WO2023078099A1 - Genetic drug for treating nerve injury disease - Google Patents

Abstract

The present invention relates to a genetic drug for treating a nerve injury disease. Disclosed in the present invention is an isolated nucleic acid molecule for treating/ameliorating a nerve injury disease. The isolated nucleic acid molecule contains a double-stranded RNA or shRNA targeting a Porf-2 gene in a targeted neural tissue and knocking down the expression of the Porf-2 gene in the neural tissue, an expression vector containing the double-stranded RNA or shRNA; a virus based on the expression vector and a pharmaceutical composition thereof; and the use thereof in a drug for treating/ameliorating the nerve injury disease.

Description

A gene drug for the treatment of nerve damage diseases

This application claims the priority of the Chinese invention patent application (application number: 202111294181X; invention name: a gene drug for the treatment of nerve injury diseases; application date: November 03, 2021), and the entire content of the Chinese invention patent application Incorporated herein by reference in its entirety.

technical field

The invention relates to a gene medicine for treating nerve injury diseases, and belongs to the technical field of gene therapy.

Background technique

The optic nerve is formed by the axons sent by the retinal ganglion cells (RGC) converging at the optic disc and then passing through the sclera. , essentially belonging to the central nervous system.

Optic nerve injury, also known as traumatic optic neuropathy, is one of the common and serious complications of traumatic brain injury. Car accident injuries, falling injuries and blow injuries are prone to optic nerve damage, especially car accident injuries. The direct injury caused by the stabbing of the optic nerve by a sharp instrument and the direct injury of other parts of the optic nerve are relatively rare in clinical practice, and more than 90% of the optic nerve injuries are indirect injuries of the optic canal. Specifically, indirect optic nerve injury refers to the outer side of the orbit, generally refers to the impact on the upper temporal part of the brow arch, and the external force is transmitted to the optic canal through the skull, causing deformation or fracture of the optic canal, resulting in vision and visual field impairment caused by optic nerve damage.

Regarding the clinical treatment of optic nerve injury, the current common treatment methods mainly include conservative treatment, hormone therapy, surgical treatment (eg, optic canal decompression, autologous transplantation, etc.), protection and regeneration of the optic nerve. Traditional conservative treatment, hormone therapy or surgical treatment cannot achieve good therapeutic effect. Due to the low regenerative ability of RGCs, it is difficult for RGCs to regenerate after optic nerve injury, which leads to optic atrophy and blindness; therefore, how to repair and regenerate the damaged optic nerve and restore the function of the optic nerve is a difficult problem in clinical research in ophthalmology at home and abroad.

Studies have shown that identifying suitable targets to enhance the regenerative ability of damaged RGCs can promote optic nerve regeneration, and there are also related scientific research results of gene therapy.

Regarding the means of gene therapy, the gene therapy technology using adeno-associated virus as a carrier has achieved certain results after nearly two decades of development. Adeno-associated virus (adeno associated virus, AAV) belongs to Parvoviridae, and is the most simple type of single-stranded DNA-deficient virus with no envelope and icosahedral structure found so far. It needs helper virus (usually Adenovirus) involved in replication. The inverted repeat sequence (ITR) at both ends of the adeno-associated virus contains cap and rep genes, wherein the cap gene encodes the viral capsid protein, and the rep gene is involved in virus replication and integration. The probability of wild-type AAV infecting human chromosome 19 is about 19%, but the modified recombinant adeno-associated virus (rAAV) lacks the ability of site-specific integration because it cannot synthesize Rep protein, mainly in the form of episomes Existence, the probability of insertional mutation and activation of oncogenes is extremely low; in view of the characteristics of good safety of recombinant adeno-associated virus, wide range of host cells, low immunogenicity, and long time of expressing foreign genes in vivo, it is considered the most promising One of the promising gene transfer vectors is widely used in gene therapy research worldwide.

Currently, AAV vectors can be divided into 12 serotypes (AAV-1-AAV-12) and more than 100 variants (such as some derived chimeric AAV vectors). Different AAV vectors have different transfection efficiencies for different cells or tissues. Among them, AAV2 and AAV9 have been proved to have relatively high transfection efficiency for the nervous system.

However, there is still a long way to go for gene therapy of nerve injury diseases, especially for the treatment of optic nerve injury diseases; therefore, the field hopes to find key targets that can be applied clinically in the future and develop effective treatments Methods and medicaments for nerve damage diseases, especially optic nerve damage diseases.

Contents of the invention

The present invention discloses that the effect of the Porf-2 gene on the treatment/improvement of optic nerve damage diseases is studied by means of RNA interference (RNAi), and thus a method for treating/improving optic nerve damage diseases is provided, the method comprising A molecule capable of specifically inhibiting the transcription or translation of the Porf-2 gene, or the expression or activity of the Porf-2 protein, is administered to the patient's optic nerve tissue, thereby treating/improving the optic nerve injury disease.

In view of the fact that the Porf-2 gene exists in other nerve tissues besides the optic nerve tissue; the inventor of the present invention discloses "the role of the Porf-2 gene revealed by RNAi in the treatment/improvement of optic nerve damage diseases" On the basis of ", those skilled in the art can reasonably extend to: the Porf-2 gene can also be applied to the treatment/improvement of other nerve injury diseases.

Therefore, the first aspect of the present invention provides the use of Porf-2 gene in treating/improving neurological injury diseases.

In the use of treating/improving nerve injury diseases, the dosage of the molecule administered to the nervous tissue of the patient is a dosage sufficient to reduce the transcription or translation of Porf-2 gene, or the dosage sufficient to reduce the expression or activity of Porf-2 protein. Preferably, the expression of the Porf-2 gene is at least reduced by 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99%.

The molecule administered to the patient's nervous tissue may be selected from but not limited to: nucleic acid molecules, carbohydrates, lipids, small molecule chemical drugs, antibody drugs, polypeptides, proteins or interfering viruses.

The nucleic acid includes, but is not limited to: antisense oligonucleotides, double-stranded RNA (dsRNA) or short hairpin RNA (shRNA).

The double-stranded RNA (dsRNA) or short hairpin RNA (shRNA) contains the promoter sequence or coding region sequence information of the Porf-2 gene.

Preferably, the double-stranded RNA (dsRNA) is small interfering RNA (siRNA). The small interfering RNA comprises a first strand and a second strand complementary to each other to form an RNA dimer; the sequence of the first strand is consistent with 15-27 continuous nucleotide sequences in the Porf-2 gene (target sequence) are basically the same. The siRNA can specifically bind to the mRNA fragment encoded by the target sequence, and specifically silence the expression of the Porf-2 gene.

The target sequence in the Porf-2 gene is: when the siRNA specifically silences the expression of the Porf-2 gene, the fragment in the Porf-2 gene corresponding to the mRNA fragment complementary to the siRNA.

Preferably, the Porf-2 gene is a human-derived Porf-2 gene.

Preferably, the nerve damage disease is an optic nerve damage disease.

