CN113999816A

CN113999816A - Human umbilical cord mesenchymal stem cell line for expressing HOXA10 and preparation method and application thereof

Info

Publication number: CN113999816A
Application number: CN202111525699.XA
Authority: CN
Inventors: 谢敬; 吴美贤
Original assignee: Shanghai East Hospital Tongji University Affiliated East Hospital
Current assignee: Shanghai East Hospital Tongji University Affiliated East Hospital
Priority date: 2021-12-14
Filing date: 2021-12-14
Publication date: 2022-02-01
Anticipated expiration: 2041-12-14
Also published as: CN113999816B

Abstract

The invention provides a human umbilical cord mesenchymal stem cell line for expressing HOXA10, wherein the sequence of HOXA10 is shown as SEQ ID NO: 4, respectively. The invention also provides a preparation method of the human umbilical cord mesenchymal stem cell line for expressing HOXA10, which comprises the steps of amplifying HOXA10 gene from human umbilical cord mesenchymal stem cells; cloning the obtained HOXA10 gene into a lentiviral vector; infecting human umbilical cord mesenchymal stem cells with a lentivirus carrying HOXA10 to obtain a human umbilical cord mesenchymal stem cell line expressing HOXA 10. The invention also provides application of the human umbilical cord mesenchymal stem cell line expressing HOXA10 in preparation of a medicine for treating endometrial injury. The invention finds that the T10-UCMSCs cell line obviously improves the treatment effect of stem cells on repairing endometrial injury, and is greatly helpful for clinical treatment of infertility caused by endometrial injury.

Description

Human umbilical cord mesenchymal stem cell line for expressing HOXA10 and preparation method and application thereof

Technical Field

The invention belongs to the field of biomedicine, and relates to a human umbilical cord mesenchymal stem cell line, in particular to a human umbilical cord mesenchymal stem cell line expressing HOXA10, and a preparation method and application thereof.

Background

The uterus is an important physiological organ of women, and maintains the physiological characteristics and the fertility function of women. Wherein the endometrium has important effect on embryo implantation and pregnancy. Endometrial damage is a major cause of female infertility.

The prior proposal is to transplant UCMSCs into uterus through tail vein or uterine cavity, thereby improving the thickness of the endometrium, relieving fibrosis of the damaged part and achieving the treatment effect.

Due to the existence of individual differences, treatment methods such as hormone replacement therapy are not ideal, which makes stem cell therapy have a wide prospect in clinic. However, although embryonic stem cells are totipotent and have been shown to repair damaged endometrium in vitro, ethical issues and tumorigenesis greatly limit their use. The umbilical cord mesenchymal stem cells separated from human waste tissue umbilical cords are the clinically optimal seed cells due to the fact that the umbilical cord mesenchymal stem cells are easily obtained in a wide source/obtaining mode, are free from ethical disputes and are low in immunogenicity. At present, Umbilical Cord Mesenchymal Stem Cells (UCMSCs) are preliminarily proved to be capable of effectively improving the recovery of endometrium to a certain extent, but the repair effect is limited and the curative effect is unstable due to the influence of intrauterine environment.

Homeobox genes (HOX) belong to transcription regulatory genes of a polygene family with high conservation type, and can be divided into A, B, C, D four gene clusters in mammals, and the four gene clusters are arranged on chromosomes in a sequence closely related to the development function of embryos controlled by the homeobox genes. The HOXA10 gene is mainly expressed in the endometrium and plays an important role in maintaining endometrial development and embryo implantation. The treatment of HOXA10 in combination with stem cells in vivo is not clear.

Disclosure of Invention

Aiming at the technical problems in the prior art, the invention provides a human umbilical cord mesenchymal stem cell line expressing HOXA10, a preparation method and application thereof, and aims to solve the technical problem that the effect of the drug in the prior art on endometrial injury is not good.

