CN113999919A

CN113999919A - Obesity regulation marker FKBP15 and application thereof

Info

Publication number: CN113999919A
Application number: CN202111283585.9A
Authority: CN
Inventors: 郭锡熔; 高建芳; 王星云; 沈丹; 张中晓; 徐丽玲; 彭舟; 张玲; 秦大妮
Original assignee: Shanghai Tong Ren Hospital
Current assignee: Shanghai Tong Ren Hospital
Priority date: 2021-11-01
Filing date: 2021-11-01
Publication date: 2022-02-01
Anticipated expiration: 2041-11-01
Also published as: CN113999919B

Abstract

The invention discloses a obesity regulation and control marker FKBP15 and application thereof, and belongs to the technical field of medicines. The invention discovers a novel obesity regulation marker FKBP15 for the first time, which can activate AMPK phosphorylation to inhibit differentiation of fat cells by inhibiting expression of FKBP15, thereby achieving the purpose of reducing accumulation of lipid droplets. The mechanism fills the blank of adipocyte differentiation research, provides a new thought for prevention and/or treatment of obesity, and is helpful for further clarifying adipocyte differentiation and obesity regulation and control mechanisms.

Description

Obesity regulation marker FKBP15 and application thereof

Technical Field

The invention belongs to the technical field of medicines, and particularly relates to a obesity regulation and control marker FKBP15 and application thereof.

Background

Obesity is a chronic dystrophic disease characterized by excessive accumulation of white adipose tissue in the body, mainly manifested by adverse health and other consequences caused by metabolic disorders, and is increasing at epidemic rate worldwide. The occurrence of obesity is related to genetic background and living environment, including socioeconomic status, life and eating habits. Obesity can lead to health problems such as type 2 diabetes, cardiovascular disease, hyperlipidemia, hypercholesterolemia, hypertension, and cancer. The current strategy for treating obesity mainly aims at promoting energy consumption by exercise and reducing energy intake by diet control, but has little effect because most obese patients are hard to insist; the surgical treatment can improve the symptoms of obesity, but is not generally selected if the obesity is serious. Up to now, there are five drugs approved for the treatment of obesity on the market abroad: in China, only orlistat is approved to be on the market by the current national drug administration and can be used for losing weight, and the drugs have some side effects, such as: lorcaserin is a drug which can reduce food intake and weight but does not affect energy metabolism, and the most common side effects are headache, dizziness, fatigue, nausea, dry mouth, constipation and the like; phentermine or compound phentermine/topiramate capsules: phentermine has the effect of suppressing appetite, topiramate can enhance satiety, and the main side effects of phentermine are hypertension, palpitation, headache, anxiety, dry mouth, constipation and the like; naltrexone/bupropion compound sustained-release tablets suppress appetite through the central nervous system, promote energy consumption, and have common side effects of nausea, vomiting, constipation, diarrhea, insomnia and the like. Patent CN102225078A discloses an obesity agent, which uses the microorganism of lactobacillus rhamnosus as the effective component, and has better effectiveness and safety. Patent CN103442561A discloses the ability of calebin a to inhibit adipogenesis and its use in obesity management, and significant biological regulatory properties of calebin a include inhibition of leptin production, increased expression of adiponectin, and inhibition of local (adipocytes) and systemic inflammation caused by the pro-inflammatory cytokines tumor necrosis factor (TNF- α), interleukin-6 (IL-6) and interleukin-1 (IL-1 β). The lack of effective means for preventing and treating obesity makes the global obesity population rapidly increase and the obesity population not decrease or increase, which has become a global serious public health problem. Therefore, the active search for effective obesity treatments has been elusive.

