 Terc^-/-Schematic drawing of materials taken 21 days after LPC-induced demyelination after mice injected with PBS or beta-NMN;

FIG. 2B shows G3 Terc^-/-Representative transmission electron microscopy images of the myelin sheath of the callus injury zone after PBS or β -NMN injection in mice;

FIG. 2C shows G3 Terc^-/-Pathological grading statistics of remyelination after mice are injected with PBS or beta-NMN;

FIG. 2D shows G3 Terc^-/-Statistical plots of remyelination axon ratios after mouse injection of PBS or β -NMN;

FIG. 2E is G3 Terc^-/-A graph showing the statistical results of G-Ratio of remyelination after mouse injection of PBS or β -NMN;

FIG. 2F is a statistical plot of the remyelination distance following injection of PBS or β -NMN into G3 Terc-/-mice;

FIG. 3A is a schematic representation of a coronal slice of a brain after demyelination 21d and electrode placement;

FIG. 3B is a diagram showing the compound action potential waveform of a representative callus for each group;

FIG. 3C is a statistical chart of the ratio of the effective recorded brain slices of each group;

FIG. 3D is a statistical plot of the ratio of fast conduction amplitude to slow conduction amplitude;

FIG. 4A shows G3 Terc^-/-Injecting PBS or beta-NMN into the abdominal cavity half an hour before LPC injection or injecting the beta-NMN into the abdominal cavity 3 days after LPC induced demyelination of the mouse, and drawing materials from 21dpl in a process schematic diagram;

FIG. 4B is a representative TEM image of myelin sheath in the callus injury region of mice in the β -NMN treated group and PBS control group;

FIG. 4C is a pathological grading statistic of remyelination in mice in the β -NMN treated group and PBS control group;

FIG. 4D is a statistical plot of the proportion of remyelinated axons in mice in the β -NMN treated group and PBS control group;

FIG. 4E is a graph showing the statistical results of G-Ratio of remyelination in mice in the β -NMN treated group and PBS control group;

FIG. 4F is a statistical plot of the remyelination distance of mice in the β -NMN treated group and PBS control group;

FIG. 5A shows G3 Terc^-/-Representative fluorescence profiles of mouse and WT mouse oligodendrocyte precursor cells differentiated after treatment with DMSO or β -NMN;

FIG. 5B is a statistical plot of the respective representative fluorescence plots of FIG. 5A;

FIG. 6A is a fluorescence plot of the location of SIRT2 cells after DMSO or β -NMN treatment of primary oligodendrocyte precursor cells;

FIG. 6B is a statistical plot of the cellular proportion of SIRT2 nucleated;

FIG. 6C is a statistical plot of the ratio of the fluorescence signal of SIRT2 in cell nuclei to the fluorescence signal of whole cell bodies;

FIG. 6D shows the amount of SIRT2 protein expression and the acetylation level of its deacetylated substrate after Western blot detection of SIRT2 overexpression or knockdown;

FIG. 6E shows wild type mouse oligodendrocyte precursorSomatic cells and G3 Terc^-/-Mouse oligodendrocyte precursor cells and G3 Terc after beta-NMN treatment^-/-mRNA levels of ID4 in mouse oligodendrocyte precursor cells;

FIG. 6F shows wild type mouse and SIRT2^-/-mRNA levels of ID4 in mouse brain tissue;

FIG. 6G is an enrichment of SIRT2 in the ID4 promoter region in the ChIP-qPCR assay DMSO control group and the β -NMN treated group;

FIG. 7A is SIRT2^-/-SIRT2 protein content in mouse and wild type mouse brain tissue;

FIG. 7B is SIRT2^-/-Schematic drawing of the procedure of drawing materials 21 days after injecting LPC-induced demyelination in mice and wild-type mice;

FIG. 7C is SIRT2^-/-Representative transmission electron microscopy pictures of remyelination in mouse and wild type mouse callus injury regions;

FIG. 7D is SIRT2^-/-Pathological grading statistics of mouse and wild mouse remyelination;

FIG. 7E SIRT2^-/-Statistical plots of the proportion of remyelinated axons in mice and wild-type mice;

FIG. 7F is SIRT2^-/-A graph showing the statistical results of G-Ratio of mice and wild type mice;

FIG. 7G is a statistical plot of the myelin sheath spacing of SIRT 2-/-mice and wild type mice.

Detailed Description

For the purpose of promoting a better understanding of the objects, aspects and advantages of the present disclosure, reference is made to the following detailed description taken in conjunction with the accompanying drawings.

It is to be noted that technical terms or scientific terms used in the embodiments of the present disclosure should have a general meaning as understood by those having ordinary skill in the art to which the present disclosure belongs, unless otherwise defined. The use of "first," "second," and similar terms in the embodiments of the disclosure is not intended to indicate any order, quantity, or importance, but rather to distinguish one element from another.

Myelin is a segment-like structure formed by oligodendrocytes, which encapsulates axons to provide nutritional support and protection, and also serves as the structural basis for the abrupt transmission of neural signals. Myelin degeneration caused by the damage of oligodendrocytes is called demyelination. Oligodendrocyte precursor cells can differentiate into mature oligodendrocytes, forming new myelin sheaths around axons, a process known as myelin repair. Myelin repair can extend through the entire life from development, adulthood to aging, being the only regenerative process in the central nervous system that can occur intact.

Central nervous system demyelinating diseases include: demyelination caused by inflammatory lesions of myelin and oligodendrocytes such as multiple sclerosis; genetic factors affecting oligodendrocytes induce impaired myelination such as leukodystrophy. In addition, myelin degeneration can be caused by a variety of causes including aging, autoimmune diseases, ischemia or hypoxia, viral infections, and genetic factors. Demyelination is also one of the early events of aging of the nervous system and neurodegenerative diseases such as alzheimer's disease and huntington's disease, etc., and is the characteristic pathological basis of demyelinating diseases of the nervous system. Demyelinating diseases of the central nervous system present a wide variety of clinical manifestations due to the involvement of demyelinating lesions in the brain area, size and number of lesions, including but not limited to loss of monocular vision due to optic neuritis, loss of limb weakness or sensation due to transverse myelitis, and ataxia due to diplopia or cerebellar lesions due to brainstem dysfunction. Often after 10 to 20 years, the clinical course of many patients develops, eventually leading to impaired mobility and cognition, severely affecting the quality of life of the patient and even leading to death. Therefore, it is of great significance to search for drugs that promote central nervous system myelin repair.