The second aspect of the present invention provides the use of Porf-2 gene or Porf-2 protein in preparing or screening drugs for treating/improving nerve injury diseases.

In the use of treating/improving nerve injury diseases, the dosage of the molecule administered to the nervous tissue of the patient is a dosage sufficient to reduce the transcription or translation of Porf-2 gene, or the dosage sufficient to reduce the expression or activity of Porf-2 protein. Preferably, the expression of the Porf-2 gene is at least reduced by 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99%.

The molecule administered to the patient's nervous tissue may be selected from but not limited to: nucleic acid molecules, carbohydrates, lipids, small molecule chemical drugs, antibody drugs, polypeptides, proteins or interfering viruses.

The nucleic acid includes, but is not limited to: antisense oligonucleotides, double-stranded RNA (dsRNA) or short hairpin RNA (shRNA).

The double-stranded RNA (dsRNA) or short hairpin RNA (shRNA) contains the promoter sequence or coding region sequence information of the Porf-2 gene.

Preferably, the double-stranded RNA (dsRNA) is small interfering RNA (siRNA). The small interfering RNA comprises a first strand and a second strand complementary to each other to form an RNA dimer; the sequence of the first strand is consistent with 15-27 continuous nucleotide sequences in the Porf-2 gene (target sequence) are basically the same. The siRNA can specifically bind to the mRNA fragment encoded by the target sequence, and specifically silence the expression of the Porf-2 gene.

The target sequence in the Porf-2 gene is: when the siRNA specifically silences the expression of the Porf-2 gene, the fragment in the Porf-2 gene corresponding to the mRNA fragment complementary to the siRNA.

Preferably, the Porf-2 gene is a human-derived Porf-2 gene.

Preferably, the nerve damage disease is an optic nerve damage disease.

The third aspect of the present invention provides the use of the isolated Porf-2 gene or Porf-2 protein in screening drugs for treating/improving nerve injury diseases.

The "use of the isolated Porf-2 gene or Porf-2 protein in screening for the treatment/improvement of nerve injury diseases" includes: using the isolated Porf-2 gene or Porf-2 protein as a target for screening nerve injury Disease treatment/improvement drugs.

Specifically, the isolated Porf-2 gene or Porf-2 protein is used as the object/target of action, and the drug is screened to find a drug that can inhibit the expression of the Porf-2 gene as a candidate drug for treating/improving nerve damage diseases. The siRNA and shRNA of the Porf-2 gene as described in the present invention are obtained by screening the Porf-2 gene as an object, and can be used as candidate drugs for treating/improving nerve injury diseases; in addition, small molecule chemical drugs, antibody drugs, polypeptides Or protein, etc. can also use Porf-2 gene or its protein as the target.

The drug for treating/improving nerve injury diseases is a molecule that can specifically inhibit the transcription or translation of the Porf-2 gene, or can specifically inhibit the expression or activity of the Porf-2 protein, thereby reducing the expression or activity of the Porf-2 gene in nerve tissue. expression level, to achieve the purpose of treating/improving nerve injury diseases.

The administration dose of the medicine for treating/improving nerve injury disease is enough to reduce the transcription or translation of Porf-2 gene, or the dosage enough to reduce the expression or activity of Porf-2 protein. Preferably, the expression of the Porf-2 gene is at least reduced by 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99%.

Drugs for the treatment/improvement of nerve injury diseases obtained by screening the isolated Porf-2 gene or Porf-2 protein can be selected from but not limited to: nucleic acid molecules, carbohydrates, lipids, small molecule chemical drugs, antibody drugs, polypeptides, proteins or interfering viruses.

The nucleic acid includes, but is not limited to: antisense oligonucleotides, double-stranded RNA (dsRNA) or short hairpin RNA (shRNA).

The double-stranded RNA (dsRNA) or short hairpin RNA (shRNA) contains the promoter sequence or coding region sequence information of the Porf-2 gene.

Preferably, the double-stranded RNA (dsRNA) is small interfering RNA (siRNA). The small interfering RNA comprises a first strand and a second strand complementary to each other to form an RNA dimer; the sequence of the first strand is consistent with 15-27 continuous nucleotide sequences in the Porf-2 gene (target sequence) are basically the same. The siRNA can specifically bind to the mRNA fragment encoded by the target sequence, and specifically silence the expression of the Porf-2 gene.

The target sequence in the Porf-2 gene is: when the siRNA specifically silences the expression of the Porf-2 gene, the fragment in the Porf-2 gene corresponding to the mRNA fragment complementary to the siRNA.

Preferably, the Porf-2 gene is a human-derived Porf-2 gene.

Preferably, the nerve damage disease is an optic nerve damage disease.

The fourth aspect of the present invention provides an isolated nucleic acid molecule for the treatment/improvement of nerve injury diseases, wherein the isolated nucleic acid molecule includes targeting the Porf-2 gene in the nerve tissue, and knocking down the Porf-2 gene in the nerve tissue. 2. Double-stranded RNA and/or shRNA for gene expression.

Preferably, the double-stranded RNA contains a nucleotide sequence capable of hybridizing with the Porf-2 gene under stringent conditions.

Preferably, the shRNA contains a nucleotide sequence capable of hybridizing with the Porf-2 gene under stringent conditions.

Further, the double-stranded RNA comprises a first strand and a second strand complementary to each other to form an RNA dimer; the sequence of the first strand is identical or substantially identical to the target sequence of the Porf-2 gene. More preferably, the double-stranded RNA is siRNA (small interfering RNA). More preferably, the siRNA is obtained by performing RNA interference sequence design with the Porf-2 gene sequence as the target sequence.

Further, the shRNA comprises a sense strand segment and an antisense strand segment, and a stem-loop segment connecting the sense strand segment and the antisense strand segment, the sequences of the sense strand segment and the antisense strand segment are complementary, and The sequence of the sense strand fragment is identical or substantially identical to the target sequence of the Porf-2 gene. More preferably, the sense strand fragment and the antisense strand fragment of the shRNA are obtained by using the Porf-2 gene sequence as the target sequence and performing RNA interference sequence design. The shRNA is transformed into siRNA through enzymatic cleavage in the cell, and then plays the role of specifically knocking down the expression of the Porf-2 gene.

The target sequence in the Porf-2 gene is: when the siRNA specifically silences the expression of the Porf-2 gene, the fragment in the Porf-2 gene corresponding to the mRNA fragment complementary to the siRNA.

Preferably, the target sequence refers to 15-27 continuous nucleotide sequences in the Porf-2 gene; preferably, the target sequence refers to 19-23 continuous nucleotide sequences in the Porf-2 gene more preferably, the target sequence refers to 19, 20 or 21 consecutive nucleotide sequences in the Porf-2 gene.

Preferably, the Porf-2 gene is a human-derived Porf-2 gene. More preferably, the target sequence of the Porf-2 gene is as shown in any one of SEQ ID NO: 1-6.