The FKBP15 gene is located in human chromosome chr9: 113161006-113221318; the total length of mRNA is 8807BP, wherein the 5 'UTR is 75BP long, the CDS region is 3660BP, the 3' UTR region is 5072BP long, and 1219 coded amino acids; 60313, 28 exons in total, and 3D structure prediction results show that the FKBP15 protein consists of 9 alpha helices and 8 irregular folds; in vertebrates, the coding region gene sequences are relatively conserved. FKBP15 is one of the members of the FK506 binding protein Family (FKBP), which is part of a highly conserved immunophilin family, and its members play an important role in regulating signaling pathways involved in cell differentiation, inflammation, adaptive immune response, cancer, and developmental biology.

Therefore, it is highly desirable to provide a new intervention target for obesity treatment, and provide a new concept for obesity prevention and/or treatment.

Disclosure of Invention

The purpose of the invention is as follows: in order to overcome the defects in the prior art, the invention provides a novel obesity regulation marker FKBP15 and application thereof. The invention firstly discovers that AMPK phosphorylation can be activated through inhibiting the expression of an FKBP family member FKBP15, so that the differentiation of fat cells is inhibited, and the aim of reducing the accumulation of fat droplets is fulfilled.

The technical scheme is as follows: in order to achieve the purpose, the technical scheme of the invention is as follows:

in one aspect, the invention provides the use of FKBP15 in the preparation of an obesity modulating product.

In another aspect, the invention provides a adiposity modulating product comprising a modulator of FKBP 15.

Specifically, the product is a medicine or a health-care product.

Further specifically, the medicament also comprises a pharmaceutically acceptable carrier, wherein the carrier is any one or more of a sustained release agent, an excipient, a filler, a binder, a wetting agent, a disintegrating agent, an absorption enhancer, an adsorption carrier, a surfactant or a lubricant.

Specifically, the anti-obesity drug is any one of an external preparation, an oral preparation or an injection preparation.

Further specifically, the external preparation is a spray or an aerosol.

More specifically, the oral preparation is any one of granules, capsules, tablets or vesicular agents.

More specifically, the injection preparation adopts intradermal, subcutaneous, intramuscular, topical or intravenous injection as the administration mode.

In yet another aspect, the invention provides the use of FKBP15 as a target for obesity regulation.

In still another aspect, the present invention provides the use of FKBP15 in the preparation of an AMPK phosphorylation pathway modulating product.

In yet another aspect, the present invention provides an AMPK phosphorylation pathway modulation product comprising a modulator of FKBP 15.

Specifically, the product is a medicine or a health-care product.

In yet another aspect, the invention provides the use of FKBP15 as a regulatory target of the AMPK phosphorylation pathway.

In another aspect, the invention provides the use of FKBP15 in the preparation of an obesity detection product.

In yet another aspect, the invention provides a fatness detection product comprising a detection reagent that binds to a transcription or translation product of FKBP 15.

Specifically, the product includes but is not limited to a separate reagent, chip or kit.

More specifically, the product includes but is not limited to a gene detection kit or a protein expression detection kit.

In still another aspect, the invention provides the use of FKBP15 as a target for obesity detection.

Has the advantages that: compared with the prior art, the invention has the advantages that:

1) the invention discovers a novel obesity regulation marker FKBP15 for the first time, which can activate AMPK phosphorylation to inhibit differentiation of fat cells by inhibiting expression of FKBP15, thereby achieving the purpose of reducing accumulation of lipid droplets.

2) The invention provides a novel intervention target FKBP15 for preventing and/or treating obesity, provides a novel idea for preventing and/or treating obesity, and is helpful for further clarifying adipocyte differentiation and obesity regulation and control mechanisms.

3) The marker FKBP15 is used for regulating and controlling obesity, and has better safety and effectiveness.

Drawings

FIG. 1 is a fluorescent effect test chart of FKBP15 for knocking down lentivirus and infecting human precursor adipocytes by overexpression lentivirus, wherein A: FKBP15-RNAi virus infected human precursor adipocytes, GFP fluorescent staining 72h post infection, MOI: 10, 200 ×; b: FKBP15 overexpressing virus infected human preadipocytes, GFP fluorescent staining 72h post infection, MOI: 10, 200 x.