Beta-nicotinamide mononucleotide, nicotinamide and nicotinamide ribose are precursors of nicotinamide adenine dinucleotide, an important intermediate product of cellular energy metabolism, and play a key role in the regulation of many biological processes. To investigate whether precursors of nicotinamide adenine dinucleotide play a role in the differentiation process of demyelination repair, the present disclosure takes β -nicotinamide mononucleotide as an example, and studies were performed on β -nicotinamide mononucleotide that promotes SIRT2 to enter the nucleus of oligodendrocyte precursor cells, β -nicotinamide mononucleotide that promotes differentiation of oligodendrocyte precursor cells, and β -nicotinamide mononucleotide that promotes myelin repair. The following is a detailed description with reference to specific experimental examples.

Examples of the experiments

The wild type mice used in the following experiments were C57BL/6P0-P2 mice and C57BL/6 adult mice, purchased from Shanghai Slek; g3 Terc used^-/-The premature mice, namely third generation telomerase RNA component knockout mice, are mated by heterozygote mice to obtain first generation homozygote mice, then the first generation homozygote mice are mated to obtain second generation homozygotes, and finally the second generation homozygote mice are mated to obtain third generation homozygotes; use of SIRT2^-/-Mice were purchased from Jackson Lab.

The adopted beta-nicotinamide mononucleotide (hereinafter referred to as beta-NMN) is purchased from Pontai bioengineering GmbH, Cathaki 1094-61-7; lysolecithin (hereinafter abbreviated LPC) available from Sigma under cat number L4129; rabbit anti-Olig 2, purchased from Millipore under cat # AB 9610; rat anti-MBP, purchased from Bio-Rad under cat number MCA 409S; rabbit anti-SIRT 2, purchased from Sigma, cat # S8447; donkey anti-rabbit 488 from Jackson ImmunoResearch, cat # 711-545-; donkey anti-rat-Cy 3, purchased from Jackson ImmunoResearch, cat # 712-; donkey anti-rabbit-Cy 3, purchased from Jackson ImmunoResearch, cat # 711-; rabbit anti-H3K 18Ac, available from Active motif, cat No. 39693; rabbit anti-H3, purchased from Abcam, cat # ab 1791; mouse anti-beta-actin, purchased from Sigma, cat # a 5441; donkey anti-rabbit-HRP purchased from Jackson ImmunoResearch, cat 711-; donkey anti-mouse-HRP purchased from Jackson ImmunoResearch, cat # 715-; murine resistance flag, purchased from MBL, cat # M185-3L; murine IgG, purchased from Beyotime, cat # A7028.

1. Experimental methods

1.1 culture of Primary oligodendrocyte precursor cells

Two culture media are adopted in the culture process: the first culture medium is DMEM/F12+ 10% fetal calf serum + 1% penicillin/streptomycin; and the second culture medium includes Neurobasal + B27+ N2+ 1% penicillin/streptomycin. The components of the culture medium are purchased from Gbico, and the product numbers are respectively as follows: DMEM/F12(11320082), fetal bovine serum (10099141), penicillin/streptomycin (15140163), Neurobasal (21103049), B27(17504044), N2 (17502001).

The culture process is as follows: spraying alcohol to the whole body of the mouse, and cutting off the neck; cutting skin with surgical scissors, cutting along the middle suture of skull to form a small opening on each of the left and right sides, peeling off brain shell with curved forceps, taking out whole brain, and placing into precooled HBSS (Gbico, 14025092); removing the brain stem part, clamping the left hemisphere and the right hemisphere of the brain, peeling off the meninges, keeping the ventral side upward, removing the hippocampus and the nucleus, only keeping the cortex, and removing the obvious bleeding point; placing the tissue into a preheated culture medium I, clamping the tissue into fragments by using forceps, and then slowly blowing the fragments by using a 1mL gun head until no macroscopic tissue block exists; adding to 75cm of polylysine precoated²In the culture bottle, supplementing the culture medium to 10mL, and starting culture; changing the liquid every two days after the third day, and collecting cells at the tenth day; tightening the culture bottle, sealing with a sealing film, and shaking on a shaker at 37 deg.C and 100rpm for 1 h; sucking out the culture medium, changing the culture medium I, and continuously shaking at 37 ℃ and 250rpm for 12-18 hours on a shaker; the following morning, aspirate the medium to a 10cm petri dish (no coating required) and stand at 37 ℃ for 30 minutes; transferring the culture medium to a 15mL centrifuge tube, centrifuging at 1000rpm for 3-4 minutes, and discarding the supernatant; the first suspension of the culture medium (the specific volume depends on the cell amount) is added to a six-well plate or a small glass plate pre-coated with polylysine, and the culture medium is changed after 3-4 hours of culture at 37 ℃, and the subsequent experiment can be carried out the next day.

1.2 construction of demyelination model mice

LPC is injected into a mouse callus area to construct a local demyelination model, and the specific operation method is as follows:

10mg LPC was dissolved in 1mL PBS, sonicated to complete dissolution and the solution clarified.

Injecting sodium pentobarbital (30mg/kg) into the abdominal cavity of the mouse for anesthesia; the head of the mouse is fixed on a brain stereotaxic apparatus, the front and back effects are horizontal, and the head is lightly pressed to ensure that the mouse does not shake; the penicillin eye ointment is smeared on the eyes of the mouse to prevent the eyes from being injured by light irradiation; disinfecting the head with iodine tincture, and shaving hair; cutting the skin of the head to expose the skull, wiping with 10% hydrogen peroxide solution, and exposing bregma; positioning to 0.5mm in front of bregma, and drilling with drill bit, wherein the hole should not be too large; sucking 3 mu L LPC by a micro injection needle, slowly descending to the surface of the brain, marking down a scale, and slowly rotating downwards to a position 2.0mm below the surface of the brain; LPC was injected at a rate of 2. mu.L/10 min, 2. mu.L per mouse; after the injection is finished, slowly pulling out the needle after the needle is left for 10min, and pulling out the needle after 5 min; the skin of the head was sutured, the mouse was removed from the locator and placed on the heat pad, and returned to the mouse cage after the anesthetic was removed. Perfusing after 21 days, wherein the perfusion method comprises the following steps: the method comprises the steps of firstly, injecting sodium pentobarbital (30mg/kg) into the abdominal cavity of a mouse for anesthesia, perfusing and removing blood by PBS (phosphate buffer solution) precooled at 4 ℃, perfusing and fixing by 4% glutaraldehyde heart precooled at 4 ℃ for 5-8 minutes, then taking the brain tissue of the mouse, and fixing for at least one week in 4% glutaraldehyde at 4 ℃.