The invention provides a human umbilical cord mesenchymal stem cell line for expressing HOXA10, wherein the sequence of HOXA10 is shown as SEQ ID NO: 4, respectively.

The invention also provides a preparation method of the human umbilical cord mesenchymal stem cell line for expressing HOXA10, which comprises the following steps:

(1) amplifying a gene of HOXA10 from human umbilical cord mesenchymal stem cells;

(2) cloning the HOXA10 gene obtained in the step 1) into a lentiviral vector;

(3) and infecting the human umbilical cord mesenchymal stem cells with the lentivirus with HOXA10 to obtain a human umbilical cord mesenchymal stem cell line expressing HOXA 10.

Further, in step 1), total RNA of human umbilical cord mesenchymal stem cells is extracted first and then reverse-transcribed into cDNA, and according to the CDS sequence of HOXA10, the CDS sequence of HOXA10 is shown in SEQ ID NO: 1, designing a primer sequence of 20bp homologous arms around a pLv-AcGFP vector HindIII enzyme cutting site by using primer5 software, and amplifying by using cDNA obtained by reverse transcription of human umbilical cord mesenchymal stem cells as a template.

Specifically, the sequence of the upstream primer of the primer sequence is shown as SEQ ID NO: 2, the sequence of the downstream primer is shown as SEQ ID NO: 3, respectively.

Further, in step 2), the HOXA10 gene was cloned into a lentiviral vector pLV-AcGFP1-N1 plasmid, the vector pLV-AcGFP was digested with a restriction enzyme HindIII, the above digestion product and PCR product were recovered, and then the digestion product and PCR product were subjected to homologous recombination.

Further, in the step 3), slow virus is firstly packaged, then the culture solution of the human umbilical cord mesenchymal stem cells is resuspended in slow virus precipitates, and the suspended human umbilical cord mesenchymal stem cells are blown, uniformly mixed, subpackaged in a centrifuge tube and stored in a refrigerator at the temperature of-80 ℃.

Further, the process of lentivirus packaging comprises the following steps:

1) selecting P8 generation HEK-293T cells with good growth state and exponential growth phase, inoculating in a 15cm cell culture dish, and culturing at 37 deg.C with CO with gas concentration of 5%₂Culturing in a cell culture box;

2) when the cell density is converged to 60-70%, the cell culture solution is changed into antibiotic-free culture solution for continuous culture at least 1h in advance;

3) preparing a centrifuge tube, adding 500 mu l of Opti-MEM, adding Lipofectamin2000, reversing the mixture from top to bottom for several times, uniformly mixing, and standing at room temperature for 5 min;

4) adding 500 mu l of Opti-MEM into another clean centrifuge tube, mixing the objective plasmids HOXA10-pLV-AcGFP, psPAPX2 and pMD2.G, wherein the mass ratio of HOXA10-pLV-AcGFP, psPAPX2 and pMD2.G is 8:6:3, and evenly mixing by vertically reversing;

5) adding Opti-MEM containing DNA into a tube containing Lipofectamin2000, uniformly mixing by means of a spring finger, standing for 15min at room temperature, and uniformly mixing the DNA with the Lipofectamin 2000;

6) slowly adding the mixture into HEK-293T cells in a cross manner, slightly shaking the culture dish, uniformly mixing, placing at 37 ℃ and keeping the gas concentration percentage of 5% CO₂Culturing overnight in a cell culture box;

7) after 10-12h, discarding the supernatant, replacing the fresh culture solution, continuously culturing for 48h, collecting the supernatant, continuously replacing the fresh culture solution, and collecting the supernatant again after 72 h;

8) filtering the obtained supernatant with 0.45um filter to remove cell debris; adding PEG8000 with volume percentage concentration of 40% to final volume percentage concentration of 10%, concentrating the obtained virus;

9) placing virus supernatant containing 10% PEG8000 at volume percentage in ferris wheel rotating wheel at 4 deg.C, and rotating for 8-10 hr;

10) and taking out the concentrated supernatant, centrifuging at 4 ℃ and 4000rpm for more than 40min, and then removing the supernatant to finish packaging the lentivirus.

