CN113999855B - Rice leaf tone control gene mOsFC2 and application thereof - Google Patents
Rice leaf tone control gene mOsFC2 and application thereof Download PDFInfo
- Publication number
- CN113999855B CN113999855B CN202111271537.8A CN202111271537A CN113999855B CN 113999855 B CN113999855 B CN 113999855B CN 202111271537 A CN202111271537 A CN 202111271537A CN 113999855 B CN113999855 B CN 113999855B
- Authority
- CN
- China
- Prior art keywords
- mosfc2
- rice
- gene
- leu
- mutant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/825—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/8269—Photosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Analytical Chemistry (AREA)
- Botany (AREA)
- Mycology (AREA)
- Nutrition Science (AREA)
- Immunology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Physiology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a rice leaf tone control gene mOsFC2 and application thereof, and the invention clones the rice yellow leaf gene mOsFC2 by a map-based cloning method for the first time. The OsFC2 single base mutant (mOsFC 2) has the biological functions of regulating and controlling plant photosynthetic pigment synthesis and improving photosynthesis efficiency. Enzyme activity determination of OsFC2 protein, subcellular localization, and mOsFC2 transgenic experiment verify the function of the gene in rice. The rice Nippon sunny is transformed by constructing a single-base mutant mOsFC2 expression vector, and the transgenic plant has the phenotype that leaves are yellow leaves under the low-temperature (19 ℃) growth condition and the leaves are restored to green leaves under the high-temperature condition. Namely, single base mutation of the OsFC2 gene can produce yellow-green leaves. In addition, the single base mutant mOsFC2 gene can regulate the content of photosynthetic pigment in rice in a mode of incomplete dominant mutation, and the mOsFC2 mutant can be used as a marker gene for identifying seed purity in hybrid rice, thereby providing a new gene resource for breeding and researching seed purity identification for improving photosynthetic efficiency of rice leaves.
Description
Technical Field
The invention relates to the technical field of plant genetic engineering, in particular to a rice leaf tone control gene mOsFC2 and application thereof.
Background
The rice is used as the grain crop with the largest planting area in China, and plays a role in the grain safety. With the increasing population, the continuous reduction of cultivated land area and the improvement of rice yield are one of the important challenges facing rice breeders today. Photosynthesis efficiency is one of important factors for determining rice yield, and the improvement of leaf photosynthesis efficiency can greatly improve rice yield.
The site of photosynthesis of plants is chloroplast, and the content of photosynthetic pigments in chloroplast directly determines photosynthesis efficiency. Therefore, screening for leaf color mutants, particularly those with improved photosynthetic efficiency, is very important. Currently, although a large number of leaf color mutants of rice, such as virucide mutants (v 1, v2 and v 3), ylc1, ylc2 OsV5, cde1 (t) and the like, have been found, most leaf color mutants have hindered photosynthesis, often have greatly reduced photosynthesis efficiency, resulting in reduced yield, and have severely inhibited breeding studies to increase rice yield by improving photosynthesis efficiency by changing the leaf color of rice. The rice yellow-green leaf mutant ygl1 is a natural mutant derived from a cultivar Zhenhui 249, the early leaf of the mutant is yellow, the middle stage of the mutant slowly turns green, and the later leaf color is close to that of the wild type. The ygl1 mutant has higher photosynthetic efficiency and stronger light-tolerant inhibition ability than the wild type, and thus still can obtain higher yield (Wu Ziming et al 2007). As a result of gene cloning, it was found that YGL1 gene encodes chlorophyll synthase a and catalyzes chlorophyll acid esters to chlorophyll a (Wu Ziming et al 2007). The discovery and gene cloning of the rice ygl1 mutant show that the aim of increasing photosynthesis efficiency and further improving yield can be achieved by properly changing the chlorophyll content of rice leaves.
Leaf color marking is a simple, economical and effective method of seed purity identification. Most of the genes for rice leaf color marking reported at present are recessive, and hybrid rice F cannot be distinguished 1 And hybrid plants, and simultaneously, the early growth of the leaf color mutant is slow, so that the vegetative growth of sterile lines and the preparation of hybrids are severely restricted.