In order to obtain the double-stranded RNA or shRNA targeting the human Porf-2 gene, the mRNA sequence of the coding region (CDS region) of the human Porf-2 gene was obtained from NCBI query, and the siRNA interference sequence for specifically knocking down the human Porf-2 gene was designed using software , and filter by rating. After screening by the inventors, the target sequence of the human Porf-2 gene as shown in any sequence of SEQ ID NO: 1-6 was selected.

Specifically, the sequence of SEQ ID NO: 1 is: gagaaggactatgagatttac;

The sequence of SEQ ID NO: 2 is: gcctccaagcacttcaacaag;

The sequence of SEQ ID NO: 3 is: gctgatccagatgtacatggg;

The sequence of SEQ ID NO: 4 is: gcgataagcacgtatgccaag;

The sequence of SEQ ID NO: 5 is: gccaagtactgttaccacaag;

The sequence of SEQ ID NO: 6 is: gggacattgacgaggtgaatg.

The fifth aspect of the present invention provides an expression vector of interfering nucleic acid of Porf-2 gene, wherein the expression vector comprises a gene fragment encoding the above shRNA, and the expression vector can express the shRNA.

The expression vector of the interfering nucleic acid of the Porf-2 gene is obtained by cloning the gene fragment encoding the above shRNA into a known vector. Preferably, the known vector may be a lentiviral vector, an adeno-associated viral vector or a retroviral vector, etc.

Preferably, the expression vector of the interfering nucleic acid of the Porf-2 gene is a recombinant viral vector, which is formed by cloning the gene fragment encoding the above-mentioned shRNA into the coding region of the viral vector; the viral vector is a lentiviral vector , adeno-associated viral vector, or retroviral vector.

The expression vector of the interfering nucleic acid of the Porf-2 gene, after being packaged by the virus, becomes an infectious virus particle, infects the nerve tissue, and then transcribes the above-mentioned shRNA, and then undergoes steps such as enzyme cutting and processing in the cell to become siRNA , and finally achieve specific knockdown of the expression of the Porf-2 gene.

More preferably, the expression vector of the interfering nucleic acid of the Porf-2 gene also contains a promoter sequence and/or a nucleotide sequence encoding a marker that can be detected in nerve tissue; the detectable marker , such as green fluorescent protein (GFP).

More preferably, the expression vector of the interfering nucleic acid of the Porf-2 gene is a recombinant adeno-associated virus vector obtained by inserting the gene fragment encoding the above-mentioned shRNA into the coding region between the two ITR sequences of the adeno-associated virus vector.

The "adeno-associated virus vector" can be serotype AAV1, 2, 3, 4, 5, 6, 7, 8, 9 or 10, or chimeric AAV derived from these serotypes, such as AAV2-AAV3, AAVrh.10, AAVhu.14, AAV3a/3b, AAVrh32.33, AAVHSC15, AAV-HSC17, AAVhu.37, AAVrh.8, etc.

Upon transfection, AAV elicited only a mild immune response in the host. In a preferred embodiment of the invention, the adeno-associated viral vector is a serotype AAV2 or 5 vector. More preferably, the adeno-associated virus vector is a serotype AAV2 vector.

The sixth aspect of the present invention provides a virus, wherein the virus is obtained by transfecting a eukaryotic cell with a virus packaging system; the virus packaging system comprises the above-mentioned recombinant adeno-associated virus vector.

In a specific embodiment of the present invention, the virus packaging system is an adeno-associated virus packaging system, which comprises the above-mentioned recombinant adeno-associated virus vector containing the Porf-2 gene interference nucleic acid, the packaging plasmid of the adeno-associated virus, and the adeno-associated virus helper plasmid.

In a preferred embodiment of the present invention, the virus packaging system adopts the adeno-associated virus packaging system of the three-plasmid system, which includes the packaging plasmid pAAV-RC (containing the AAV2 coat protein gene), the helper plasmid pHelper (containing the gene) and the above-mentioned recombinant adeno-associated virus vector containing Porf-2 gene interference nucleic acid.

The adeno-associated virus packaging system transfects eukaryotic cells, and the adeno-associated virus is obtained through virus packaging. The adeno-associated virus infects nerve tissue, and transcribes the above-mentioned shRNA, which is processed into siRNA by enzyme digestion, and finally achieves specific knockdown of the expression of the Porf-2 gene.

The seventh aspect of the present invention provides a pharmaceutical composition, which comprises the above-mentioned virus, and a pharmaceutically acceptable carrier or excipient.

Further, the pharmaceutical composition comprises 1-99% wt of the virus, and a pharmaceutically acceptable carrier or excipient.

When preparing/preparing a pharmaceutical composition, the active ingredient is usually mixed with an excipient, or diluted with an excipient, or encapsulated in a pharmaceutical carrier. The pharmaceutical composition can be tablets, pills, powders, solutions, syrups, sterile injection solutions and the like. Preferably, an injection form is used. More preferably, a dosage form suitable for subretinal injection or vitreous injection is used.

The eighth aspect of the present invention provides the expression vector of the above-mentioned Porf-2 gene interfering nucleic acid, or the above-mentioned virus, or the application of the above-mentioned pharmaceutical composition in the preparation of drugs for the treatment/improvement of nerve injury diseases.

The above virus or pharmaceutical composition can be used to treat/improve nerve damage diseases. The method for treating/improving nerve injury diseases comprises administering an effective dose of the virus or the pharmaceutical composition to the nerve tissue of the subject. Using the method for treating/improving nerve damage diseases, the expression of the Porf-2 gene in the nerve tissue of the subject is knocked down. Further, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% of the Porf-2 gene expression is knocked down.

The subject can be a human.

Preferably, the nerve damage disease is an optic nerve damage disease.

Preferably, the expression vector of the above-mentioned Porf-2 gene interfering nucleic acid, or the above-mentioned virus, or the above-mentioned pharmaceutical composition is used to promote the regeneration of optic nerve axons after optic nerve injury.

Preferably, the expression vector of the interfering nucleic acid of the above-mentioned Porf-2 gene, or the above-mentioned virus, or, as the above-mentioned pharmaceutical composition, is used to improve the survival rate of RGC cells after optic nerve injury.

Preferably, the expression vector of the above-mentioned Porf-2 gene interfering nucleic acid, or the above-mentioned virus, or the above-mentioned pharmaceutical composition is used to prevent the compound layer of ganglion cells from becoming thinner after optic nerve injury.

Preferably, the above-mentioned Porf-2 gene interfering nucleic acid expression vector, or the above-mentioned virus, or the above-mentioned pharmaceutical composition is used to promote the recovery of visual function after optic nerve injury.

It should be understood that within the protection scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described in the following embodiments can be combined with each other to form a new or preferred technical solution. Due to space limitations, we will not elaborate here.

Description of drawings

Fig. 1 is the map of the first empty plasmid described in the embodiment 1 of the present invention;

Fig. 2 is the result figure of the Porf-2 expression level analysis obtained at different time points (after injury) obtained by immunofluorescence detection;

Fig. 3 is the result figure of the Porf-2 expression level analysis obtained at different time points (after injury) detected by qPCR;

Fig. 4 is two weeks after virus expression, the Porf-2 expression level analysis result figure of qPCR detection experimental group and control group;

Fig. 5 is a graph showing the statistical results of the regenerated axons at different distances from the injury in the experimental group and the control group;

Fig. 6 is a graph showing the survival results of retinal cells after immunofluorescent staining of the retinal slices.