The invention also provides application of the human umbilical cord mesenchymal stem cell line expressing HOXA10 in preparation of a medicine for treating endometrial injury.

Based on the important role of umbilical cord mesenchymal stem cells and HOXA10 genes in maintaining endometrial development and embryo implantation, the invention constructs a HOXA10 high-expression UCMSCs cell line (T10-UCMSCs) to repair endometrial injury, thereby performing more effective treatment on uterine injury cases.

The invention constructs a cell line (T10-UCMSCs) of HOXA10 high-expression UCMSCs, and provides a transplantation treatment method of umbilical cord mesenchymal stem cells with HOXA10 high-expression on the basis of constructing a mouse endometrial injury model. The result shows that the T10-UCMSCs cell line obviously improves the treatment effect of stem cells on repairing the endometrial injury, and is greatly helpful for the clinical treatment of infertility caused by the endometrial injury.

Drawings

FIG. 1 is a flow cytometry assay for cell surface markers of purified UCMSCs.

Figure 2 is the CDS sequence of human HOXA 10.

FIG. 3 shows the CCK-8 method for detecting cell proliferation of UCMSCs transfected with HOXA10 virus and UCMSCs transfected with lentiviral vector.

FIG. 4 shows the functional verification of the HOXA10 gene in T10-UCMSCs cell line.

FIG. 5 shows the uterine morphology of the sham-operated group, the endometrial lesion group, the USMSCs treated group and the T10-UCMSCs cell line treated group.

FIG. 6 is a Vimentin immunohistochemistry of sham, endometrium injury, USMSCs treatment, and T10-UCMSCs cell line treatment.

FIG. 7 shows pregnancy rates of sham-operated groups, endometrium-injured groups, USMSCs-treated groups, and T10-UCMSCs cell line-treated groups.

FIG. 8 shows embryo implantation rates of the sham-operated group, the endometrial lesion group, the USMSCs treated group, and the T10-UCMSCs cell line treated group.

Detailed Description

Example 1 purification, culture and passaging of Umbilical Cord Mesenchymal Stem Cells (UCMSCs)

UCMSCs fromShanghai Oriental Hospital (affiliated Oriental Hospital of Tongji University)Separated from fetal waste tissue (tissue-umbilical), and presenting CD37 as detected by flow cytometry⁺、CD90⁺、CD105⁺、CD34^-、CD45^-HLA-D negative (FIG. 1). The stem cell culture solution is DMEM/F12 medium (Gibco) containing 10% by volume fetal bovine serum (Gibco) and hundred by volumeAt 37 ℃ and with a gas concentration of 5% CO, the specific concentration of 1% Penicilin-Streptomycin double antibody is divided₂Cultured under conditions to fuse to 80% and passage is carried out by digestion with trypsin (Gibco) at a concentration of 0.25% by volume. 2-5 generations of UCMSCs/HOXA10-UCMSCs were used for transplantation. As shown in FIG. 1, the selected cells were purified Umbilical Cord Mesenchymal Stem Cells (UCMSCs).

Example 2 HOXA10 plasmid preparation and transfection

(1) Amplification of CDS sequence of HOXA10 from hUCMSCs

Extracting total RNA of hUCMSCs by TRIzol-phenol-chloroform one-step method, and performing PrimeScript according to Takara reverse transcription kit^TMThe RT Reagent Kit instructions were inverted to cDNA. The CDS sequence of HOXA10 was obtained from NCBI (NCBI website) (FIG. 2), and primer5 software was used to design primer sequences of 20bp homology arms around the HindIII cleavage site of pLv-AcGFP vector, the primers were synthesized by Beijing Optimalaceae, and cDNA reverse transcribed from hUCMSCs was used as a template for amplification. And (3) recovering the PCR product after detecting the size of the PCR product by agarose gel electrophoresis with the mass percentage concentration of 1%.