Disclosure of Invention
The invention aims at overcoming the defects of the technology and providing a rice leaf tone control gene mOsFC2 and application thereof, and particularly comprises cloning and functional analysis of a rice mutant type OsFC2 gene (abbreviated as mOsFC 2) and application of the gene in plant leaf color, photosynthesis efficiency, yield and purity identification of hybrid rice seeds. Of particular importance is the use of the mOsFC2 gene in breeding to increase photosynthetic efficiency in rice and to identify seed purity.
The aim of the invention is achieved by the following technical scheme. A rice leaf tone control gene mOsFC2, said rice leaf tone control gene mOsFC2 having a nucleotide sequence having at least 90% homology with the nucleotide sequence shown in SEQ ID No. 1.
The nucleotide sequence of the gene includes a nucleotide sequence of a mutant, allele or derivative produced by adding, substituting, inserting or deleting one or more nucleotides in the nucleotide sequence shown in seq. ID No. 1.
A protein encoded by a rice leaf color control gene mOsFC2, said protein having an amino acid sequence that is at least 90% homologous to the amino acid sequence set forth in Seq ID No. 2.
The amino acid sequence of the protein is an amino acid sequence or derivative with the same function, wherein one or more amino acids are added, substituted, inserted or deleted in the amino acid sequence shown in the Seq ID No. 2.
An application of mOsFC2 containing the rice leaf color control gene in breeding and purity identification of hybrid rice seeds for changing the leaf color of rice and improving photosynthesis efficiency and yield.
The invention has the beneficial effects that: through screening work for many years, the bred rice yellow-green leaf mutant mosfc2 has an incomplete dominant genetic mode, the leaf photosynthesis efficiency is increased, and the nutrition growth and the yield are normal. The results of the map-based cloning showed that the OsFC2 gene in the mosFC2 mutant was subjected to a single base (SNP) mutation, and the mutated form of the gene was designated as mOsFC2. According to the genetic characteristics, the mOsFC2 gene can be used as a leaf color marker gene for identifying the purity of seeds, and has important breeding value.
Drawings
FIG. 1 a.19deg.C light growth box conditions, growth of 12 days of the mosfc2 mutant; b. the mosfc2 mutant was grown in the field to heading stage.
FIG. 2 leaf photosynthetic pigment content of wild-type and mosfc2 mutants at heading stage.
FIG. 3 leaf net photosynthetic rates of heading stage wild-type and mosfc2 mutants.
FIG. 4. Transient expression of OsFC2 fusion sGFP vector in rice protoplasts.
FIG. 5 enzyme activity response of prokaryotic expression proteins of OsFC2 and mOsFC2 genes.
FIG. 6a phenotypes of different wild-type, ygl2 and heterozygous plants at low temperature (19 ℃); b phenotype of mOsFC2 transgenic seedlings at low temperature (19 ℃).
FIG. 7 shows different genotyping sequencing patterns.
Detailed Description
In the present invention, the materials and equipment used, unless otherwise specified, are commercially available or commonly used in the art. The methods in the following examples are conventional in the art unless otherwise specified.
The first object of the invention is to clone rice mOsFC2 gene, and the second object of the invention is to provide a novel method for regulating leaf chlorophyll content and increasing leaf photosynthesis efficiency. The method comprises a method for transferring mOsFC2 gene into rice to change leaf color of the rice and improve photosynthesis efficiency. A third object of the present invention is to provide leaf color marker genes and methods for purity identification of hybrid rice seeds. The method comprises breeding leaf color marked sterile line and maintainer line by using mOsFC2 gene through hybridization, gene editing and transgene, and developing a new method for identifying purity of hybrid rice seeds.
The mOsFC2 gene sequence and amino acid are shown in sequence tables SEQ ID NO.1 and SEQ ID NO.2 or basically correspond to the sequences of SEQ ID NO.1 and SEQ ID NO. 2. The mutated mOsFC2 gene sequence is 1581bp (base pair) long and codes 526 amino acids. In contrast to the OsFC2 gene, mutation of G to C at position 1402 of the mOsFC2 gene results in mutation of encoded aspartic acid to histidine.
Cloning, functional analysis and use of the mOsFC2 gene in the present invention.