Detailed ways

The inventor of this application published the following two articles in 2016 and 2017:

Huang GH, Yang XT, Chen K, Xing J, Guo L, Zhu L, Li HJ, Li XC, Zhang SY, Feng DF, Porf-2 Inhibits Neural Stem Cell Proliferation Through Wnt/beta-Catenin Pathway by Its GAP Domain, Frontiers in Cellular Neuroscience, 2016, 10:85.;

Yang XT, Huang GH, Li HJ, Sun ZL, Xu NJ, Feng DF. Rac1 Guides Porf-2 to Wnt Pathway to Mediate Neural Stem Cell Proliferation. Frontiers in Molecular Neuroscience, 2017,10:172.

They reveal the molecular mechanism by which Porf-2 protein inhibits the proliferation of neural stem cells. Specifically, Porf2 protein inactivates Rac1 through its GAP domain, which leads to the continuous activation of Wnt/β-Catenin pathway, which leads to the blockage of neural stem cell division.

The inventors of the present application found in the research on the Porf-2 gene that after a period of optic nerve injury, the expression level of the Porf-2 gene in RGC cells increased; The expression of Porf-2 gene, unexpectedly found that the knockdown of Porf-2 gene in mouse optic nerve tissue can promote the regeneration of optic nerve axons after optic nerve injury, especially it can also improve the survival rate of RGC cells after optic nerve injury, and prevent the The ganglion cell complex layer becomes thinner and promotes the recovery of visual function; this finding suggests that the Porf-2 gene can be used as a therapeutic target after optic nerve injury by knocking down the expression of the Porf-2 gene by RNAi, especially in combination with The gene therapy technology of adeno-associated virus can realize direct drug delivery to the eye, and it can become an effective means of treating/improving optic nerve damage in the future, and has considerable clinical application prospects.

The present invention is described further below by embodiment. It should be understood that these examples are only used to illustrate the present invention, but not to limit the protection scope of the present invention, and the present invention is not limited to these specific implementations.

The materials and reagents used in the following examples can be obtained from commercial sources unless otherwise specified. For the experimental methods without specific conditions indicated in the following examples, conventional conditions, such as the conditions described in the Molecular Cloning Laboratory Manual of Sambrook et al., or the conditions suggested by the manufacturer are generally followed. Percentages and parts are by weight unless otherwise indicated.

Example 1

1. Design and screening of interference sequences targeting Porf-2 gene in nervous tissue

Obtain the mRNA sequence of the mouse Porf-2 gene coding region (CDS region) from NCBI (see https://www.ncbi.nlm.nih.gov/gene/223666), and use software to specifically knock down mouse Porf siRNA interference sequence of -2 gene; the following 6 siRNA (siRNA-1-6) sequences were screened according to the scores, see Table 1 below:

Table 1

For the above-mentioned 6 siRNAs (siRNA-1-6), an appropriate stem-loop fragment sequence was designed (in this example, the DNA sequence corresponding to the stem-loop fragment is: TTCAAGAGA), and thus the corresponding 6 siRNAs were obtained. shRNA (shRNA1~6).

The sense strands of shRNA1-6 are the corresponding sense strands of siRNA-1-6, and the antisense strands of shRNA1-6 are the corresponding antisense strands of siRNA-1-6, which will not be repeated here.

In addition, the inventors designed primer sequences (introducing a SmaI restriction site) for amplifying the DNA fragments corresponding to shRNA1-6, and the primer sequences are shown in Table 2 below.

Table 2

Send the primer sequences of the DNA fragments corresponding to shRNA1-6 in the above Table 1 to Shanghai Sangon Biotechnology Co., Ltd. for artificial synthesis; then anneal the synthesized single-stranded primers to obtain double-stranded oligo with sticky ends sequence.

2. Construction of a recombinant plasmid for knocking down the Porf-2 gene

The steps of the build process are as follows:

1) Obtain the interfering fragment to be cloned and inserted: Use SmaI endonuclease (purchased from NEB company's enzyme digestion system) to digest the double-stranded oligo sequence corresponding to shRNA1-6 to obtain the interfering fragment (DNA fragment) to be cloned and inserted ;

2) The first empty plasmid pAAV-H1-MCS-gRNA-CAG-EGFP-WPRE-SV40pA (adeno-associated virus vector of AAV2 serotype, purchased from Shanghai Taiertu Biotechnology Co., Ltd.), and SmaI endonuclease (purchased from the enzyme digestion system of NEB Company) to carry out enzyme digestion;

See Figure 1 for the map information of the first empty plasmid.

For the enzyme digestion system and specific operation of the above steps 1) and 2), please refer to the instruction manual, and will not repeat them here.

The interfering fragments to be cloned and inserted in the above step 1) and the digested first empty plasmid in step 2) were all recovered using the AxyPrep PCR cleaning kit. For specific operations, please refer to the instructions and will not repeat them.

3) Plasmid ligation: The above-mentioned cleaning and recovery of the interfering fragment and the first empty plasmid were ligated by T4 ligase (20 μl system).

4) Transformation, recombinant plasmid identification and amplification: transform the ligation product of step 3) into the competent cell Top10, spread the Amp resistance plate, and obtain monoclonal colonies for small shaking and small extraction (using Axygen small extraction kit); The plasmids obtained by the small extraction were digested and identified, and the plasmids with the same size as the target fragment were selected and sent to Shanghai Sangong Co., Ltd. for sequencing and identification, and the nucleic acid sequence comparison was performed. The recombinant plasmid with the correct sequencing ratio was selected and shaken, and the Axygen large extraction kit was used for extraction and purification to obtain a recombinant plasmid knocking down the Porf-2 gene.

Specifically, the recombinant plasmids obtained above to knock down the Porf-2 gene are recombinant adeno-associated virus vectors expressing shRNA1-6 respectively (named RNAi-1, RNAi-2, ... RNAi- 6).

In the recombinant plasmid for knocking down the Porf-2 gene obtained above, the shRNA1-6 sequence that interferes with the expression of the Porf-2 gene is inserted into the coding region between the ITR sequences at both ends of the adeno-associated virus vector (the above-mentioned first empty plasmid), Specifically, insert between the two Esp3I restriction sites in Figure 1.

3. Preliminary verification of the knockdown effect of the recombinant adeno-associated virus vectors of shRNA1-6 above from the cellular level

In order to initially verify the knockdown effect at the cellular level, the inventors constructed an overexpression plasmid of the Porf-2 gene and an interference control plasmid.