FIG. 2 is a graph showing the expression abundance in FKBP15-RNAi and overexpressed lentivirus infected human white precursor adipocytes, wherein A: FKBP 15-expression of mRNA of FKBP15 after infection of human preadipocytes by RNAi virus; b: expression of mRNA of FKBP15 following infection of human preadipocytes by FKBP15 overexpressing virus.

FIG. 3 is a graph showing the effect of RNAi and overexpressed lentivirus infection of FKBP15 on proliferation of preadipocytes, wherein A: the effect on proliferation of white preadipocytes after FKBP 15-RNAi; b: effect of FKBP15 overexpression on proliferation of white precursor adipocytes.

Fig. 4 is a graph showing the effect of FKBP15 knockdown or overexpression on adipogenesis of human white precursor adipocytes, wherein a: FKBP 15-oil red O staining after differentiation and maturation of human white preadipocytes infected by RNAi (400X). B: results of over-expression of FKBP15 oil red O staining (400 ×); c: FKBP15-RNAi infects the intracellular triglyceride content of the human white precursor adipocyte after differentiation and maturation; d: intracellular triglyceride content following overexpression of FKBP 15; e: FKBP 15-expression of adipogenic genes (CEBP. alpha., CEBP. beta., PPAR. gamma.) after RNAi.

FIG. 5 is a graph showing the results of the mechanism of inhibiting adipocyte differentiation after knockdown of FKBP15, wherein A: functional significance analysis of FKBP15 and its downstream target gene; b: changes in the expression level of P-AMPK alpha 2 protein following FKBP15 knockdown.

Detailed Description

The present invention will be further illustrated in detail with reference to the following specific examples, which are not intended to limit the present invention but are merely illustrative thereof. The experimental methods used in the following examples are not specifically described, and the materials, reagents and the like used in the following examples are generally commercially available under the usual conditions without specific descriptions.

The examples, where no specific techniques or conditions are indicated, are carried out according to the techniques or conditions described in the literature of the art (for example, see J. SammBruk et al, molecular cloning, A laboratory Manual, third edition, scientific Press, ed. by Huang Pe, et al) or according to the instructions of the product.

The invention adopts independent repeated experiments, and the experiments are repeated for 3 times. The experimental data are analyzed by SPSS18.0 statistical analysis software, the measured data are expressed by mean +/-standard deviation, the mean of the two samples is compared, and after the normality test and the homogeneity test of the variance, the difference is suggested to have statistical significance by adopting t or t' test, wherein P is less than 0.05.

Example 1 FKBP15 Gene study

The present invention screens differential expression Genes (differential expressed Genes) in fat tissues of fat and normal human omentum by using an inhibitory subtractive hybridization (SSH) technology, further screens a human adipose tissue cDNA library after obtaining differential expression gene fragments, and clones a gene-FKBP 15(GenBank accession number: 23307) which expresses significant up-regulation in fat tissues of fat people. The expression difference of the gene in the fat tissues of the omentum of the obese person and the normal person is verified by applying an RT-PCR technology and a Westernblot technology, and the expression difference of the gene between the obese person and the normal person is up to 8 times, and the intra-group difference is small.

Example 2 Effect of FKBP15 knockdown or overexpression on adipogenesis of human white adipocytes

FKBP15 overexpression lentivirus and RNAi-Easy lentivirus vector construction and packaging

On a cellular or individual level in mammals, the biological function can be explored by expressing the gene without altering and disrupting the genomic sequence. At the cellular level, an overexpression vector suitable for cells can be constructed to transfect the cells or an overexpression virus infection target cell can be prepared, and a transient overexpression or stable overexpression cell line can be achieved. Compared with adenovirus, lentivirus has lower titer generated during packaging and can be expressed in 2-4 days, but the lentivirus can randomly integrate a target gene into a cell genome to construct a stable cell strain. The cells of the invention need to be passaged for many times, the time for inducing differentiation is 8d, and a stable cell line is needed, so the slow virus packaging plasmid is selected and constructed. The FKBP15 overexpression lentivirus and RNAi lentivirus are constructed and packaged by molecular biological means known by technicians in the field and entrusted to Shanghai Jikai gene medicine science and technology GmbH.