The primer sequence is as follows:

F：ctcaagcttcgaattccaagaaatgtcagccagaaagggcta(SEQ ID NO：2)

R：gtcgactgcagaattcggaaaaattaaagttggctgtgagctc(SEQ ID NO：3)

the PCR reaction system is as follows:

(2) cloning of the HOXA10 Gene into a lentiviral vector (pLV-AcGFP1-N1 plasmid)

The vector pLV-AcGFP was digested with the restriction enzyme HindIII, and the size of the band was confirmed and recovered. Recovering the above enzyme digestion products and PCR products by using Tiangen kit, and adopting all-type gold

Basic nucleic acids Cloning and Assembly Kit the cleavage products and the PCR products were subjected toAnd (3) homologous recombination. The resulting product was stored and named HOXA 10-pLV-AcGFP.

(3) Construction of HOXA10 lentivirus and infection of hUCMSCs

And (3) slow virus packaging:

1. selecting P8 generation HEK-293T cells with good growth state and exponential growth phase, inoculating in a 15cm cell culture dish, and culturing at 37 deg.C with gas concentration of 5% CO₂Cultured in a cell culture box.

2. When the cell density is converged to 60-70%, the cell culture solution is changed into antibiotic-free culture solution for at least 1h in advance to continue the culture.

3. A centrifuge tube was prepared, 500. mu.l of Opti-MEM was added, Lipofectamin2000 was added, the mixture was inverted several times, and the mixture was allowed to stand at room temperature for 5 min.

4. Adding 500 mu l of Opti-MEM into another clean centrifuge tube, mixing the objective plasmids HOXA10-pLV-AcGFP, psPAPX2 and pMD2.G, wherein the mass ratio of HOXA10-pLV-AcGFP, psPAPX2 and pMD2.G is 8:6:3, and evenly mixing by upside down.

5. Adding Opti-MEM containing DNA into a tube containing Lipofectamin2000, flicking and uniformly mixing, and standing for 15min at room temperature to uniformly mix the DNA with Lipofectamin 2000.

6. Slowly adding the mixture into HEK-293T cells in a cross manner, shaking the culture dish, mixing uniformly, placing at 37 deg.C with gas concentration percentage of 5% CO₂The cells were cultured overnight in a cell incubator.

After 7.10-12h, the supernatant is discarded, the fresh culture solution is replaced, the supernatant is collected after continuous culture for 48h, the fresh culture solution is replaced continuously, and the supernatant is collected again after 72 h.

8.0.45um filter to collect the supernatant and remove cell debris; PEG8000 at 40% by volume concentration was added to a final concentration of 10% by volume, and the resulting virus was concentrated.

9. The virus supernatant containing 10% PEG8000 is put into a ferris wheel rotating wheel at 4 ℃ to rotate for 8-10 h.

10. And taking out the concentrated supernatant, centrifuging at 4 ℃ and 4000rpm for more than 40min, and then removing the supernatant to finish packaging the lentivirus.

11. And (3) re-suspending the obtained virus precipitate by using a proper amount of UCMSCs cell culture solution, blowing, beating, uniformly mixing, subpackaging in a centrifugal tube, and storing in a refrigerator at the temperature of-80 ℃.

Observing the fluorescence in the cells for 72h after the addition of the virus, measuring the virus titer to be 2 x 10^5TU/ml by using a dilution counting method, diluting the virus titer to a proper MOI value by using a culture solution according to the measured virus titer, adding polybrene with the final concentration of 8ug/ml, and placing the diluted virus titer into an incubator for culture. And replacing fresh culture solution after 48 hours, observing the fluorescence expression amount, and continuously culturing until the fluorescence expression amount is higher, and then carrying out flow cytometry screening. The cell culture fluid was removed, washed twice with DPBS, and digested with 0.25% trypsin. Terminating the cells after rounding with culture solution, blowing, uniformly mixing, transferring to a centrifuge tube, and centrifuging. Removing the supernatant, adding an appropriate amount of FBS-free cell culture solution for resuspension and counting, and adjusting the cell density to 10^ 6/ml. And filtering the re-suspension through a 200-mesh sieve, and then performing flow cytometry screening and purification in a flow tube.