The overexpression plasmid (hereinafter also referred to as OV, i.e. overexpression construct) is obtained by inserting the cDNA sequence of the Porf-2 gene into the second empty plasmid (pAAV-CMV bGlobin-Arhgap39-mCherry-3xFlag-WPRE-hGHpA). The expression plasmid can make the fusion expression of Porf-2 protein and red fluorescent protein (mCherry);

The overexpressed control plasmid (hereinafter also referred to as OC, i.e. overexpression empty control) refers to the above-mentioned second empty plasmid;

The interference control plasmid (hereinafter also referred to as RNAi-NC) is obtained by inserting an shRNA with no interference activity (no corresponding target) into the first empty plasmid pAAV-H1-MCS-gRNA-CAG-EGFP-WPRE-SV40pA .

Mix the above-mentioned recombinant adeno-associated virus vectors (RNAi-1-6) expressing shRNA1-6 with the overexpression plasmid (OV) respectively, and co-transfect 293T cells, and observe the fluorescence expression after 24 hours to judge the RNAi-1-6 knockdown effect.

Knockdown groups 1-6 respectively set the following group names: OV+RNAi-1, OV+RNAi-2, ... OV+RNAi-6;

In addition, set control groups 1-6 corresponding to the above knockdown groups:

Control groups 1-6 are respectively set the following group names: OC+RNAi-1, OC+RNAi-2, ... OC+RNAi-6;

In addition, a control group OV+RNAi-NC, and a control group OV (only OV was added) were also set up.

From the detection results of green fluorescence, the expression of green fluorescence was observed in knockdown group 1-6, control group 1-6 and control group OV+RNAi-NC, which indicated that they were all transfected with the corresponding interference plasmid. Note: Green fluorescence expression was not observed only in the control group OV.

From the detection results of red fluorescence, the red fluorescence effects of the knockdown group 1-6 were significantly weaker than that of the control group OV; however, 1) compared with the control group OV, the red fluorescence of the two groups There is no significant difference in the expression level, which indicates that the interference control plasmid (RNAi-NC) does not have the knockdown ability; 2) Normal red fluorescent expression was observed in the control group 1-6, and its expression level was compared with that of the control group OV , there is no significant difference, which shows that the knockdown plasmid RNAi-1～6 only specifically knocks down the Porf-2 gene; 3) Among the 6 knockdown groups, the effects of knockdown groups 4, 6, 2 and 3 are better; , the red fluorescence effect is the weakest in knockdown group 4, followed by knockdown group 6.

Based on the verification results at the cellular level, the inventors selected the knockdown plasmid RNAi-4 (ie, the recombinant adeno-associated virus vector expressing shRNA4) to prepare an adeno-associated virus.

4. Packaging of adeno-associated virus

The adeno-associated virus packaging system in this example uses a three-plasmid system, which includes the packaging plasmid pAAV-RC (containing the AAV2 coat protein gene), the helper plasmid pHelper (containing the gene that can help AAV replicate) and the above-mentioned knockdown plasmid RNAi-4 (recombinant adeno-associated virus vector expressing shRNA4).

This part of the work is entrusted to Shanghai Taiertu Biotechnology Co., Ltd., and the brief description is as follows:

Step 1) Cultivation: On the first day, 293T cells with a degree of polymerization above 90% were subcultured at a ratio of 1:3, and cultured with high-glucose DMEM containing 10% FBS. About 1-2 hours before transfection the next day, replace the culture medium with serum-free culture medium;

Step 2) Transfection: Co-transfect 293T cells with Lipofectamine 2000, the above-mentioned knockdown plasmid RNAi-4, packaging plasmid pAAV-RC and helper plasmid pHelper; about 24 hours after transfection, change the medium; after about 72 hours after transfection, Use PEG8000 to precipitate the virus in the medium supernatant, and collect the virus after precipitation overnight;

Step 3) purification and concentration: the virus mixture collected in step 2) was purified by iodixanol density gradient centrifugation, and then concentrated by an ultrafiltration tube to obtain the adeno-associated virus solution of this embodiment, namely Solution of adeno-associated virus expressing shRNA4.

Regarding the identification of the virus obtained:

1) Identification of virus purity: Take a small amount of the adeno-associated virus solution obtained above, add proteinase K, and incubate at 37°C for half an hour to break the virus capsid; spread it on PAGE gel, and compare it with the standard virus coat protein to confirm the method. The protein coat of the adeno-associated virus for example is correct;

2) Determination of virus titer: Take a small amount of the adeno-associated virus solution obtained above, add proteinase K, incubate at 37°C for half an hour to break the virus capsid; then heat at 95°C for 5 minutes to inactivate the enzyme; centrifuge at 12000rp for 2min, collect the supernatant ; Then dilute the collected supernatant into different gradient concentrations, and perform qPCR amplification. After calculation, the virus titer is about 1.82E+13, which meets the requirements of virus products;

3) Identification of virus integrity: In view of the fact that the AAV2 vector (the first empty vector pAAV-H1-MCS-gRNA-CAG-EGFP-WPRE-SV40pA) has several characteristic sequences, such as the promoter CAG and the marker gene EGFP; thus, The supernatant collected in the identification of the above part 2) was added with primers of different characteristic sequences for qPCR detection; after detection, the amplified products of the promoter CAG and the marker gene EGFP of the adeno-associated virus prepared in this example The signal value is very close to that of the standard sample (the first empty vector), which shows that the knockdown plasmid RNAi-4 (i.e., the recombinant adeno-associated virus vector expressing shRNA4) contained in the adeno-associated virus obtained in this example is correct , no recombination between the knockdown plasmid RNAi-4 and the AAV genome occurred.

5. Construction of mouse optic nerve clamp injury model

The build steps are as follows:

1) Select 5-week-old male C57BL/6 mice, use 1% pentobarbital sodium injection (10ul/g) for intraperitoneal injection anesthesia, after the mice are anesthetized, add oxybucaine hydrochloride dropwise to the left eyeball Corneas were topically anesthetized and placed under a dissecting microscope. Take an object of appropriate size and place it under the head of the mouse so that the head of the mouse is in a horizontal position.

2) Select the outer canthus as the surgical approach, first use fine forceps to lift the conjunctiva, pull the eyeball outward, use venus scissors to cut a small hole in the outer canthus conjunctiva until the bulbar conjunctiva layer, and bluntly dissect the retrobulbar tissue downwards and backwards , exposing the optic nerve. The operation should be gentle and careful to avoid damage to the retrobulbar artery.

3) Carefully peel off the optic nerve sheath, and hold the optic nerve with Dumont#5 self-closing forceps at 1mm behind the bulb for 5 seconds; do not damage the blood vessels in the sheath so as not to affect the blood supply and return of the fundus.

The control group exposed the optic nerve without clamping.

4) Disinfect the wound and apply erythromycin eye ointment on the edge of the incision. The blood supply of the fundus was observed, and the mice with pale fundus arteries and damaged lenses were excluded from the group and supplemented.

6. Detection of the expression of Porf-2 gene in normal model and mouse retina of injury model

Select 5-week-old C57BL/6 male mice and randomly divide them into a control group (normal) and a 7-day-injury group; the 7-day-injury group was established according to the above-mentioned part 5, and the mice were killed 7 days after modeling obtained after.