2. Identification of Lentiviral vectors carrying the FKBP15 Gene

To investigate whether the packaged FKBP15 lentiviral concentrate could successfully infect human preadipocytes, cells were seeded into six-well plates (cell density about 1X 10)⁶Perwell), when the degree of cell fusion is about 50%, 20. mu.L (1X 10) of the virus is added to each of the negative control group LV-FKBP15, the knockdown test group (LV33-KD-FKBP15) and the overexpression test group (LV-OE-FKBP15)⁸TU/mL), blank control (no viral infection, abbreviated Ctrl group) 20. mu.L of PBS was added and the auxiliary reagent Polybrene was finally infectedThe concentration is 6 mug/mL, the MOI is 10, 1mL of serum-containing culture solution is added after 4h of infection, the serum-containing culture solution is replaced by a normal culture solution containing serum after 24h of infection, and green fluorescence can be expressed in cells after successful virus infection. Cells had no green fluorescent signal before virus infection; after 72 hours of virus infection, the number of cells with fluorescence is increased, the fluorescence intensity is increased and is clearly visible. The results of the detection are shown in FIG. 1.

The results in FIG. 1 show that both LV33-KD-FKBP15 and LV-OE-FKBP15 viruses can successfully infect human preadipocytes, the fluorescence signal of the infected cells is strong after 72h infection, and the fluorescence can be maintained after continuous culture.

FKBP15 knockdown and overexpression of intracellular abundance expression of lentiviral infection

The detection is carried out by using a Real-time PCR experiment, and the specific detection steps are as follows:

3.1. total RNA extraction from cells

Precooling at 4 ℃ by using a centrifugal machine, and preheating RNase-Free ddH at 65 DEG C₂O, the laboratory bench was wiped with 75% alcohol, cleaned gauze, and sprayed with RNaseZap before operation.

1) Taking out the cell lysate (Trizol) frozen at-80 ℃, and after the lysate is melted, placing the cell lysate at room temperature for lysis for 10 min.

2) In proportion (Trizol: chloroform-1: 0.2) adding chloroform, shaking vigorously for 30sec, then centrifuging at 12000rpm/min at 4 ℃ for 15 min. After centrifugation, the liquid is divided into three layers: aqueous phase (colorless upper layer), intermediate phase (white), organic phase (red lower layer).

3) And (3) taking 300 mu L of the upper aqueous phase, transferring the upper aqueous phase into a new RNase-Free centrifuge tube, adding 1.5 times of volume of absolute ethyl alcohol, and carrying out centrifugation after fully and uniformly mixing Votex.

4) A700. mu.L sample was applied to RNase-Free adsorption column, centrifuged at 12000rpm for 30sec at room temperature, and the tube liquid was discarded.

5) Adding deproteinizing solution RW1, 350 μ L/tube, centrifuging at 12000rpm at room temperature for 30sec, and discarding the liquid in the tube; and repeating the steps once.

6) Adding rinsing solution RW, 500 μ L/tube, standing for 2min, centrifuging at 12000rpm at room temperature for 30sec, and discarding the liquid in the tube; and repeating the steps once.

7) And (4) performing air separation at the room temperature of 12000rpm for 2min, transferring the adsorption column into a new RNase-Free 1.5mL centrifuge tube, and placing the centrifuge tube in a fume hood for 8-10min for airing.

8) Add 30. mu.L of preheated RNase-Free ddH per tube₂O, tightly covering the tube cover, and centrifuging at the room temperature of 12000rpm for 2min for elution. The adsorption column was discarded and the resulting RNA was frozen at-80 deg.C (possibly on ice).

9) The concentration of the extracted RNA samples, OD260/280 and OD230/260 were measured using a NanoDrop ND-1000 spectrophotometer.