After perfusion, a transmission electron microscope sample is prepared, and the preparation process is as follows: first dissect a target tissue mass, about 1mm³Fixation in 4% glutaraldehyde at 4 ℃ overnight; rinsing with 0.1M sodium arsenate buffer solution for 10min for 3 times, and performing on ice (0.1M sodium arsenate buffer solution: solution A: 4.28g sodium arsenate dissolved in 100mL ddH)₂O is in; and B, liquid B: 0.88mL of HCl was added to 50mL of ddH₂And (4) in O. 100mL of solution A and 5.4mL of solution B were added to 80mL of ddH₂In O, the osmotic pressure is adjusted to 300 with sucrose, ddH₂O is metered to 200 mL); then fixed with 2% osmic acid on ice for 1h, followed by ddH₂Rinsing for 4 times (5 min each time) with O; fixing with 2% uranyl acetate at room temperature for 1 hr, and adding ddH₂Rinsing for 4 times (5 min each time) with O; then dehydrating the sample with acetone with gradient concentration (50%, 70%, 90%, 95%) for 10min each time, and dehydrating with 100% acetone for 3 times, 20min each time; then, the mixture of embedding medium and acetone (v/v: 1/3, 1/1, 3/1) was used for each siteArranging for 2h, embedding in a pure embedding medium overnight, replacing the pure embedding medium once the next day, and embedding for 2 h; then transferring the sample to a sample table with pure embedding medium, polymerizing for 12h at 45 ℃, then polymerizing for 48-72h at 65 ℃, and slicing in an LEICA EM UC7 ultrathin slicer after the sample is polymerized to obtain a 60-90nm slice; the sections were stained in saturated solutions of lead citrate and uranyl acetate for 5min and photographed under a Tecnai G2 Spirit 120KV electron microscope.

Myelin sheath was observed under electron microscopy and the results are shown in figure 1: normal myelinated axons are tightly packed with myelin, demyelinated axons are bared, remyelinated axons are re-packed with myelin, but myelin becomes thinner.

1.3 construction of SIRT2 overexpression Stable transformants and SIRT2 knock-down Stable transformants

1.3.1 construction of SIRT2 overexpression vector and SIRT2 knock-down vector

The plasmid used for constructing the SIRT2 overexpression vector is pCDH-CMV-EF1 alpha-MCS-flag-P2A-copGFP, the SIRT2 gene is inserted into a multiple cloning site, and the expression of SIRT2 is jointly started by CMV and EF1 alpha promoters.

The specific process is as follows: obtaining a SIRT2 full-length product by adopting high-fidelity enzyme PCR; then carrying out DNA electrophoresis, and cutting off a target band in a gel imager; using a general DNA purification recovery kit to carry out gel recovery; the SIRT2 DNA recovered from 2. mu.g of plasmid and gel was double digested with restriction enzymes Xba I and BsiW I at 37 ℃ for 30 min; after DNA electrophoresis gel cutting, using a general DNA purification recovery kit to recover the gel; the obtained linearized plasmid and the SIRT2 fragment are recovered, and are connected for 2 hours at room temperature by ligase according to the molar mass ratio of 1: 1; the ligation product was competently mixed with 50. mu.L of E.coli, incubated on ice for 30min, heat-shocked at 42 ℃ for 90s, and incubated on ice for 3 min; adding 1mL LB culture medium, and resuscitating on a shaker at 37 ℃ and 250rpm for 1 h; centrifuging the bacterial liquid, resuspending 200 mul of culture medium, and coating 100 mul of bacterial liquid on a bacterial culture plate containing ampicillin resistance for overnight culture; picking single colony for sequencing on the next day; partially preserving the strains of the bacteria with correct sequencing, and partially carrying out amplification culture and shaking overnight; centrifuging overnight-cultured bacterial liquid at 4 ℃ and 3000rpm for 10min, and extracting plasmids by using an endotoxin-free plasmid extraction kit to obtain the SIRT2 overexpression vector.

The plasmid used for constructing the SIRT2 knock-down vector is pGreenPuro, and the shRNA forward and reverse primer sequences are annealed to form double chains and then inserted into pGreenPuro plasmid. Wherein, shRNA sequence is designed aiming at SIRT2 gene, and shRNA is designed through Thermo Fisher website (https:// rnaidesigner. thermofisher. com/rnaiexpress /). The nucleotide sequence of the shRNA includes:

shRNA-F: 5 '-GATCCGGATGAAAGAGAAGATCTTCTTTCAAGAGAAGAAGATCTTCTCTTTCATCCTTTTTG-3' (shown in SEQ ID NO: 1),

shRNA-R: 5 '-AATTCAAAAAGGATGAAAGAGAAGATCTTCTTCTCTTGAAAGAAGATCTTCTCTTTCATCCG-3' (shown in SEQ ID NO: 2).

The specific construction process of the SIRT2 knock-down vector comprises the following steps: and (3) adding 1 mu L of forward and reverse primers of 20 mu M shRNA into 18 mu L ddH2O respectively, putting the mixture into a PCR instrument, reacting for 2min at 98 ℃, then turning off the PCR instrument, slowly cooling and annealing, and taking out after about 2 h. Carrying out double enzyme digestion on 2 mu g of pGreenPuro plasmid by using restriction enzymes BamH I and EcoRI at 37 ℃ for 30 min; cutting gel after electrophoresis, and recovering the gel by using a universal DNA purification recovery kit; connecting 1 mu L of annealing product and linearized plasmid for 2h at room temperature; and the subsequent processes of connecting product transformation, sequencing and plasmid extraction are the same as the construction process of the SIRT2 overexpression vector, so that the SIRT2 knock-down vector is obtained.