The retinal tissues of the control group and each injury group (non-injury side) were taken to make frozen sections, and Porf-2 protein and TUJ1 protein (using antibodies to Porf-2 and TUJ1) were immunofluorescently double-stained by immunofluorescence histochemistry. Finally, the expression of Porf-2 in the retina was determined by laser confocal fluorescence microscope photography and fluorescence quantitative analysis. As shown in FIG. 2 , the analysis results of Porf-2 expression at different time points (after injury) obtained by immunofluorescence detection.

The retinal tissues of the normal control group and each injury group (non-injury side) were collected, total RNA was extracted, and after reverse transcription PCR, the expression of Porf-2 in the retina was detected by qPCR. As shown in FIG. 3 , the analysis results of Porf-2 expression at different time points (after injury) obtained by qPCR detection.

Comparing the results in Figure 2 and Figure 3, it can be seen that the expression of Porf-2 obtained by immunofluorescence detection and qPCR detection has basically the same change trend, both revealing that the expression of Porf-2 gene increased on the 7th day after injury .

7. Effect data - verification of the effect of injecting the adeno-associated virus of this embodiment into the vitreous cavity of the mouse model

In general, by injecting the adeno-associated virus of this example (that is, the adeno-associated virus obtained in the above section 4, that is, the adeno-associated virus containing the recombinant adeno-associated virus vector expressing shRNA4) into the vitreous cavity of the mouse model To interfere with the expression of the Porf-2 gene in RGC cells; then on this basis, establish a mouse optic nerve injury model to simulate axonal injury; two weeks later, inject CTB-555 into the vitreous cavity to trace the regenerated axons; At the same time, TUJ1 immunofluorescence staining was performed to observe the survival of RGCs and the recovery of vision. The specific experimental process is as follows:

7-1. Intravitreal injection of adeno-associated virus

1) 3-week-old male C57BL/6 mice were anesthetized by intraperitoneal injection of 1% pentobarbital sodium injection (10ul/g). After the mice were anesthetized, compound tropicamide was added dropwise to the left eyeball Eye drops dilate the pupil,

2) At about 1 mm behind the corneoscleral limbus, use a micro-injector to insert the needle obliquely at 45° downwards. Be careful not to damage the lens and retina. After extracting 2ul of vitreous humor, pull out the syringe, which will help the next vitreous cavity injection and can Prevention of increased intraocular pressure due to injection.

3) Use the microsyringe again to insert the needle from the original needle port, and slowly inject 2 ul of the prepared virus solution (the solution of adeno-associated virus in this embodiment) into the vitreous cavity of the mice in the experimental group. After the injection, stay for 5 minutes until the virus fully infiltrates the vitreous cavity, and then pull out the needle to prevent reflux.

Mice in the control group were intravitreally injected with the interference control virus—the interference control plasmid (RNAi-NC) constructed in the above-mentioned part 3, and the adeno-associated virus obtained by the virus packaging method in the above-mentioned part 4.

4) Apply tobramycin and dexamethasone eye ointment to prevent infection after the operation, and transfer them to the incubator until they recover from anesthesia and return to the cage for feeding. After close observation, those with lens opacity, massive hemorrhage in vitreous cavity and large-scale retinal detachment were excluded.

7.2 Detection of infection effectiveness of adeno-associated virus by immunofluorescent staining of retinal sections/retinal smears

Two weeks after virus expression, immunofluorescent staining of retinal sections and immunofluorescent staining of retinal slices were performed respectively.

The procedure for immunofluorescent staining of retinal sections is as follows:

1) After the experimental mice were anesthetized, pre-cooled PBS was used to flush and perfuse the systemic blood vessels from the left ventricle. After 3-5 minutes, the blood was completely washed, and then perfused with pre-cooled 4% PFA (1xPBS) for 5-10 minutes.

2) Use micro-scissors and micro-tweezers to gently separate and take out the eyeball and optic nerve, carefully remove the surrounding soft tissue, and poke a small hole in the center of the cornea with a needle. The trimmed tissues were fixed in 4% PFA for 2 hours at 4°C. Then rinse twice with PBS. Then the tissues were dehydrated in 30% sucrose solution in a refrigerator at 4°C for 48 hours.

3) Use filter paper to carefully absorb the remaining water on the tissue, remove the cornea and lens, and only keep the optic cup, fully submerge the optic cup in OCT for embedding, and put it in a -80°C refrigerator to prepare frozen sections.

4) Using a frozen microtome, the temperature of the case and the freezing head is adjusted to -20°C. Transfer the tissue from the -80°C freezer to the microtome half an hour in advance to thaw. Retina and optic nerve were sliced longitudinally, retina 20 μm/layer, optic nerve 14 μm/layer, the slices were pasted on anti-slip slides, and stored at -20°C for later use.

5) Select retinal frozen sections, bake the slices in a 37°C oven for 20 minutes, and wash three times with 1xPBS to remove residual OCT.

6) Add an appropriate amount of prepared blocking solution dropwise on the slice, seal at room temperature for 2 hours, and absorb the blocking solution. Add primary antibody (Porf-21:100, TUJ11:300) and incubate overnight at 4°C.

7) The next day, take out the slices from the refrigerator at 4°C, refold at room temperature for 30 minutes, and absorb the primary antibody. Wash with 1xPBST three times, 10min each time.

8) Add the corresponding fluorescent secondary antibody and DAPI (secondary antibody 1:500, DAPI 1:1000), and incubate at room temperature for 2 hours in the dark. Wash 3 times with 1xPBST, 10min each time.

9) Discard the residual PBST on the slide, after drying slightly, add an appropriate amount of anti-fluorescence quencher dropwise, and seal the slide.

10) Laser confocal fluorescence microscope to take photos for observation and film.

The procedure of immunofluorescent staining of retinal slices is as follows:

1) After the experimental mice were anesthetized, pre-cooled PBS was used to flush and perfuse the systemic blood vessels from the left ventricle. After 3-5 minutes, the blood was completely washed, and then perfused with pre-cooled 4% PFA (1xPBS) for 5-10 minutes.

2) Use micro-scissors and micro-tweezers to gently separate and take out the eyeball and optic nerve, carefully remove the surrounding soft tissue, and poke a small hole in the center of the cornea with a needle. The trimmed tissues were fixed in 4% PFA for 2 hours at 4°C. Then rinse twice with PBS. Then the tissues were dehydrated in 30% sucrose solution in a refrigerator at 4°C for 48 hours.

3) Take out the dehydrated tissue, carefully dissect and separate the complete retina in PBS, and the operation should be careful and gentle to avoid damage to the retina. After the retina was isolated, rinse with 1xPBS 3 times, 10min each time.

4) The retina was placed in a 24-well plate containing blocking solution, and blocked at room temperature for 2 hours. After the blocking, the blocking solution was sucked off, and the primary antibody (TUJ11:300) was added to incubate at 4°C for 48 hours.

5) Two days later, remove the spread from the refrigerator at 4°C, refold at room temperature for 30 minutes, and absorb the primary antibody. Wash with 1xPBST three times, 10min each time.