3.2. Reverse transcription reaction (Takara RR036A)

RT reaction was prepared as follows according to the composition of Table 1 (reaction preparation was carried out on ice).

TABLE 1

Reagent	Amount of the composition used	Final concentration
			5×PrimeScript RT Master Mix(Perfect Real Time)	8μL	1×
Total RNA	32μL	-
			RNase Free ddH₂O	upto40μL	-

A maximum of 2000ng of Total RNA was used in a 40. mu.L reaction.

After gentle and uniform mixing, carrying out reverse transcription reaction, wherein the reaction procedure is as follows: 15min at 37 ℃ (reverse transcription); 5sec at 85 ℃ (inactivation reaction of reverse transcriptase); 4 ℃ forever.

Note that: the obtained RT reaction solution was added to the next Real Time PCR reaction system in an amount not exceeding 1/10(V/V) of the Real Time PCR reaction volume.

Realtime PCR assay (applied biosystems, PowerUp)^TM SYBR^TM Green Master Mix，A25743)

1) Before using the reagent, please fully swirl and mix the reagent;

2) three replicates per sample were performed;

3) the reaction system is 10 mu L;

4) preparing a reaction system:

the PCR reaction system was prepared according to the following Table 2 (Note: when a plurality of reaction wells were prepared, a margin of 5 wells was reserved for each component so as not to be lost by a pipette).

TABLE 2

Composition of matter	10 μ L system
		2×PowerUp SYBR Green Master Mix	5μL
Forward primer and reverse primer^[1]	0.5μL/0.5μL
		cDNA template and ddH₂O^[2]	1μL/3μL
Total volume	10μL

^[1]The final concentrations of the forward and reverse primers are recommended to be 300-800nM respectively;^[2]it is recommended to use 1-10ng cDNA or 10-100ng gDNA per reaction well.

The forward and reverse primers are shown in Table 3 below.

TABLE 3

Gene	Forward Sequence(5'to 3')	SequenceReverse(5'to3')
			H-PPIA	TTCATCTGCACTGCCAAGAC	TCGAGTTGTCCACAGTCAGC
H-FKBP15	ACAGCTCTCACCAAGCAAA	CCGTAAGGACTGGAACACC

After the reaction system is prepared, a reaction cover is covered, and the mixture is fully vortexed, uniformly mixed and centrifuged. The reaction solution was dispensed into each reaction well. Sealing the film, centrifuging to avoid generating bubbles.

5) Run qPCR reaction program: the reaction plate was placed on a fluorescent quantitative PCR instrument, a rapid or standard PCR reaction program was selected as required, and the reaction parameters were set according to the following table.

Standard mode (primers Tm. gtoreq.60 ℃ C., Table 4 below):

TABLE 4

Set melting curve mode (table 5 below):

TABLE 5

Phases	Speed of temperature rise and fall	Temperature of	Time
				1	1.6 deg.C/sec	95℃	15 seconds
2	1.6 deg.C/sec	60℃	1 minute
				3	0.15 deg.C/sec	95℃	15 seconds

The relative expression level of mRNA was calculated by the Delta CT methodNormalized with PPIA): relative mRNA expression level of 2^{(△CT(control)-△CT(mRNA))}

As shown in fig. 2, the expression level of FKBP15 in the FKBP15-RNAi group was significantly decreased compared to the control group, and the expression level of FKBP15 in the OE-FKBP15 group was nearly 6-fold higher than the control group, which was very significantly different. This demonstrates the success of constructing cells that can stabilize RNAi and overexpress FKBP 15.

4. Effect of human preadipocyte FKBP15-RNAi and overexpression of FKBP15 on cell proliferation

Human visceral preadipocyte suspension was seeded at 100. mu.L of approximately 3000 cells per well in 96-well plates at an MOI of 10 using FKBP15 to overexpress lentivirus (1. mu.L, 1X 10)⁸TU/mL) and RNAi-Easy lentivirus (1. mu.L, 1X 10)⁸TU/mL) was infected and cell proliferation was detected using CCK8 kit. After 24h, 48h and 72h, 10. mu.L of CCK8 solution was added to each well, the culture was incubated for 1h in an incubator, and the absorbance (A) was measured at 450 nm. The results of the detection are shown in FIG. 3.