1. Cloning of mOsFC2 Gene
1.1 screening and phenotypic characterization of the yellow-green leaf mutant, mosfc2, of Rice
The bred yellow leaf mutant mosfc2 has the phenotype of yellow seedlings in the seedling stage under the low temperature condition and recovers the phenotype of green leaves under the high temperature condition by an EMS mutagenesis method. When the field is planted to the heading stage, the photosynthetic pigment content of the mosfc2 yellow leaf mutant is about 70% of that of the wild type, and the net photosynthetic efficiency is increased by 15%.
1.2 genetic analysis and Gene cloning of yellow-green leaf mutant, mosfc2
The yellow leaf mutant mosfc2 was hybridized with Japanese sunny and was found to have a yellow-green phenotype at low temperatures (19 ℃) during the seedling stage. The separation ratio of yellow seedlings, yellow green seedlings and green seedlings in the F2 population is 1:2:1, and the research results show that the genetic mode of the yellow leaf mutant is incompletely dominant. The gene was successfully mapped and cloned by map-based cloning using yellow leaf mutants and the F2 population created by 9311, and the yellow leaf phenotype was found to be caused by a single base mutation of the key gene for chlorophyll synthesis OsFC2 (designated mOsFC 2). The whole length of the mOsFC2 mutant gene comprises a promoter and a terminator, and the promoter and the terminator are constructed into a binary expression vector Pcamcia 1300 to transform rice Nipponbare. The transgenic positive seedling has the phenotype of yellow seedling at low temperature, which indicates that OsFC2 is the mutant gene.
2. Subcellular localization of OsFC2
The fragment of the OsFC2 complete CDS (with the stop codon removed) is connected into a Pcamcia 1300-35S-NOS carrier by utilizing the homologous recombination technology, so that a target gene is fused with the N end of green fluorescent protein GFP, and after instantaneous expression is carried out by using rice protoplast, the positioning condition of the fused GFP protein is observed under a Leica TCS SP2 laser confocal microscope. OsFC2 was found to be a chloroplast-localized protein.
3. Enzyme Activity assay for OsFC2
The OsFC2 and mOsFC2 fragments are respectively connected into a vector pGEX-4T1-GST by utilizing the homologous recombination technology, and are converted into escherichia coli DE3 for expression, and the purified protein is used for enzyme activity reaction. Enzyme Activity reaction enzyme activity was calculated using the amount of zinc porphyrin zinc porphyrin IX (ZnProto) product using protoporphyrin protoporphyrin IX (Proto IX) and zinc sulfate (ZnSO 4) as substrates. The enzyme activity reaction found a reduction in enzyme activity of the mOsFC2 protein of about 50% compared to OsFC2.
4. mOsFC2 gene can regulate leaf color of rice
The genetic mode of the rice mOsFC2 gene is incomplete dominant, and under the low-temperature condition, the seedling stage of plants with different genotypes can be obviously divided into yellow, yellow-green and green. Since the mOsFC2 gene can change the chlorophyll content of rice leaves, the rice can be bred into light green rice varieties by hybridization, gene editing and other methods. Through many years of hybridization breeding, a sterile line (K2A) and a maintainer line with an mOsFC2 gene are successfully bred, and 3 indica-japonica rice combinations (Zheyou M1702, M1705 and M1710) are configured, and the three combinations have the advantages of strong heterosis, high yield, excellent rice quality, high later grouting speed and the like. The mOsFC2 gene can regulate the leaf color of rice, and is further applied to rice molecular breeding.
5. The genotype of mOsFC2 can accurately correspond to the phenotype of rice, and can be used for identifying the purity of seeds
The F2 population obtained by crossing yellow leaf mutant mosfc2 with Japanese sunny was used to identify the phenotype and genotype separation under 19 degrees low temperature growth conditions. The wild-type gene OsFC2 plants were found to be of the green leaf phenotype, heterozygous genotype plants were of the yellow-green phenotype, and plants of the homozygous mutant genotype mOsFC2 were found to be of the yellow-seedling phenotype. SNP loci can be accurately identified by sequencing PCR products. The mutation site of yellow leaf is transferred into sterile line and maintainer line of three-line hybrid rice by means of hybridization method to obtain new variety with leaf color mark gene. Specifically, the sterile line and the maintainer line at the seedling stage are yellow, the hybrid rice F1 seed is yellow-green, and other hybrid plants (restorer line, field-fall cereal plant, other hybrid plants mixed in the parent seed) are normal green. By utilizing the difference of leaf colors, the normal green plants are removed in the seed reproduction and seed production processes, so that the purity of sterile line and hybrid rice F1 seeds can be ensured.