6) Add the corresponding fluorescent secondary antibody and DAPI (secondary antibody 1:500, DAPI 1:1000), and incubate at room temperature for 2 hours in the dark. Wash 3 times with 1xPBST, 10min each time.

7) Carefully cut the retina into a petal shape with scissors along the four directions of temporal side, nasal side, dorsal side and ventral side, with the GCL layer facing up, and spread it on a glass slide.

8) Discard the residual PBST on the slides and spreads, and after a little drying, add an appropriate amount of anti-fluorescence quencher dropwise, and seal the slides.

9) Laser confocal fluorescence microscope to take pictures for observation and film.

From the results of immunofluorescence detection of retinal slices, the vitreous cavity of the mice in the experimental group and the control group were effectively infected in a large area, and from the results of immunofluorescence detection of retinal slices, the optic ganglion cells were effectively infected with the virus And eGFP is highly expressed, which shows that AAV2 virus (including the adeno-associated virus obtained in the above-mentioned part 4, and the interference control virus) can effectively infect RGC cells.

7-3. qPCR detection of the adeno-associated virus knockout efficiency of Porf-2 in retinal tissue

Two weeks after the virus was expressed, the retinal tissues of each group were obtained for qPCR detection to verify whether the expression of the Porf-2 gene was effectively knocked down in the retinal tissues of the mice in the experimental group. The operation of qPCR is the same as the qPCR in Section 6 above.

See Fig. 4, after two weeks of virus expression, the analysis results of Porf-2 expression in the experimental group and the control group were detected by qPCR.

As can be seen from Figure 4, at the mRNA level, the expression level of the Porf-2 gene in the experimental group was significantly lower than that in the control group—a drop of about 50%. This shows that the expression level of the Porf-2 gene in the retinal tissue of mice injected with the adeno-associated virus of this example (containing the recombinant adeno-associated virus vector expressing shRNA4) was significantly reduced, which verified the adeno-associated virus obtained in this example. A related virus can efficiently knock down the Porf-2 gene in retinal cells.

7-4. Detecting the effect of Porf-2 gene knockdown on optic nerve axon regeneration after optic nerve injury by tracing regenerated axons

Two weeks after the virus was expressed, the optic nerve clamp injury was performed on the mice of the experimental group and the control group according to the method of the above-mentioned part 5 (construction of the mouse optic nerve clamp injury model);

Two weeks after the optic nerve injury, the regenerated axon was traced.

Before operation, prepare nerve tracer, dissolve CTB-555 powder with pre-cooled PBS to make the final concentration 2ug/ul, aliquot and store in -20°C refrigerator for later use, avoid light during use and storage, and avoid repeated freezing melt.

Step 1) After 2 weeks of optic nerve damage, perform intraperitoneal injection anesthesia with 1% pentobarbital sodium injection (10ul/g) again, treat that after the mouse is anesthetized, add compound tropicamide eye drops at the left eyeball The liquid dilates the pupil.

Step 2) At about 1mm behind the corneoscleral limbus, use a micro-syringe to insert the needle obliquely at 45° downwards. Be careful not to damage the lens and retina. After extracting 1.5ul of vitreous humor, pull out the syringe, which will help the subsequent vitreous cavity Injection can also prevent the increase of intraocular pressure caused by injection.

Step 3) Use the micro-syringe again to insert the needle from the original needle port, and slowly inject 1.5ul of the prepared CTB-555 solution into the vitreous cavity of the mouse. After the injection, stay for 5 minutes until the reagent fully infiltrates the vitreous cavity, and then pull out the needle to prevent reflux. Tobramycin and dexamethasone eye ointment was applied after the operation to prevent infection, and the animals were transferred to the incubator until they recovered from anesthesia and returned to the cage for feeding. After close observation, those with lens opacity, massive hemorrhage in vitreous cavity and large-scale retinal detachment were excluded.

Step 4) After 3 days, after the tracer is fully traced, the mice are anesthetized and sacrificed.

Step 5) Count the number of axons at 0.1, 0.2, 0.5, 1.0, and 1.5 mm from the injury. The axons on the CTB marker after the injury were regarded as regenerated axons, and the regenerated axons at different positions away from the injury point were counted, and the same slice layers of each optic nerve were used for statistics and the average number was taken.

See Figure 5, the statistical results of the regenerated axons at different distances from the injury in the experimental group and the control group.

It can be seen from Figure 5 that at different distances, the number of regenerated axons in the experimental group was significantly higher than that in the control group; the axon regeneration can extend to 1.5 mm. The results in Fig. 5 verify that the knockdown of the Porf-2 gene in retinal tissue by the adeno-associated virus (containing the recombinant adeno-associated virus vector expressing shRNA4) of this example can promote the regeneration of optic nerve axons after injury.

7-5. Detection of the effect of Porf-2 gene knockdown on the survival of RGC cells after optic nerve injury

Two weeks after the virus was expressed, the optic nerve clamp injury was performed on the mice of the experimental group and the control group according to the method of the above-mentioned part 5 (construction of the mouse optic nerve clamp injury model);

Two weeks after the optic nerve injury, perform immunofluorescent staining of retinal slices (see the operation in Section 7.2 above), use TUJ1 fluorescent staining to mark the surviving RGC cells, randomly select a field of view in each quadrant of the retinal slices, and use Image The J software counts the RGCs stained with TUJ1 fluorescence; thereby verifying the effect of Porf-2 gene knockdown on the survival of RGC cells after injury.

See FIG. 6 , the statistical results of RGC cell survival after immunofluorescent staining of retinal slices.

It can be seen from Figure 6 that the survival rate of RGCs in the control group is about 20%, while the survival rate in the experimental group is as high as 40%, which is significantly higher than that in the control group (P<0.01). This shows that using the adeno-associated virus (containing the recombinant adeno-associated virus vector expressing shRNA4) of this example to knock down the Porf-2 gene in retinal tissue can improve the survival rate of RGC cells after optic nerve injury.

7-6. Effect of knockdown of Porf-2 gene on recovery of visual function after optic nerve injury

Inject the virus into the vitreous cavity according to the above-mentioned part 7.1; after the virus is expressed for two weeks, perform the optic nerve clamp injury on the mice in the experimental group and the control group according to the method in the above-mentioned part 5 (construction of the mouse optic nerve clamp injury model) .

Afterwards, OCT detection and pupillary light reflex detection were performed on the mice to observe the changes in the visual function of the mice.

A. OCT detection method is as follows:

1) Spectral-domain optical coherence tomography (SD-OCT, Micron IV; Phoenix Research Laboratories, Pleasanton, CA, USA) was performed before and 7d, 14d, 21d, and 28d after optic nerve injury; Note: "Before optic nerve injury "Refers to the mice that have been injected with the adeno-associated virus in the above-mentioned part 7-1 and the virus is expressed for two weeks; "7d, 14d, 21d, 28d after injury" are the mice that have been injected with the adeno-associated virus in the above-mentioned part 7-1 , and after two weeks of virus expression, the optic nerve clamp injury was performed according to the method in the above-mentioned section 5, and then the mice were subjected to 7 days, 14 days, 21 days and 28 days respectively.