FIG. 3 shows FKBP15 overexpressing lentivirus (1. mu.L, 1X 10)⁸TU/mL) and RNAi-Easy lentivirus (1. mu.L, 1X 10)⁸TU/mL) had no significant effect on proliferation of precursor adipocytes after infection.

Effect of FKBP15 knockdown or overexpression on adipogenesis of human white precursor adipocytes

In order to research the influence of FKBP15 on fat differentiation, cells of FKBP15-RNAi and cells over expressing FKBP15 were obtained respectively, differentiation was induced for cell adipogenesis, changes in intracellular lipid droplet accumulation were observed by methods such as oil red O staining and triglyceride detection, and changes in expression levels of adipogenic marker genes (CEBP alpha, CEBP beta, PPAR gamma) were detected by qPCR technology.

5.1. Precursor adipocyte induced differentiation protocol

(1) Induction differentiation agent I (100mL system): DMEM/F12 medium: 97.2 mL; IBMX: weighing 11.5mg, adding 500 mu L of 0.5N KOH for dissolving; insulin (1 mg/mL): 290 μ L, final concentration 500 nM; dexamethasone (0.1 mM): 1mL, final concentration 1. mu.M; rosiglitazone (20 mM): 5 μ L, final concentration 1 μ M; P/S: 1 mL. The maintenance period is 4 days.

(2) Induction differentiation agent II (100mL system): DMEM/F12 medium: 98.7 mL; insulin (1 mg/mL): 290 μ L, final concentration 100 nM; P/S: 1 mL. The maintenance period is 4 days.

5.2. Oil red O dyeing

1) Removing the culture medium of the differentiated mature fat cells, washing for 2 times by PBS (phosphate buffer solution), and fixing for 30min by 1 mL/hole of 4% paraformaldehyde;

2) preparing an oil red O staining solution: preparing a working solution by using an oil red O staining kit (Sciencell oil red O kit 0843): stock solution: ddH₂The proportion of O is 3: 2;

3) and (3) filtering: preparing the dissolved oil red, filtering for 2 times by using a 0.22 mu m filter membrane, and carefully and softly operating;

4) fixing: washing the cells for 3 times by PBS, and fixing for 20min by Sciencell cell fixing solution;

5) dyeing: removing the fixed cells, sucking away the fixing solution, washing twice with PBS, adding oil red working solution, placing in a 37 ℃ incubator, and dyeing for 30 min;

6) after dyeing is finished, the dyeing solution is discarded, and ddH₂O rinsing for 5 times, and taking care not to directly rinse the cells; an appropriate amount of PBS was added and photographed under a microscope.

5.3. Triglyceride test for fat formation (Polycosal tissue triglyceride determination kit E1013)

1) Cell lysis: differentiating mature adipocytes, washing with PBS 1-2 times to remove glycerol, and then scaling each 1X 10⁶Adding 0.1mL of lysate into each cell, scraping the cells by a pipette tip, uniformly mixing, and standing for 10 minutes at room temperature;

2) and (3) processing a lysate: sucking a proper amount of supernatant, transferring the supernatant into a 1.5mL centrifuge tube, and carrying out protein quantification on the rest lysate by using a protein quantification kit by using a BCA method; placing the cell lysate at 70 deg.C, mixing well and heating for 10 min; centrifuging at room temperature of 2000 × rpm for 5min after heating, and performing enzymology detection on supernatant;

3) preparing a working solution: reagent R1 and reagent R2 were mixed as 4: mixing at a ratio of 1, preferably preparing on the same day, and removing discoloration;

4) diluting a standard product: diluting 4mM glycerol standard substance with distilled water or liquid consistent with buffer solution at equal ratio, generally 4-6 tubes, and setting 0 concentration control reaction tube;

5) uniformly mixing a sample to be detected with 10 mu L/hole and working solution with 190 mu L/hole, placing at 37 ℃ for 10min or 25 ℃ for 30min, and stabilizing the color within 60min after reaction balance;

6) the OD of each tube was measured at 550 nm.

qPCR technology for detecting the change of expression level of adipogenic marker genes (CEBP alpha, CEBP beta and PPAR gamma)

The detection method is the same as the step 3.