mOsFC2 genotyping primer sequence:
FC2-6057F GCTTGCCTTATGTTGGTGCT
FC2-7513R TGAGACGGAGGGAGTAGACA
the invention discloses a rice leaf tone control gene mOsFC2 and application thereof, and the invention clones the rice yellow leaf gene mOsFC2 by a map-based cloning method for the first time. The OsFC2 single base mutant (mOsFC 2) has the biological functions of regulating and controlling plant photosynthetic pigment synthesis and improving photosynthesis efficiency. Enzyme activity determination of OsFC2 protein, subcellular localization, and mOsFC2 transgenic experiment verify the function of the gene in rice. The rice Nippon sunny is transformed by constructing a single-base mutant mOsFC2 expression vector, and the transgenic plant has the phenotype that leaves are yellow leaves under the low-temperature (19 ℃) growth condition and the leaves are restored to green leaves under the high-temperature condition. Namely, single base mutation of the OsFC2 gene can produce yellow-green leaves. In addition, the single base mutant mOsFC2 gene can regulate the content of photosynthetic pigment in rice in a mode of incomplete dominant mutation, and the mOsFC2 mutant can be used as a marker gene for identifying seed purity in hybrid rice, thereby providing a new gene resource for breeding and researching seed purity identification for improving photosynthetic efficiency of rice leaves.
It should be understood that equivalents and modifications to the technical scheme and the inventive concept of the present invention should fall within the scope of the claims appended hereto.
Sequence listing
<110> academy of agricultural sciences in Zhejiang province
<120> a rice leaf tone control gene mOsFC2 and use thereof
<160> 1
<210> 1
<211> 1581
<212> DNA
<213> Rice genus (oryza sativa)
<222> （1）…（220）
<400> 1
atgtggtcgt cgagccaggc gagcacgagg ggcgtgattg aggtggggag ggtggaggcg 60
gggccttccc atttccccaa gaggcccgcg ccgcggaatt cctccagggt caatctgtca 120
aggacatatg caattaaatc ttgttcagtg agtagccgta cagggctttg ccttggacaa 180
tgttatcata agaagtcttc tgcttgcaaa tgcaagttgg gatggtcttc tcaaccactg 240
tctagcttga ggcatcactt aagagtacat tcatcagcat cggaggcggt tcttacttcc 300
caatctgatt tcacaaaact tcttgttggg aatgaaaaaa ttggtgttct cttgctgaat 360
cttggaggtc cagagaccct tgatgatgtg cagcctttct tgtttaatct atttgctgat 420
ccggacatta tccgtcttcc tagattgttt cgctttcttc agaagccatt agcacaattt 480
atatctgttg taagagcacc aaagagcaag gaaggctatg catccatcgg tggtggttct 540
cctcttcgtc aaattactga tgcacaggct gaagcactga ggaaagcatt atgtgataaa 600
gatattcctg ccaaggtgta tgttggaatg cgttactggc atccattcac tgaggaagct 660
atagaacaaa taaaacggga tggcatcaca aaacttgttg tacttcctct gtacccccag 720
ttctccatat caactagtgg ttcaagtctc cgtttactgg agggcatatt cagagaggat 780
gagtatctgg tgaatatgca gcatacagtt ataccttcct ggtatcagag ggagggatat 840
atcaaggcta tggcaacttt gattgagaag gaactgcgaa cattttcaga accccaaaag 900
gttatgatat ttttcagtgc ccatggagtt cctctggcat atgtagaaga agctggtgat 960
ccatacaaag cagagatgga agagtgtgtg gatcttatca tggaggaact cgaaaaaaga 1020
ggaataacaa actcatgcac acttgcctat cagagccgag tggggccagt tgaatggctg 1080
aggccctaca ctgatgagac aattatcgag ttggggcaga aaggggtgaa gagccttcta 1140
gctgttccca tcagttttgt cagtgaacat attgaaactt tggaagaaat cgatgtagaa 1200
tacaaggagt tggctttaga atccggcatc aagcactggg gacgagttcc tgcattaggt 1260
tgtgaaccca cgttcataac agatcttgcc gatgctgtta ttgaaagctt gccttatgtt 1320
ggtgctatgg cagtttcaaa ccttgaagct cgacagccac tggtgccact tgggagtgtg 1380
gaagaactgc tagcggcgta ccactcgaaa cgcgacgagc tgccccctcc agtgactgta 1440
tgggagtggg gctggacgaa gagcgcggag acctggaatg gacgggctgc tatgctggcc 1500
gtgctggctc tcctagtgct ggaggtgaca accggagaag ggttcttgca ccagtggggc 1560
atcctgcctt tgttccactg a 1581
<210> 2
<211>526
<212> PRT
<213> Rice genus (Oryza sativa L.)