2) mice were anesthetized by intraperitoneal injection of pentobarbital sodium (100 mg/kg), and their pupils were dilated with 0.5% tropicamide and 0.5% phenylephrine hydrochloride eye drops;

3) During the imaging process, keep the cornea moist with 2.5% hypromide eye solution.

4) Carry out radial volume scanning (with the optic disc as the center, diameter 1.2mm), each volume consists of 100 b-scans and 1000 a-scans;

5) Use the InSight software of version 1.1.5207 (Phoenix Research Laboratories) to analyze the image;

6) 4 images (scans 1, 26, 51 and 76 at 0°, 45°, 90° and 135° in mouse face images) for retinal thickness measurement;

7) For each selected image, place vertical calipers on both sides of the optic nerve head, 500 μm away from the center of the optic nerve head;

8) Use calipers to measure the thickness of the ganglion cell complex (GCC), which consists of the three innermost layers of the retina: nerve fiber layer (NFL), ganglion cell layer (GCL) and inner plexiform layer (IPL);

9) The GCC thickness of each retina was taken as the average of a total of eight measurements.

B. The detection method of pupillary light reflex is as follows:

1) The device for measuring and analyzing the dynamic change of pupil diameter is provided by the research group of Academician Yang Xiongli, School of Medicine, Fudan University. Through this device, the change of pupil diameter of the mouse can be digitally photographed and automatically analyzed when the mouse is awake.

2) 4 weeks after the nerve injury, the pupil light reflex test was performed on the mice in the experimental group and the control group, and the pupil changes of the mice were analyzed;

3) The mice were dark-adapted for 24 hours before the test. During the test, the head of the mouse was braked, and the position between the camera and the pupil was adjusted so that the pupil was in the center of the screen and a clear and stable pupil image was obtained;

4) Give a light intensity of 1w/ ^m2 for 20s, detect the size of the pupil before and after contraction, and calculate the contraction amplitude (CA);

5) Convert the captured video into pictures for analysis.

According to the quantitative statistical results of the GCC thickness obtained after the above OTC detection, after 28 days (4 weeks) of optic nerve injury, the GCC thickness of the mice in the control group (injected with the interference control virus) was about 30.14±1.82 μm, and the mice in the experimental group The GCC thickness (injected with the adeno-associated virus of the present embodiment) is about 40.78 ± 2.57 μm; the data of the experimental group are significantly higher than the data of the control group (p<0.05, there is a significant difference), which shows that using the method of the present embodiment Knockdown of the Porf-2 gene in retinal tissue by adeno-associated virus (containing a recombinant adeno-associated virus vector expressing shRNA4) prevented the thinning of the ganglion cell complex layer after optic nerve injury.

From the results of pupillary light reflex detection, after optic nerve injury 28d (4 weeks), the pupil contraction rate of control group mice (injected interference control virus) was 53.88 ± 3.13%, and experimental group mice (injected this implementation The pupillary constriction rate of the adeno-associated virus of the example) was 73.70 ± 2.54%, and the data of the experimental group were significantly higher than the data of the control group (p<0.05, there was a significant difference), which indicated that the adeno-associated virus of the present embodiment (containing Recombinant adeno-associated virus vector expressing shRNA4) can knock down the Porf-2 gene in retinal tissue, which can promote the recovery of visual function after optic nerve injury.

It should be understood that although this description is described according to implementation modes, not each implementation mode only contains an independent technical solution, and this description in the description is only for clarity, and those skilled in the art should take the description as a whole, and each The technical solutions in the embodiments can also be properly combined to form other embodiments that can be understood by those skilled in the art.

The series of detailed descriptions listed above are only specific descriptions for feasible implementations of the present invention, and they are not intended to limit the protection scope of the present invention. Any equivalent implementation or implementation that does not depart from the technical spirit of the present invention All changes should be included within the protection scope of the present invention.

Claims (14)

1. Use of the Porf-2 gene in preparing or screening drugs for treating/improving nerve damage diseases.
2. The use according to claim 1, characterized in that: the use is the use of the isolated Porf-2 gene or Porf-2 protein in the screening of drugs for the treatment/improvement of nerve injury diseases.
3. The use according to claim 1 or 2, characterized in that: the nerve damage disease is an optic nerve damage disease.
4. An isolated nucleic acid molecule for treating/improving nerve damage diseases, characterized in that:

   The isolated nucleic acid molecule comprises double-stranded RNA and/or shRNA targeting the Porf-2 gene in the nerve tissue and knocking down the expression of the Porf-2 gene in the nerve tissue.
5. The nucleic acid molecule of separation as claimed in claim 4, is characterized in that:

   The target sequence of the Porf-2 gene is as shown in any one of SEQ ID NO: 1 to 6;

   The double-stranded RNA is siRNA, which comprises a first strand and a second strand complementary to each other to form an RNA dimer; the sequence of the first strand is identical or substantially identical to the target sequence of the Porf-2 gene;

   The shRNA comprises a sense strand fragment and an antisense strand fragment, and a stem-loop fragment connecting the sense strand fragment and the antisense strand fragment, the sequences of the sense strand fragment and the antisense strand fragment are complementary, and the sense The sequence of the strand fragment is identical or substantially identical to the target sequence of the Porf-2 gene.
6. A kind of expression carrier of the interfering nucleic acid of Porf-2 gene, it is characterized in that,

   The expression vector comprises a gene segment encoding the shRNA as described in claim 4 or 5, and the expression vector is capable of expressing the shRNA.
7. The expression vector according to claim 6, wherein,

   The expression vector is a recombinant virus vector, which is formed by cloning the gene fragment encoding shRNA as described in claim 4 or 5 into the coding region of the virus vector;

   The viral vector is any one of lentiviral vector, adeno-associated viral vector or retroviral vector.
8. The expression vector according to claim 7, wherein,

   The expression vector is a recombinant adeno-associated virus vector obtained by inserting the gene segment encoding the shRNA described in claim 4 or 5 into the coding region between the two ITR sequences of the adeno-associated virus vector.
9. The expression vector according to claim 8, wherein the adeno-associated virus vector is a serotype AAV2 vector.
10. A virus, characterized in that: the virus is obtained by transfecting a virus packaging system into a eukaryotic cell; and the virus packaging system comprises the expression vector according to claim 8 or 9.
11. A pharmaceutical composition, characterized in that the pharmaceutical composition comprises the virus according to claim 10, and a pharmaceutically acceptable carrier or excipient.
12. The pharmaceutical composition according to claim 11, wherein the pharmaceutical composition is in the form of an injection.
13. The expression vector as described in any one of claims 6 to 9, or the virus as claimed in claim 10, or the pharmaceutical composition as claimed in claim 11 or 12 in the treatment/improvement of nerve injury diseases aspects of application.
14. The application according to claim 13, characterized in that: the nerve damage disease is an optic nerve damage disease.

Images