1.3.2 construction of Stable transformants

HEK293T cells are used as host cells to coat lentiviruses; the specific process is as follows: culturing HEK293T cells with a DMEM medium containing 10% fetal calf serum, changing the culture medium into a serum-free DMEM medium when the cell confluency reaches 80%, and transfecting after 2 hours; mixing a SIRT2 overexpression vector or a SIRT2 knock-down vector with psPAX2 and pMD2.G according to the proportion of 4:3:1 and the total amount of 8 mu g, adding the mixture into 1mL opti-MEM, adding 16 mu L of 1mg/mL PEI after uniformly mixing, gently mixing the mixture uniformly, standing the mixture at room temperature for 5min, slowly dripping the mixture into cells, uniformly mixing the mixture and putting the mixture into a cell culture box; after 8h of transfection, the medium is changed into a DMEM medium containing 10% fetal calf serum, and the culture is continued for 36-48 h; cells were observed under a fluorescence microscope, at which time 90% or more of the cells were fluorescent, and the cell culture medium was filtered through a 0.22 μm filter, and the filtrate, which contained lentivirus, was collected. In practical applications, the filtrate is stored at 4 ℃ if it is used within one week and at-80 ℃ if it is used after one week.

Planting OLN93 cells into a 6-well plate at a density of 5x 10 a5 cells per well, culturing for 12h, and replacing the culture medium with the collected filtrate containing lentivirus when the cell confluence reaches about 80%; after the lentivirus is infected for 36-48h, observing the infection efficiency under a fluorescence microscope; digesting the cells by pancreatin, diluting the cells to 10/mL in a gradient manner, and adding the diluted cells into a 96-well plate, wherein each well is 100 mu L; after the cells adhere to the wall, observing and marking holes with single cells and fluorescence under a microscope; after 14 days of culture, digesting the cells forming the monoclone in the marked hole for expanding culture to obtain a SIRT2 overexpression stable transgenic cell strain and a SIRT2 knock-down stable transgenic cell strain.

1.4 Effect of Long term supplementation of beta-NMN on myelin repair in demyelinated mice

G3 Terc of 3 months old^-/-Injecting beta-NMN into the abdominal cavity of the mouse as a beta-NMN treatment group, wherein the administration mode is as follows: dissolving beta-NMN in water, and performing intraperitoneal injection every day for 3 months at a dose of 10mg/kg body weight; g3 Terc of 3 months old^-/-Mice were injected intraperitoneally with PBS as a PBS control group in the following manner: daily intraperitoneal injection is carried out for 3 months, and the dosage is 10mg/kg body weight.

After 3 months, injecting LPC demyelination, performing demyelination by the same method as that in 1.2, and after 21 days, perfusing and preparing a transmission electron microscope sample by the same method as that in 1.2, observing the myelin restoration efficiency of the damaged area by an electron microscope, wherein the results are shown in figures 2A-2E, and the results show that G3 Terc is obtained after the beta-NMN is supplemented^-/-The mouse callus area had decreased bare axons (fig. 2B), and statistics also showed a doubling of the proportion of remyelinated axons (fig. 2D); of the newly formed myelin sheaths, the proportion of normal myelin sheaths increased significantly and the proportion of grade 2 myelin sheaths decreased (fig. 2C); statistics of G-Ratio showed a significant increase in the thickness of newly formed myelin sheaths (FIG. 2E); the interlamellar spacing of the nascent myelin sheath decreased significantly (fig. 2F). The results of fig. 2B-2F show that long-term in vivo supplementation of β -NMN can improve the repair efficiency of premature aging mice after myelin sheath injury.

1.5 Effect of Long-term supplementation of beta-NMN on the function of Electrical Signal transduction in the lesion area of the corpus callosum

Wild type light mouse and wild type aged mouse are used as blank control group, and 3-month-old G3 Terc is added^-/-Injecting beta-NMN into the abdominal cavity of the mouse as a beta-NMN treatment group, wherein the administration mode is as follows: dissolving beta-NMN in water, and performing intraperitoneal injection every day for 3 months at a dose of 10mg/kg body weight; g3 Terc of 3 months old^-/-Mice were injected intraperitoneally with PBS as a PBS control group in the following manner: daily intraperitoneal injection is carried out for 3 months, and the dosage is 10mg/kg body weight.

Injecting LPC demyelination after 3 months, wherein the demyelination method is the same as that of 1.2, and after 21 days, injecting sodium pentobarbital (30mg/kg) into the abdominal cavity of a mouse for anesthesia, and taking brain tissues; brain tissue was transferred to pre-cooled slice buffer and kept open to 95% O₂And 5% CO₂A gas; performing coronal section on a shaking microtome with a thickness of 250 μm; taking 4 brain slices before and after the demyelination position (bregma-1.0mm), and incubating for 1h in artificial cerebrospinal fluid at 34.5 ℃; then, the brain slices are transferred to room temperature, placed in a recording tank, and start recording after balancing for half an hour; the room temperature is adjusted to 21.5 ℃; the stimulating electrode uses a tungsten electrode, the recording electrode uses a glass electrode (1-3M omega), the stimulating pulse is 0.1ms, and the current intensity is 1 mA; the evoked compound action potentials were recorded and analyzed offline by Spike2 software. In data analysis, 100 replicates are recorded for waveform analysis on average, the conduction velocity is estimated by dividing the distance difference between two stimulation sites and the recording electrode by the time difference, and the amplitude is the vertical distance from the peak value of two depolarization phases to the front and back phase tangency points of the positive electrode.

Wherein, the section buffer solution includes: 2.5mM KCl, 1.25mM NaH₂PO₄、26mM NaHCO₃、10mM Dextrose、213mM Sucrose、2mM MgSO₄And 2mM CaCl₂(ii) a The artificial cerebrospinal fluid comprises: 126mM NaCl, 2.5mM KCl, 1.25mM NaH₂PO₄、26mM NaHCO₃、25mM Dextrose、2mM MgSO₄And 2mM CaCl₂315-325 mOsm, and the pH of the artificial cerebrospinal fluid is 7.2-7.3.

Fig. 3A is a schematic representation of a coronal slice of the brain after demyelination 21d and electrode placement, with a tungsten stimulating electrode on the left and a glass recording electrode on the right, and a coronal slice thickness of 250 μm.