The forward and reverse primers are shown in Table 6 below.

TABLE 6

Gene	Forward Sequence(5'to3')	SequenceReverse(5'to 3')
			H-PPIA	TTCATCTGCACTGCCAAGAC	TCGAGTTGTCCACAGTCAGC
H-CEBPα	CTGTGTCACCACCCAAATCCTTAT	TGTGTCGAGAAAAGGACCTTGA
			H-CEBPβ	GACAAGCACAGCGACGAGTA	AGCTGCTCCACCTTCTTCTG
H-PPARγ	GCTGTGCAGGAGATCACAGA	GGGCTCCATAAAGTCACCAA

The results are shown in FIG. 4. Oil red O staining showed significant inhibition of lipid formation levels in the differentiated 8d, LV33-KD-FKBP15 group compared to the control group, whereas LV-OE-FKBP15 group was significantly elevated compared to the control group, corresponding to 400 Xlight microscopy. Triglyceride results showed that intracellular accumulation of triglycerides was significantly reduced in LV33-KD-FKBP15 group compared to the control group, whereas intracellular accumulation of triglycerides was significantly increased in LV33-OE-FKBP15 group compared to the control group. Therefore, FKBP15 can significantly influence adipocyte differentiation after being knocked down. The mRNA level changes of LV33-KD-FKBP15 composition lipid differentiation marker genes CEBP alpha, CEBP beta and PPAR gamma are detected, and the result shows that the FKBP15 can obviously inhibit the expression of the CEBP alpha, CEBP beta and PPAR gamma genes after being knocked down.

Example 3 study of the Effect of FKBP15 on the mechanism of adipocyte differentiation

In order to explore the mechanism research of FKBP15 affecting adipocyte differentiation, a website related to the biological information analysis is further used for knowing that: FKBP15 has a negative role in regulating phosphatase activity (see fig. 5). GO analysis shows that FKBP15 has negative regulation effect on phosphatase activity, and AMPK phosphorylation level is inhibited to obviously inhibit differentiation of fat cells. Therefore, changes in AMPK phosphorylated protein levels were further examined using western blot experiments.

1. Extracting cell protein:

the cell culture dish was filled with a 4 ℃ pre-cooled RIPA lysate (containing protease inhibitor and phosphatase inhibitor) at 500 μ L/well, and the cells were collected in a 1.5mL EP tube by scraping with a pipette tip and allowed to stand on ice for 30 min. After the lysis is finished, centrifuging for 30min at 4 ℃ and 12000rpm, and taking supernatant to obtain the extracted protein.

Protein quantification by BCA method (Biyunyan, China, Cat: P0012):

1) preparing a working solution: solution A: solution B is 50: 1;

2) the protein standard was formulated as follows:

protein standards (μ L)0, 1, 2, 4, 8, 12, 16, 20;

PBS (or ddH)₂O)(μL)20、19、18、16、12、8、4、0。

3) Sample adding: samples (can be diluted according to experience in proper amount)/standard substance 20 mu L/hole, working solution 200 mu L/hole, carefully mixing;

4) reacting at 37 ℃ for 30 min;

5) the OD was measured at a wavelength of 562 nm. Protein concentrations were calculated from the standard curve.