<220>
<400> 2
Met Trp Ser Ser Ser Gln Ala Ser Thr Arg Gly Val Ile Glu Val Gly
1 5 10 15
Arg Val Glu Ala Gly Pro Ser His Phe Pro Lys Arg Pro Ala Pro Arg
20 25 30
Asn Ser Ser Arg Val Asn Leu Ser Arg Thr Tyr Ala Ile Lys Ser Cys
35 40 45
Ser Val Ser Ser Arg Thr Gly Leu Cys Leu Gly Gln Cys Tyr His Lys
50 55 60
Lys Ser Ser Ala Cys Lys Cys Lys Leu Gly Trp Ser Ser Gln Pro Leu
65 70 75 80
Ser Ser Leu Arg His His Leu Arg Val His Ser Ser Ala Ser Glu Ala
85 90 95
Val Leu Thr Ser Gln Ser Asp Phe Thr Lys Leu Leu Val Gly Asn Glu
100 105 110
Lys Ile Gly Val Leu Leu Leu Asn Leu Gly Gly Pro Glu Thr Leu Asp
115 120 125
Asp Val Gln Pro Phe Leu Phe Asn Leu Phe Ala Asp Pro Asp Ile Ile
130 135 140
Arg Leu Pro Arg Leu Phe Arg Phe Leu Gln Lys Pro Leu Ala Gln Phe
145 150 155 160
Ile Ser Val Val Arg Ala Pro Lys Ser Lys Glu Gly Tyr Ala Ser Ile
165 170 175
Gly Gly Gly Ser Pro Leu Arg Gln Ile Thr Asp Ala Gln Ala Glu Ala
180 185 190
Leu Arg Lys Ala Leu Cys Asp Lys Asp Ile Pro Ala Lys Val Tyr Val
195 200 205
Gly Met Arg Tyr Trp His Pro Phe Thr Glu Glu Ala Ile Glu Gln Ile
210 215 220
Lys Arg Asp Gly Ile Thr Lys Leu Val Val Leu Pro Leu Tyr Pro Gln
225 230 235 240
Phe Ser Ile Ser Thr Ser Gly Ser Ser Leu Arg Leu Leu Glu Gly Ile
245 250 255
Phe Arg Glu Asp Glu Tyr Leu Val Asn Met Gln His Thr Val Ile Pro
260 265 270
Ser Trp Tyr Gln Arg Glu Gly Tyr Ile Lys Ala Met Ala Thr Leu Ile
275 280 285
Glu Lys Glu Leu Arg Thr Phe Ser Glu Pro Gln Lys Val Met Ile Phe
290 295 300
Phe Ser Ala His Gly Val Pro Leu Ala Tyr Val Glu Glu Ala Gly Asp
305 310 315 320
Pro Tyr Lys Ala Glu Met Glu Glu Cys Val Asp Leu Ile Met Glu Glu
325 330 335
Leu Glu Lys Arg Gly Ile Thr Asn Ser Cys Thr Leu Ala Tyr Gln Ser
340 345 350
Arg Val Gly Pro Val Glu Trp Leu Arg Pro Tyr Thr Asp Glu Thr Ile
355 360 365
Ile Glu Leu Gly Gln Lys Gly Val Lys Ser Leu Leu Ala Val Pro Ile
370 375 380
Ser Phe Val Ser Glu His Ile Glu Thr Leu Glu Glu Ile Asp Val Glu
385 390 395 400
Tyr Lys Glu Leu Ala Leu Glu Ser Gly Ile Lys His Trp Gly Arg Val
405 410 415
Pro Ala Leu Gly Cys Glu Pro Thr Phe Ile Thr Asp Leu Ala Asp Ala
420 425 430
Val Ile Glu Ser Leu Pro Tyr Val Gly Ala Met Ala Val Ser Asn Leu
435 440 445
Glu Ala Arg Gln Pro Leu Val Pro Leu Gly Ser Val Glu Glu Leu Leu
450 455 460
Ala Ala Tyr His Ser Lys Arg Asp Glu Leu Pro Pro Pro Val Thr Val
465 470 475 480
Trp Glu Trp Gly Trp Thr Lys Ser Ala Glu Thr Trp Asn Gly Arg Ala
485 490 495
Ala Met Leu Ala Val Leu Ala Leu Leu Val Leu Glu Val Thr Thr Gly
500 505 510
Glu Gly Phe Leu His Gln Trp Gly Ile Leu Pro Leu Phe His
515 520 525
<210>3
<211>20
<212>DNA
<213> primer
<400>3
GCTTGCCTTATGTTGGTGCT
<210>4
<211>20
<212>DNA
<213> primer
<400>4
tgagacggagggagtagaca
Claims (3)
1. A rice leaf tone control gene mOsFC2, characterized by: the nucleotide sequence of the rice leaf color control gene mOsFC2 is the nucleotide sequence shown in SEQ ID NO. 1.
2. A protein encoded by the rice leaf tone control gene mOsFC2 of claim 1, wherein: the amino acid sequence of the protein is the amino acid sequence shown in Seq ID No. 2.