The results of the compound action potentials of the calluses of the mice in each group are shown in FIGS. 3B-3D, and the results show that the waveforms of the compound action potentials of the calluses of the mice in each group have two phases, the first phase is a fast-conducting axon wrapped by myelin sheath, and the second phase is a slow-conducting naked axon not wrapped by myelin sheath (FIG. 3B); wild type naive mice and beta-NMN treated G3 Terc^-/-More than 90% of the brain discs of the mice recorded electrical signals, while wild-type aged mice and PBS-treated G3 Terc^-/-Mice were shown to record less than 50% of the brain slices with electrical signals (fig. 3C); PBS treated G3 Terc^-/-The amplitude ratio of the fast-conducting phase to the slow-conducting phase of the mice is significantly reduced compared with wild-type annual light mice, and is significantly increased after beta-NMN supplementation, even exceeding that of wild-type annual light mice (figure 3D); wherein the ratio of the amplitudes of the fast-conducting phase and the slow-conducting phase is the ratio of the number of myelinated axons to the number of unmyelinated axons. The results in FIGS. 3B-3D show that long-term β -NMN supplementation in vivo can functionally promote signaling in the corpus callosum.

1.6 Effect of supplementation of beta-NMN at or after injury on myelin repair in demyelinated mice

As shown in fig. 4A, in pair G3 Terc^-/-Half an hour before injecting LPC into the abdominal cavity of a mouse or 3 days after injecting LPC into the abdominal cavity of the mouse, respectively injecting beta-NMN into the abdominal cavity to be used as a beta-NMN treatment group, G3 Terc is treated^-/-Injecting PBS to the abdominal cavity half an hour before injecting LPC to the abdominal cavity of the mouse to be used as a PBS control group; mice of the beta-NMN treatment group and the PBS control group are respectively perfused and transmission electron microscope samples are prepared by the same method as that in 1.2, the myelination recovery efficiency of the damaged area is observed by an electron microscope, the result is shown in figures 4B-4F, the upper picture scale in figure 4B is 2 microns, and the lower picture scale is 200 nm; the results in the figure show that, when the injury is at the time or after the injury is completed, the number of naked axons in the callus area is obviously reduced and the myelin structure is obviously improved (FIG. 4B); the proportion of newly formed myelin sheaths increased after β -NMN supplementation (fig. 4D); the proportion of normal myelin in neonatal myelin was significantly increased and the proportion of grade 1 myelin was decreased (fig. 4C); the statistical results of G-Ratio show that the thickness of newly formed myelin sheaths is also clearSignificantly increased (FIG. 4E); the interlamellar spacing of the nascent myelin sheath decreased significantly (fig. 4F). The results in FIGS. 4B-4F show that β -NMN supplementation during or after myelin sheath damage can increase the repair efficiency after myelin sheath damage.

1.7 Effect of beta-NMN on oligodendrocyte precursor cell differentiation

Wild type mice and G3 Terc were cultured separately^-/-Oligodendrocyte precursor cells of the mouse are cultured by the same method as 1.1; for wild type mice and G3 Terc after culture^-/-The oligodendrocyte precursor cells of the mice are respectively treated by beta-NMN to be used as a beta-NMN treatment group, the administration concentration of the beta-NMN is 1mM, and the treatment time is 48 hours; for wild type mice and G3 Terc after culture^-/-The oligodendrocyte precursor cells of the mice were treated with DMSO at the same volume as β -NMN for 48 hours as a DMSO treatment group, respectively.

After the treatment is finished, the oligodendrocyte precursor cells of each group of mice are respectively displayed by adopting an immunofluorescence staining method, and the immunofluorescence detection method comprises the following steps: wild type mice will be cultured with G3 Terc^-/-Fixing mouse oligodendrocyte precursor cells in 4% paraformaldehyde for 10min, washing with PBS for 3 times, and blocking in 5% donkey serum containing 0.3% Triton X-100 for 1 h; diluting rabbit anti-Olig 2 and rat anti-MBP with 2.5% donkey serum according to the ratio of 1:200 and 1:500 respectively, incubating for 4 hours at room temperature, and washing with PBS 3 times; then, donkey anti-rabbit-488 and donkey anti-rat-Cy 3 are added dropwise to incubate for 1h at room temperature, wherein donkey anti-rabbit-488 and donkey anti-rat-Cy 3 are respectively diluted with 2.5% donkey serum according to the proportion of 1:400, and washed for 3 times by PBS after incubation; then staining cell nuclei with DAPI for 10min, washing with PBS for 3 times; and (6) sealing and observing.

The results are shown in FIGS. 5A-5B, which show that after β -NMN supplementation, wild-type mice and G3 Terc^-/-The mice had increased numbers of differentiated and mature oligodendrocytes (FIG. 5A), and statistical results also showed wild type and G3 Terc^-/-Differentiation efficiency of mouse oligodendrocyte precursor cells was significantly increased (fig. 5B).

1.8 location detection of SIRT2 in oligodendrocyte precursor cells

Culturing primary oligodendrocyte precursor cells of a wild-type mouse by the same culture method as 1.1, treating the primary oligodendrocyte precursor cells of the wild-type mouse by beta-NMN to serve as a beta-NMN treatment group, wherein the administration concentration of the beta-NMN is 1mM, and the treatment time is 48 hours; treating primary oligodendrocyte precursor cells of a wild-type mouse by using DMSO (dimethyl sulfoxide) as a DMSO control group, wherein the administration volume of the DMSO is the same as that of beta-NMN, and the treatment time is 48 hours; then, carrying out location by using SIRT2 in the primary oligodendrocyte precursor cells in an immunofluorescence detection experimental group and a control group; the immunofluorescence detection method comprises the following steps: fixing primary oligodendrocyte precursor cells in 4% paraformaldehyde for 10min, washing with PBS for 3 times, and then blocking in 5% donkey serum containing 0.3% Triton X-100 for 1 h; diluting rabbit anti-SIRT 2 and 2.5% donkey serum according to the proportion of 1:200, incubating for 4 hours at room temperature, and washing for 3 times by PBS; then donkey anti-rabbit-Cy 3 is added dropwise to incubate for 1h at room temperature, wherein donkey anti-rabbit-Cy 3 and 2.5% donkey serum are diluted according to the proportion of 1:400, and washed for 3 times by PBS after incubation; then staining cell nuclei with DAPI for 10min, washing with PBS for 3 times; and (6) sealing and observing.