Western Blot experiment

1) Loading with preformed gel (Tiandi and, China, SLE 009):

adjusting the sample loading volume according to the concentration of the measured protein, wherein the sample loading volume is generally 20-80 mu g/hole and 10-30 mu L;

2) electrophoresis:

constant voltage electrophoresis is generally adopted, 70V 30min, and the voltage is adjusted to 140V 60min after the protein marker strip is separated. Cutting the glue in a required range according to the molecular weight of the target protein;

3) film transfer:

cutting a PVDF membrane according to the size of the glue, soaking in methanol for 2-3min for activation, removing bubbles between the membrane and the glue during membrane conversion, 300mAh, 90min, cooling, and placing in an ice box (membrane conversion current mainly depends on the molecular weight of a target protein);

4) and (3) sealing:

after the membrane transfer, the membrane was transferred to a WB antibody incubation box, and an appropriate amount of blocking solution, typically 5% skim milk powder, was added. Sealing the shaking table at room temperature for 1-2 h;

5) primary antibody incubation (table 7):

diluting the antibody with an anti-diluent according to the antibody specification, and incubating overnight at 4 ℃ in a shaker;

6) first resistance recovery:

recovering primary antibody, washing membrane with TBST (Yazyme, China, Cat: PS103S) for 3 times, each time for 10 min;

7) secondary antibody incubation (table 6):

HRP-labeled secondary mouse or rabbit antibodies, diluted with secondary antibody 1: diluting with 5000, and incubating at room temperature for 1-2 h;

8) and (3) secondary antibody recovery:

recovering the secondary antibody, washing the membrane with TBST for 3 times, and each time for 10 min;

9) and (3) developing:

using ECL detection (ECL Western Blotting Kit, Pierce, Inc.), mixing reagent 1 and reagent 2 in equal volumes, directly applying to the membrane (protein-containing side up), taking care that no air bubbles remain, Blotting excess developer, exposing in a gel imaging system, scanning and quantifying the optical density of the bands.

TABLE 7

Name of antibody	Species of species	Brand	Goods number
				β-actin	Rabbit	Affinity Biosciences	AF7018
P-AMPKα2	Rabbit	Affinity Biosciences	AF3423

The detection result is shown in fig. 5, the p-AMPK alpha protein level of the mature fat cells is obviously up-regulated after FKBP15 is knocked down, and the fact that FKBP15 can influence the differentiation of the fat cells through the negative regulation of the activity of AMPK alpha 2 phosphatase is proved.

The above description is only of the preferred embodiments of the present invention, and it should be noted that: it will be apparent to those skilled in the art that various modifications and adaptations can be made without departing from the principles of the invention and these are intended to be within the scope of the invention.

Sequence listing

<110> Hospital of Shanghai city

<120> obesity regulation and control marker FKBP15 and application thereof

<130> 20211017

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 1

ttcatctgca ctgccaagac 20

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 2

tcgagttgtc cacagtcagc 20

<210> 3

<211> 19

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 3

acagctctca ccaagcaaa 19

<210> 4

<211> 19

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 4

ccgtaaggac tggaacacc 19

<210> 5

<211> 24

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 5

ctgtgtcacc acccaaatcc ttat 24

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 6

tgtgtcgaga aaaggacctt ga 22

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 7

gacaagcaca gcgacgagta 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 8

agctgctcca ccttcttctg 20

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 9

gctgtgcagg agatcacaga 20

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 10

gggctccata aagtcaccaa 20

Claims

Application of FKBP15 in preparing obesity regulating product is provided.
2. A obesity regulating product characterized by: the product comprises a regulator of FKBP 15.
3. The product of claim 2, wherein: the product is a medicine or a health-care product.
The application of FKBP15 as an obesity regulation target.
Application of FKBP15 in preparing AMPK phosphorylation pathway regulation products.
6. An AMPK phosphorylation pathway regulation product characterized by: the product comprises a regulator of FKBP 15.
Application of FKBP15 as AMPK phosphorylation pathway regulation target.
The application of FKBP15 in preparing obesity detection products.
9. A fat detection product, characterized in that: the product comprises a detection reagent which binds to a transcription or translation product of FKBP 15.
The application of FKBP15 as an obesity detection target.