Figure 2 is the CDS sequence of human HOXA 10.

Example 3 CKK8 detection of proliferation of T10-UCMSCs cell line

After UCMSCs are infected by HOXA10 lentivirus, the proliferation of the cell line is detected by CKK8 kit (hanbio). Cells were seeded at 5X 10^4 density in 96-well plates and cultured for 24h, 48h, 96h and 120h with 10. mu.l of CKK8 solution added sequentially. The incubation was continued for 4h and the absorbance was measured at 450nm with a microplate reader (FIG. 3). Each group was repeated 3-5 wells and averaged.

FIG. 3 shows cell proliferation of HOXA10 virus UCMSCs and lentivirus vector-transfected UCMSCs.

Example 4 Dual luciferase reporter assay to detect HOXA10 function in T10-UCMSCs cell line

Emx2 and ITGB3 promoters were inserted into pGL3-basic vector (Promega), respectively. Lipofectamine 2000(Invitrogen) helper vector and negative control (pGL3-basic) and reporter vector pRL-SV40 plasmids were co-transfected into 293T cells. Luciferase activity was detected 48 hours after transfection using a dual luciferase reporter assay kit (Promega) (fig. 4).

And (4) conclusion: HOXA10 was functional in the T10-UCMSCs cell line.

Example 5 endometrial injury models were established.

The model is based on the rapid dehydration of ethanol. Female mice were observed for 2 oestrus cycles in succession and selected for molding in the third cycle. After the mice were anesthetized with 10% chloral hydrate, the mice were placed in the supine position, the abdominal cavity was opened, and the two ends of the uterus were clamped with hemostatic clips. The injector is inserted from the uterine horn, injected with ethanol with the volume percentage concentration of 95 percent and withdrawn after a certain period of time, and is lightly flushed with a large amount of physiological saline to prevent the abdominal cavity from adhesion. The other side of the uterus is operated in the same way, and the uterus is put back to the original position after the injury of the two sides is completed, and the abdominal cavity is closed.

Example 6 transplantation of UCMSCs and T10-UCMSCs cell lines

The stem cells after digestion were prepared in advance and counted before implantation. Opening abdomen after anaesthesia, taking out uterus and making mould. The cell suspension was aspirated with an insulin syringe, injected slowly from the uterine horn, and carefully spilled. After the bilateral implantation was completed, the uterus was returned and the abdominal cavity was closed. And (4) placing the mouse which is not revived on a temperature control table, and returning to the cage position for continuous feeding after reviving.

Example 7T 10-UCMSCs cell line improves morphology and tolerability of endometrium-damaged uterus

After 14 days of treatment with stem cells, mice in the sham operation group, the endometrial injury group, the USMSCs treatment group and the T10-UCMSCs cell line treatment group were sacrificed, respectively, and then the uterus was fixed with 4% paraformaldehyde for 24 hours for paraffin embedding, and the thickness of each paraffin section was 5 μm. Paraffin sections were dewaxed in xylene, dehydrated in graded ethanol (vol% concentration) 100%, 95%, 80%, 75% and 50%, each for 5 minutes, and rinsed with distilled water, followed by hematoxylin and eosin staining according to standard experimental procedures. As shown in fig. 5, the HE staining has better uterine morphology compared with the endometrium injury group, the USMSCs treatment group and the T10-UCMSCs cell line treatment group, and the USMSCs treatment group and the T10-UCMSCs cell line treatment group have obvious repairing effect on uterine injury.

The paraffin sections of mouse uterine tissues of the obtained pseudo-operation group, endometrium injury group, USMSCs treatment group and T10-UCMSCs cell line treatment group are dewaxed and dehydrated by gradient ethanol according to the standard experimental process, and then the tissue sections are put into a repairing and repairing groupRepeating the steps, adding sodium citrate buffer solution for antigen restoration, washing with PBS for 3 times, and obtaining H with the volume percentage concentration of 0.3 percent₂O₂Incubate for 15min to block endogenous peroxidase activity and block with 10% by volume normal goat serum (diluted in phosphate buffered saline) for 1 h. Sections were incubated overnight at 4 ℃ with anti-vimentin (Abcam) primary antibody. The sections were removed and returned to room temperature, the primary antibody was removed and washed 3 times with PBS for 5min each. Sections were incubated with horseradish peroxidase-labeled goat anti-rabbit immunoglobulin g (igg) secondary antibody at 1:1000 dilution for 2 hours at room temperature, then developed with DAB kit, and then stained with neutral gum, photographed and analyzed (fig. 6). As a result of immunohistochemistry in fig. 6, the T10-UCMSCs cell line-treated group can significantly improve the tolerability of the damaged uterus compared to the endometrium damaged group and the USMSCs-treated group.

Example 8T 10-UCMSCs enhances endometrial function

Mice in a sham operation group, an endometrial injury group, a USMSCs treatment group and a T10-UCMSCs cell line treatment group are respectively subjected to caging after 14 days of stem cell treatment, and are respectively sacrificed and dissected after 17 days of embolisms, so that the pregnancy rates of the four groups of mice are counted, wherein the sham operation group is 57.14 percent, the endometrial injury group is 22.22 percent, the USMSCs treatment group is 45.45 percent, and the T10-UCMSCs cell line treatment group is 50 percent (figure 7). The embryo implantation rates of four groups of mice were counted, the sham group was 9.000 + -0.9129, the endometrial injury group was 1.000 + -0.0, the USMSCs treatment group was 3.400 + -0.6782, and the T10-UCMSCs cell line treatment group was 6.400 + -0.6782 (FIGS. 7 and 8).

HOXA10 in the T10-UCMSCs cell line constructed by the invention is highly expressed in UCMSCs, and the T10-UCMSCs cell line injected into the damaged uterus has an obvious repairing effect on the damaged endometrium based on a 95% ethanol rapidly dehydrated endometrium damaged mouse model. Meanwhile, the T10-UCMSCs cell line constructed by the invention can be stably passaged, and the T10-UCMSCs cell line in 5 generations has the effect of treating endometrial injury. Importantly, the T10-UCMSCs transplanted group has significantly higher pregnancy rate and embryo implantation rate than the wild-type stem cell treated group in the mouse reproduction test.

Compared with the method of directly transplanting the UCMSCs into the uterus for repair, the high-expression HOXA10 in the UCMSCs cell line has the advantages that the treatment effect of the T10-UCMSCs cell line constructed by the invention is obviously improved from the immunohistochemical detection results of the uterine morphology and tolerance indexes. More importantly, the group treated with T10 had a significantly higher embryo implantation rate in the mouse reproductive test than the wild-type stem cell treated group.

Sequence listing

<110> Shanghai City eastern Hospital (affiliated eastern Hospital of Tongji university)

<120> human umbilical cord mesenchymal stem cell line for expressing HOXA10, and preparation method and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1233

<212> DNA

<213> Homo sapiens

<400> 1

atgtcagcca gaaagggcta tctgctccct tcgccaaatt atcccacaac aatgtcatgc 60

tcggagagcc ccgccgcgaa ctcttttttg gtcgactcgc tcatcagctc gggcagaggc 120

gaggcaggcg gcggtggtgg tggcgcgggg ggcggcggcg gtggcggtta ctacgcccac 180

ggcggggtct acctgccgcc cgccgccgac ctgccctacg ggctgcagag ctgcgggctc 240

ttccccacgc tgggcggcaa gcgcaatgag gcagcgtcgc cgggcagcgg tggcggtggc 300

gggggtctag gtcccggggc gcacggctac gggccctcgc ccatagacct gtggctagac 360

gcgccccggt cttgccggat ggagccgcct gacgggccgc cgccgccgcc ccagcagcag 420

ccgccgcccc cgccgcaacc accccagcca gcgccgcagg ccacctcgtg ctctttcgcg 480

cagaacatca aagaagagag ctcctactgc ctctacgact cggcggacaa atgccccaaa 540

gtctcggcca ccgccgccga actggctccc ttcccgcggg gcccgccgcc cgacggctgc 600

gccctgggca cctccagcgg ggtgccagtg cctggctact tccgcctttc tcaggcctac 660

ggcaccgcca agggctatgg cagcggcggc ggcggcgcgc agcaactcgg ggctggcccg 720

ttccccgcgc agcccccggg gcgcggtttc gatctcccgc ccgcgctagc ctccggctcg 780

gccgatgcgg cccggaagga gcgagccctc gattcgccgc cgccccccac gctggcttgc 840

ggcagcggcg ggggctcgca gggcgacgag gaggcgcacg cgtcgtcctc ggccgcggag 900

gagctctccc cggccccttc cgagagcagc aaagcctcgc cggagaagga ttccctgggc 960

aattccaaag gtgaaaacgc agccaactgg ctcacggcaa agagtggtcg gaagaagcgc 1020

tgcccctaca cgaagcacca gacactggag ctggagaagg agtttctgtt caatatgtac 1080

cttactcgag agcggcgcct agagattagc cgcagcgtcc acctcacgga cagacaagtg 1140

aaaatctggt ttcagaaccg caggatgaaa ctgaagaaaa tgaatcgaga aaaccggatc 1200

cgggagctca cagccaactt taatttttcc tga 1233

<210> 2

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ctcaagcttc gaattccaag aaatgtcagc cagaaagggc ta 42

<210> 3

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ctcaagcttc gaattccaag aaatgtcagc cagaaagggc ta 42