The immunofluorescence assay results for the β -NMN treated and DMSO control groups are shown in fig. 6A, where fig. 6A shows the intracellular SIRT2 mapping after treatment of primary oligodendrocyte precursor cells with DMSO or β -NMN, with the rightmost side of the plot being an enlarged view of the box labeled in the left-hand plot. Statistical graphs of the cell proportion of SIRT2 entering the nucleus are shown in fig. 6B, from which it can be seen that the proportion of SIRT2 entering the nucleus of primary oligodendrocyte precursor cells in the DMSO-treated control group was 9%, while the proportion of SIRT2 entering the nucleus of primary oligodendrocyte precursor cells in the β -NMN-treated experimental group was 22%. The statistical results of the ratio of the fluorescence signal of SIRT2 in the nucleus to the fluorescence signal of the whole cell body are shown in FIG. 2C, and it can be seen from the results in the figure that the ratio of the fluorescence signal of SIRT2 in the nucleus of the primary oligodendrocyte precursor cells in the beta-NMN treated experimental group to the fluorescence signal of the whole cell body is also obviously increased.

The results of fig. 6A, 6B, and 6C demonstrate that β -NMN can promote SIRT2 entry into the nucleus of oligodendrocyte precursor cells.

The construction method of the stable transgenic cell strain of the plasmid pCDH-CMV-EF1 alpha-MCS-flag-P2A-copGFP as a control empty vector is the same as that of a SIRT2 overexpression stable transgenic strain or a SIRT2 knock-down stable transgenic strain. Then carrying out Western blot experiments on the SIRT2 overexpression stable transgenic strain, the SIRT2 knockdown stable transgenic strain and the control empty vector stable transgenic strain, wherein the experimental processes are as follows: adding lysis solution into each stable transformant, homogenizing, standing on ice for 30min until cells are completely lysed, centrifuging at 4 ℃ and 1000g for 5min, and taking protein supernatant; adding 5X Loading Buffer into the protein sample, and performing denaturation for 5min by using a 95-degree metal bath. Electrophoresis sample loading of 20 μ g, 200V electrophoresis for 60 min; soaking the PVDF film in methanol for 30s, then transferring the film, placing the protein glue on the negative electrode, placing the PVDF film on the positive electrode, transferring the film after assembling, and performing 300mA for 75 min; after the membrane transfer is finished, taking out the membrane, sealing the membrane in 5% skimmed milk for 2H, and then respectively incubating the membrane in rabbit anti-SIRT 2, rabbit anti-H3K 18Ac and rabbit anti-H3 at 4 ℃ overnight, wherein the rabbit anti-SIRT 2, the rabbit anti-H3K 18Ac and the rabbit anti-H3 are respectively diluted with TBST according to the proportion of 1:1000, and washing the membrane with TBST for 3 times after incubation, wherein each time lasts for 5 min; then incubating for 2h in donkey anti-rabbit-HRP at 4 ℃, wherein the donkey anti-rabbit-HRP and TBST are diluted according to the proportion of 1:10000, and washing for 3 times with TBST after incubation, wherein each time lasts for 5 min; ECL developer is dripped on the film and developed in a chemiluminescence imager.

The result of the Western blot experiment is shown in FIG. 6D, wherein ctrl-flag indicates a control empty vector stable transformant group, SIRT2-flag indicates a SIRT2 overexpression stable transformant group, and shSIRT2 indicates a SIRT2 knock-down stable transformant group; the results in the figure show that the acetylation level of H3K18 was down-regulated after SIRT2 overexpression and significantly up-regulated after SIRT2 knockdown, compared to the control empty vector stable transformant group, and thus it can be determined that the histone deacetylation site of SIRT2 in oligodendrocyte precursor cells was H3K 18.

Cultivation of G3 Terc^-/-Oligodendrocyte precursor cells of mouse and wild-type mouse were cultured in the same manner as in 1.1, and G3 Terc was treated with beta-NMN^-/-Mouse oligodendrocyte precursor cells, beta-NMN was administered at a concentration of 1mM for 48 hours, and then G3 Terc was treated with RT-PCR to detect beta-NMN^-/-Oligodendrocyte precursor cells of mouse, untreated G3 Terc^-/-Oligodendrocyte precursor cells of mouse and wild-type mouseThe mRNA level of oligodendrocyte precursor cell differentiation inhibitory factor ID 4; wherein the names of primers adopted by RT-PCR detection are ID 4-F: 5 '-GCTGGAGACTCACCCTGCTTTG-3' (shown in SEQ ID NO: 3), and ID 4-R: 5 '-TGCTGTCACCCTGCTTGTTCAC-3' (shown in SEQ ID NO: 4); the detection process of RT-PCR is as follows: firstly, RNA is extracted by using an RNA extraction kit, then 1 mu g of RNA is taken to be reversely transcribed into cDNA, and a PCR system is as follows:

the PCR procedure was: 95 ℃ for 30 seconds; 95 degrees, 5 seconds, 60 degrees, 30 seconds, 40 cycles.

Wild type mouse oligodendrocyte precursor cells and G3 Terc^-/-Mouse oligodendrocyte precursor cells and G3 Terc after beta-NMN treatment^-/-The results of the mRNA level detection of ID4 in mouse oligodendrocyte precursor cells are shown in FIG. 6E, which shows that in untreated G3 Terc^-/-The transcription of oligodendrocyte precursor cell differentiation inhibitory factor ID4 in mouse oligodendrocyte precursor cells is obviously higher than that of wild-type mice, and G3 Terc after beta-NMN treatment^-/-The transcription of oligodendrocyte precursor cell differentiation inhibitory factor ID4 was significantly down-regulated in mouse oligodendrocyte precursor cells.

Detection of SIRT2 by RT-PCR^-/-The mRNA level of ID4 in mouse brain tissue and wild-type mouse brain tissue is shown in FIG. 6F, which shows SIRT2^-/-mRNA levels of ID4 in mouse brain tissue were significantly upregulated compared to mRNA levels of ID4 in wild-type mouse brain tissue.