3. Use of a mOsFC2 containing the rice leaf color control gene of claim 1 for breeding and purity identification of hybrid rice seeds to change rice leaf color, improve photosynthesis efficiency and yield.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111271537.8A CN113999855B (en) | 2021-10-29 | 2021-10-29 | Rice leaf tone control gene mOsFC2 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111271537.8A CN113999855B (en) | 2021-10-29 | 2021-10-29 | Rice leaf tone control gene mOsFC2 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113999855A CN113999855A (en) | 2022-02-01 |
| CN113999855B true CN113999855B (en) | 2023-06-09 |
Family
ID=79925519
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111271537.8A Active CN113999855B (en) | 2021-10-29 | 2021-10-29 | Rice leaf tone control gene mOsFC2 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113999855B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH10257894A (en) * | 1997-03-19 | 1998-09-29 | Norin Suisansyo Nogyo Seibutsu Shigen Kenkyusho | Gene xa-1 and xa-1 protein resistant to rice xanthomonas oryzae pv. oryzae |
| WO2005079168A2 (en) * | 2004-02-23 | 2005-09-01 | Seoul National University Industry Foundation | A novel stay-green gene and method for preparing stay-green transgenic plants |
| CN103613649A (en) * | 2013-10-30 | 2014-03-05 | 中国水稻研究所 | Paddy rice leaf color control gene OscpSRP54 and protein encoded by same |
| CN112048010A (en) * | 2020-08-20 | 2020-12-08 | 华南农业大学 | Application of rice RIP2 protein in regulation and control of plant leaf included angle |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2005185101A (en) * | 2002-05-30 | 2005-07-14 | National Institute Of Agrobiological Sciences | VEGETABLE FULL-LENGTH cDNA AND UTILIZATION THEREOF |
| US9085766B2 (en) * | 2010-05-21 | 2015-07-21 | Cornell University | Methods of producing recombinant heme-binding proteins and uses thereof |
| KR20180038048A (en) * | 2015-08-20 | 2018-04-13 | 다우 아그로사이언시즈 엘엘씨 | Chloroplast transit peptide |
-
2021
- 2021-10-29 CN CN202111271537.8A patent/CN113999855B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH10257894A (en) * | 1997-03-19 | 1998-09-29 | Norin Suisansyo Nogyo Seibutsu Shigen Kenkyusho | Gene xa-1 and xa-1 protein resistant to rice xanthomonas oryzae pv. oryzae |
| WO2005079168A2 (en) * | 2004-02-23 | 2005-09-01 | Seoul National University Industry Foundation | A novel stay-green gene and method for preparing stay-green transgenic plants |
| CN103613649A (en) * | 2013-10-30 | 2014-03-05 | 中国水稻研究所 | Paddy rice leaf color control gene OscpSRP54 and protein encoded by same |
| CN112048010A (en) * | 2020-08-20 | 2020-12-08 | 华南农业大学 | Application of rice RIP2 protein in regulation and control of plant leaf included angle |
Non-Patent Citations (2)
| Title |
|---|
| 水稻苗期耐低锌种质资源鉴定与筛选;王芳等;南方农业学报;第51卷(第3期);第520-530页 * |
| 水稻黄绿叶突变体研究进展;李素贞;杨文竹;陈茹梅;;生物技术通报(11);第21-27页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113999855A (en) | 2022-02-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN116058286A (en) | Tobacco plant body and preparation method thereof | |