<210> 4

<211> 1260

<212> DNA

<213> Homo sapiens

<400> 4

gttttgcaca agaaatgtca gccagaaagg gctatctgct cccttcgcca aattatccca 60

caacaatgtc atgctcggag agccccgccg cgaactcttt tttggtcgac tcgctcatca 120

gctcgggcag aggcgaggca ggcggcggtg gtggtggcgc ggggggcggc ggcggtggcg 180

gttactacgc ccacggcggg gtctacctgc cgcccgccgc cgacctgccc tacgggctgc 240

agagctgcgg gctcttcccc acgctgggcg gcaagcgcaa tgaggcagcg tcgccgggca 300

gcggtggcgg tggcgggggt ctaggtcccg gggcgcacgg ctacgggccc tcgcccatag 360

acctgtggct agacgcgccc cggtcttgcc ggatggagcc gcctgacggg ccgccgccgc 420

cgccccagca gcagccgccg cccccgccgc aaccacccca gccagcgccg caggccacct 480

cgtgctcttt cgcgcagaac atcaaagaag agagctccta ctgcctctac gactcggcgg 540

acaaatgccc caaagtctcg gccaccgccg ccgaactggc tcccttcccg cggggcccgc 600

cgcccgacgg ctgcgccctg ggcacctcca gcggggtgcc agtgcctggc tacttccgcc 660

tttctcaggc ctacggcacc gccaagggct atggcagcgg cggcggcggc gcgcagcaac 720

tcggggctgg cccgttcccc gcgcagcccc cggggcgcgg tttcgatctc ccgcccgcgc 780

tagcctccgg ctcggccgat gcggcccgga aggagcgagc cctcgattcg ccgccgcccc 840

ccacgctggc ttgcggcagc ggcgggggct cgcagggcga cgaggaggcg cacgcgtcgt 900

cctcggccgc ggaggagctc tccccggccc cttccgagag cagcaaagcc tcgccggaga 960

aggattccct gggcaattcc aaaggtgaaa acgcagccaa ctggctcacg gcaaagagtg 1020

gtcggaagaa gcgctgcccc tacacgaagc accagacact ggagctggag aaggagtttc 1080

tgttcaatat gtaccttact cgagagcggc gcctagagat tagccgcagc gtccacctca 1140

cggacagaca agtgaaaatc tggtttcaga accgcaggat gaaactgaag aaaatgaatc 1200

gagaaaaccg gatccgggag ctcacagcca actttaattt ttcctgatga atctccaggc 1260

Claims

1. A human umbilical cord mesenchymal stem cell line expressing HOXA10, HOXA10 having the sequence of SEQ ID NO: 4, respectively.

2. The method for preparing a human umbilical cord mesenchymal stem cell line expressing HOXA10 according to claim 1, which comprises the steps of:

(1) amplifying a HOXA10 gene from human umbilical cord mesenchymal stem cells;

(2) cloning the HOXA10 gene obtained in the step 1) into a lentiviral vector;

(3) infecting human umbilical cord mesenchymal stem cells with a lentivirus carrying HOXA10 to obtain a human umbilical cord mesenchymal stem cell line expressing HOXA 10.

3. The method for preparing a human umbilical cord mesenchymal stem cell line expressing HOXA10 according to claim 2, wherein the method comprises the following steps: in step 1), total RNA of human umbilical cord mesenchymal stem cells is extracted and then is reversely transcribed into cDNA, and according to the CDS sequence of HOXA10, the CDS sequence of HOXA10 is shown as SEQ ID NO: 1, designing a primer sequence of 20bp homologous arms around a pLv-AcGFP vector HindIII enzyme cutting site by using primer5 software, and amplifying by using cDNA obtained by reverse transcription of human umbilical cord mesenchymal stem cells as a template.

4. The method for preparing a human umbilical cord mesenchymal stem cell line expressing HOXA10 according to claim 3, wherein the method comprises the following steps: the sequence of the upstream primer of the primer sequence is shown as SEQ ID NO: 2, the sequence of the downstream primer is shown as SEQ ID NO: 3, respectively.

5. The method for preparing a human umbilical cord mesenchymal stem cell line expressing HOXA10 according to claim 2, wherein the method comprises the following steps: in step 2), the HOXA10 gene is cloned into a lentiviral vector pLV-AcGFP1-N1 plasmid, the vector pLV-AcGFP is cut by restriction enzyme HindIII, the cut product and the PCR product are recovered, and then the cut product and the PCR product are subjected to homologous recombination.

6. The method for preparing a human umbilical cord mesenchymal stem cell line expressing HOXA10 according to claim 2, wherein the method comprises the following steps: in the step 3), the slow virus is firstly packaged, then the culture solution of the human umbilical cord mesenchymal stem cells is used for resuspending the slow virus precipitate, the slow virus precipitate is blown and uniformly mixed, then the mixture is subpackaged in a centrifuge tube, and the centrifuge tube is placed in a refrigerator at the temperature of minus 80 ℃ for storage.

7. The method for preparing a human umbilical cord mesenchymal stem cell line expressing HOXA10 according to claim 6, wherein the method comprises the following steps: the process of packaging the lentivirus comprises the following steps:

1) selecting P8 generation HEK-293T cells with good growth state and exponential growth phase, inoculating in a cell culture dish, and culturing at 37 deg.C with CO with gas concentration of 5%₂Culturing in a cell culture box;

6) slowly adding the mixture into HEK-293T cells in a cross manner, shaking the culture dish, mixing uniformly, placing at 37 deg.C with gas concentration percentage of 5% CO₂Culturing overnight in a cell culture box;

8. Use of the HOXA 10-expressing human umbilical cord mesenchymal stem cell line of claim 1 in the manufacture of a medicament for the treatment of endometrial damage.