Treating the SIRT2 overexpression stable transformant by adopting beta-NMN as a beta-NMN treatment group, wherein the administration concentration of the beta-NMN is 1mM, the treatment time is 48 hours, treating the SIRT2 overexpression stable transformant by adopting DMSO as a DMSO control group, wherein the administration volume of the DMSO is the same as that of the beta-NMN, the treatment time is 48 hours, and then detecting the enrichment of the SIRT2 in the ID4 promoter region in the beta-NMN treatment group and the DMSO control group by adopting chromatin co-immunoprecipitation combined with quantitative PCR (ChIP-qPCR); the primer names adopted by the ChIP-qPCR detection are respectively ChIP-ID 4-F: 5 '-TGGCACTGTCCTCCTGATTG-3' (shown in SEQ ID NO: 5), and ChIP-ID 4-R: 5 '-CCCTCAAAGTAACGACTTCCAA-3' (shown in SEQ ID NO: 6)

The detection process of ChIP-qPCR is as follows: respectively paving the beta-NMN treatment group cells and the DMSO control group cells into 3 cell culture dishes of 10cm, culturing the cells until the confluence degree is 80-90%, and changing the culture solution into 10mL of fresh culture medium; dripping 270 mu L of 37 percent formaldehyde into each culture dish till the final concentration is 1 percent, and shaking at low speed for 10min at room temperature for crosslinking; dripping 500 μ L2.5M glycine into each culture dish, and shaking at low speed for 5min at room temperature to terminate crosslinking; discard the medium and wash 3 times with 2mL of pre-cooled PBS; adding 1mL of pancreatin into each culture dish, digesting at 37 ℃ for 5min, and stopping digestion by using a culture medium containing serum; centrifuging the digested cells at 4 ℃ and 3000rpm for 5min, and removing the supernatant; washing with 1mL precooled PBS for 1 time, and centrifuging at 4 ℃ and 3000rpm for 5 min; discarding the supernatant, lysing with 500. mu.L of cell lysate (50 mM Tris-HCl + 0.5% SDS +5mM EDTA, pH7.5, adding protease inhibitor before use), centrifuging briefly after 5min at 4 ℃; the DNA is broken by ultrasonic, and the ultrasonic conditions are as follows: performing ultrasonic treatment for 0.5s and 0.5s at 10% power for 25min (the ultrasonic condition needs preliminary experiment search in the early stage, and the finally obtained DNA fragment is 100bp-300 bp); centrifuging at 12000rpm at 4 deg.C for 10min to obtain supernatant; adding 5 mu g of mouse anti-flag or mouse IgG, and turning over at 4 ℃ overnight; the next day, 50. mu.L of agarose beads were taken, 1mL of blocking solution (10 mM Tris-HCl +1mM EDTA + 1% BSA, pH 8.0) was added, the mixture was spun at 4 ℃ for 10min, centrifuged at 4 ℃ at 3000rpm for 2min, and the supernatant was discarded; adding 1mL of confining liquid again, rotating at 4 ℃ for 10min, centrifuging at 4 ℃ and 3000rpm for 2min, discarding the supernatant, and resuspending with 50 μ L of cell lysate; taking out overnight-transferred sample, taking 1% as Input, storing at-20 ℃, centrifuging the rest samples at 4 ℃ and 12000rpm for 10min, taking supernatant, adding into the sealed beads, and transferring for 2h at 4 ℃; centrifuging at 4 deg.C and 3000rpm for 2min, and removing supernatant; the beads were washed with Wash I (20 mM Tris-HCl +150mM NaCl +2mM EDTA + 1% Triton X-100+ 1% SDS at pH 8.0), Wash II (20 mM Tris-HCl +500mM NaCl +2mM EDTA + 1% Triton X-100+ 0.1% SDS at pH 8.0), Wash III (10 mM Tris-HCl +0.25M LiCl +1mM EDTA + 1% NP-40 at pH 8.0), TE buffer (10 mM Tris-HCl +1mM EDTA at pH 8.0), TE buffer, respectively. Each washing is carried out at 4 deg.C for 15min, and centrifugation is carried out at 4 deg.C and 3000rpm2min, discarding the supernatant; using 100. mu.L of an eluate containing proteinase K (0.1M NaHCO)₃+ 0.1% SDS), rotating at room temperature for 10min, centrifuging at room temperature at 3000rpm for 2min, and collecting the supernatant; resuspending the beads with 100. mu.L of an eluent containing proteinase K, rotating at room temperature for 10min, centrifuging at room temperature 3000rpm for 2min, collecting the supernatant, and combining with the previous tube; taking out an Input sample, unfreezing the Input sample at room temperature, and adding 200 mu L of eluent containing proteinase K; all samples were de-crosslinked overnight in a 65 ℃ water bath; centrifuging at 12000rpm for 10min at room temperature, and collecting supernatant; purification was performed using a DNA purification kit. After purification, a quantitative PCR method is adopted for detection, and a PCR system is as follows:

The detection result of ChIP-qPCR is shown in FIG. 6G, and the results show that the SIRT2 overexpression stable transformant cells of the beta-NMN treatment group have obviously increased SIRT2 and ID4 promoter region DNA combination compared with the DMSO control group.

From fig. 6A-6G, it was confirmed that β -NMN could promote nuclear entry of SIRT2, nuclear deacetylation of H3K18 by SIRT2 in oligodendrocyte precursor cells, further inhibit transcription of ID4, and finally promote differentiation of oligodendrocyte precursor cells.

1.9 Effect of SIRT2 on myelin repair

Detection of SIRT2 by Western blot^-/-The content of the SIRT2 protein in brain tissues of a mouse and a wild mouse is basically the same as that in the method 1.4, and the Western blot detection method is different in that the adopted primary antibodies are rabbit anti-SIRT 2 and mouse anti-beta-actin, the rabbit anti-SIRT 2 and TBST are diluted according to the proportion of 1:1000, the mouse anti-beta-actin and TBST are diluted according to the proportion of 1:10000, the adopted secondary antibodies are donkey anti-rabbit-HRP and donkey anti-mouse-HRP, and the donkey anti-rabbit-HRP and donkey anti-mouse-HRP are respectively diluted with TBST according to the proportion of 1: 10000; the Western blot detection result is shown in FIG. 7A, which shows that SIRT2^-/-No SIRT2 protein is detected in the mouse brain tissue, which indicates SIRT2^-/-MouseThe SIRT2 gene in (1) is knocked out.

Wild type mice and SIRT2 ^-/-21 days after mice are respectively injected with LPC induced demyelination, as shown in FIG. 7B, mice are perfused and prepared with a transmission electron microscope sample by the same method as in 1.2, and the transmission electron microscope sample is observed by an electron microscope, and the results are shown in FIGS. 7C-7G, wherein the results show that after SIRT2 knockout, the proportion of newly born myelin sheaths is obviously reduced, and the structure is deteriorated (FIG. 7C); the proportion of new myelin sheaths in the corpus callosum of the SIRT2 knockout mouse is obviously reduced (FIG. 7E); the proportion of normal myelin in neonatal myelin was significantly reduced, with loose myelin of

grade

1 and 2 being significantly upregulated (fig. 7D); statistics of G-Ratio showed that the thickness of the newly formed myelin sheath was also significantly reduced (FIG. 7F); the interlamellar spacing of the nascent myelin sheaths was significantly increased (fig. 7G). The results in FIGS. 7C-7G demonstrate a significant decrease in myelin repair following SIRT2 knockdown, SIRT2 being essential for myelin repair.

The application of the shRNA and the beta-nicotinamide mononucleotide of the targeted knockdown SIRT2 gene in the preparation of the medicine for treating the neurodegenerative diseases, provided by the disclosure, the beta-nicotinamide mononucleotide can promote SIRT2 to enter into the nucleus of oligodendrocyte precursor cells, so that the oligodendrocyte precursor cells are promoted to be differentiated into mature oligodendrocytes, myelin sheaths are repaired, and then the treatment of demyelinating diseases is realized, and the effect of treating the demyelinating diseases is fundamentally realized; and the medicine is safe to take, the cost is reduced, and the compliance of patients is high.

It should be noted that the embodiments of the present disclosure can be further described in the following ways:

an shRNA targeting a knockdown SIRT2 gene, wherein the nucleotide sequence of the shRNA comprises:

shRNA-F：5'—GATCCGGATGAAAGAGAAGATCTTCTTTCAAGAGAAGAAGATCTTCTCTTTCATCCTTTTTG—3'，

shRNA-R：5'—AATTCAAAAAGGATGAAAGAGAAGATCTTCTTCTCTTGAAAGAAGATCTTCTCTTTCATCCG—3'。

application of precursor of nicotinamide adenine dinucleotide in preparing medicine for treating neurodegenerative diseases.

Those of ordinary skill in the art will understand that: the discussion of any embodiment above is meant to be exemplary only, and is not intended to intimate that the scope of the disclosure, including the claims, is limited to these examples; within the idea of the present disclosure, also technical features in the above embodiments or in different embodiments may be combined, steps may be implemented in any order, and there are many other variations of the different aspects of the embodiments of the present disclosure as described above, which are not provided in detail for the sake of brevity.

The disclosed embodiments are intended to embrace all such alternatives, modifications and variances which fall within the broad scope of the appended claims. Therefore, any omissions, modifications, equivalents, improvements, and the like that may be made within the spirit and principles of the embodiments of the disclosure are intended to be included within the scope of the disclosure.

SEQUENCE LISTING

<110> Zhejiang university

<120> application of shRNA of targeted knockdown SIRT2 gene and precursor of nicotinamide adenine dinucleotide in preparation of medicines for treating neurodegenerative diseases

<130> FI211150

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 62

<212> DNA

<213> Artificial sequence

<400> 1

gatccggatg aaagagaaga tcttctttca agagaagaag atcttctctt tcatcctttt 60

tg 62

<210> 2

<211> 62

<212> DNA

<213> Artificial sequence

<400> 2

aattcaaaaa ggatgaaaga gaagatcttc ttctcttgaa agaagatctt ctctttcatc 60

cg 62

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence

<400> 3

gctggagact caccctgctt tg 22

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence

<400> 4

tgctgtcacc ctgcttgttc ac 22

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence

<400> 5

tggcactgtc ctcctgattg 20

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence

<400> 6

ccctcaaagt aacgacttcc aa 22

Claims

1. An shRNA targeting a knockdown SIRT2 gene, wherein the nucleotide sequence of the shRNA comprises:

2. application of precursor of nicotinamide adenine dinucleotide in preparing medicine for treating neurodegenerative diseases.

3. The use of claim 2, wherein said precursor of nicotinamide adenine dinucleotide comprises at least one of β -nicotinamide mononucleotide, nicotinamide and nicotinamide ribose.

4. The use of claim 2, wherein the medicament for treating a neurodegenerative disease comprises a medicament for treating a demyelinating disease.

5. The use of claim 4, wherein the medicament for the treatment of demyelinating diseases comprises a medicament that promotes myelin repair.

6. The use of claim 4, wherein the agent that promotes myelin repair comprises an agent that promotes differentiation of oligodendrocyte precursor cells into mature oligodendrocytes.

7. The use of claim 6, wherein the agent that promotes differentiation of oligodendrocyte precursor cells into mature oligodendrocytes comprises an agent that promotes entry of SIRT2 into the nucleus of oligodendrocyte precursor cells.

8. The use according to claim 2, wherein the neurodegenerative disease comprises multiple sclerosis, alzheimer's disease, parkinson's syndrome, lateral sclerosis of the spinal cord and huntington's disease.

9. The use according to any one of claims 2 to 8, wherein the medicament for the treatment of neurodegenerative disease is a pharmaceutical composition comprising a precursor of nicotinamide adenine dinucleotide as the only active ingredient.

10. The use of claim 2, wherein the medicament for treating neurodegenerative disease comprises any pharmaceutically acceptable dosage form prepared from pharmaceutically acceptable adjuvants;

preferably, the medicament for treating neurodegenerative disease comprises at least one of decoction, powder, pill, medicated wine, lozenge, gum, tea, starter, cake, lotion, stick, thread, stick, nail, moxibustion, ointment, pellet, liposome, aerosol, injection, mixture, oral ampoule, tablet, capsule, drop pill, emulsion, membrane and sponge.