| US8203032B2 (en) | Application of fluorescent protein to garden plant | |
| CN115894646B (en) | OsJDG1 gene and application thereof in regulation of rice grain type and thousand grain weight | |
| CN111320679A (en) | ZmPHYCs mutant protein related to maize flowering phase, encoding gene, recombinant vector and application thereof | |
| EP0803572B1 (en) | Cpc gene for regulating initiation of root hair formation for arabidopsis (thaliana), and transgenic (arabidopsis) plant overexpressing the cpc gene | |
| CN104975030B (en) | Maize yellow-green leaf mutant gene ygl-1, protein coded by same and application of mutant gene ygl-1 | |
| CN114990139A (en) | Application of CsHLS1 gene or protein coded by same in regulation and control of organ size of cucumber plant | |
| CN110041415B (en) | Application of lettuce gene RLL4 in controlling lettuce leaf color | |
| CN109721649B (en) | Rice plant type regulation related gene, protein and application | |
| CN109971763A (en) | Florescence control gene C MP1 and relevant carrier and its application | |
| CN106591325A (en) | Method for breeding early-blossoming corn by adopting corn gene ZmDPS10-2 and applications of method | |
| CN107022540B (en) | Wheat ALS mutant protein and gene for endowing plants with herbicide resistance and application thereof | |
| AU2007258877B2 (en) | Plants with increased tolerance to water deficit | |
| CN117402908A (en) | Application of GL6.1 gene in regulation of rice grain type | |
| CN112626115A (en) | Application of OsELF4 gene in controlling heading stage of rice | |
| CN113999855B (en) | Rice leaf tone control gene mOsFC2 and application thereof | |
| CN112457385B (en) | Application of gene LJP1 for controlling rice growth period | |
| CN109456396A (en) | A kind of protein, molecular labeling and the application of Senescence of Rice and fringe type controlling gene HK73 and its coding | |
| CN112941082B (en) | Clone and application of rice plant height gene qPH-IAA30 | |
| CN112063597B (en) | Maize multi-copper oxidase coding gene ZmDEK559-2 and application thereof | |
| CN110964730B (en) | Application of rice leaf whitening trait gene OsLCD1 in regulation and control of rice leaf color trait | |
| CN114395580A (en) | Gene for controlling plant height of corn | |
| CN114457047A (en) | Rice aspartyl-RNA synthetase gene mYLC3 and application thereof | |
| CN115074381A (en) | Method for adjusting plant height or biomass character of gramineous plants and application | |
| CN115697043A (en) | Method for obtaining mutant plants by targeted mutagenesis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Wang Linyou Inventor after: Liu Hongjia Inventor after: Wu Wenjuan Inventor after: Huang Jirong Inventor after: Wang Fang Inventor after: Gong Xue Inventor after: He Haiyan Inventor before: Liu Hongjia Inventor before: Wang Linyou Inventor before: Wu Wenjuan Inventor before: Huang Jirong Inventor before: Wang Fang Inventor before: Gong Xue Inventor before: He Haiyan |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |