CN113999811A - Method for establishing granulosa cell in vitro model of follicular cyst - Google Patents
Method for establishing granulosa cell in vitro model of follicular cyst Download PDFInfo
- Publication number
- CN113999811A CN113999811A CN202210000606.XA CN202210000606A CN113999811A CN 113999811 A CN113999811 A CN 113999811A CN 202210000606 A CN202210000606 A CN 202210000606A CN 113999811 A CN113999811 A CN 113999811A
- Authority
- CN
- China
- Prior art keywords
- cells
- follicular
- cortisol
- granulosa
- cyst
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0681—Cells of the genital tract; Non-germinal cells from gonads
- C12N5/0682—Cells of the female genital tract, e.g. endometrium; Non-germinal cells from ovaries, e.g. ovarian follicle cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6881—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56966—Animal cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/74—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
- G01N33/743—Steroid hormones
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/30—Hormones
- C12N2501/38—Hormones with nuclear receptors
- C12N2501/39—Steroid hormones
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/72—Assays involving receptors, cell surface antigens or cell surface determinants for hormones
- G01N2333/723—Steroid/thyroid hormone superfamily, e.g. GR, EcR, androgen receptor, oestrogen receptor
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2469/00—Immunoassays for the detection of microorganisms
- G01N2469/10—Detection of antigens from microorganism in sample from host
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Food Science & Technology (AREA)
- Biophysics (AREA)
- Endocrinology (AREA)
- Reproductive Health (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for establishing a granulosa cell in vitro model of follicular cyst. The granulosa cells are stimulated to express related marker molecules of spontaneous follicular vesicle granulosa cells by adding cortisol into the in vitro cultured granulosa cell fluid, and a granulosa cell in vitro culture model of the cyst follicles is established. The method can be used for in vitro research of molecular mechanism of follicular cyst formation or development of related drugs for follicular cyst diseases.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a method for establishing a granulosa cell in vitro model of follicular cyst.
Background
Follicular cysts are common reproductive disorders that severely affect reproductive performance in women or dams. For human, a patient with follicle cyst can not normally ovulate, and the physical and psychological health of a female is seriously affected; for female animals, the number of non-productive days increases and annual number born decreases rapidly due to the repeated infertility of sick female animals. Follicular cysts are common reproductive disorders, but the pathogenesis remains unclear. Research shows that when the body is stimulated by injury, fright, intense fluctuation of emotion and the like in the growth, development and maturation period of the follicle, the secretory activity of the hypothalamus-pituitary-adrenal axis is enhanced, so that the secretion level of glucocorticoid of adrenal gland is sharply increased, the mature follicle before ovulation cannot ovulate, the follicle continuously exists and is not ruptured, and follicular fluid is continuously increased to form a cyst follicle. Due to the lack of a proper research model, the research on the formation, occurrence, development, treatment and the like of the follicular cyst is always in a standstill, and at present, no method for accurately predicting the formation of the follicular cyst in vivo exists, and an effective treatment means is lacked.
At present, the follicle cyst of the female animal cannot be predicted, and the follicle cyst is known to occur only by observing the ovary after tools such as B ultrasonic and the like or the female animal with abnormal estrus is culled and slaughtered, so that the follicle cyst cannot be found and treated in time.
The existing effective method for treating the follicular cyst is not only few, but also has high recurrence rate. Granulosa cells are the most important somatic cells in follicles, and are used as important components of the structure and the function of the follicles, and have a decisive role in the growth, development and maturation of the follicles. Along with the growth, atresia, ovulation and luteal formation of the follicle, the granulosa cell not only has corresponding changes in morphology and function and participates in regulating the growth and development of the follicle and the oocyte, but also maintains the normal microenvironment of the follicle for the growth and development of the follicle by expressing gonadotropin receptors, secreting steroid hormones, cytokines, growth factors and the like. However, to date, there has been no report on establishing an in vitro model of follicular granulosa cells in cysts against follicular cysts. How to establish a granulosa cell in vitro model of the follicular cyst has important significance for researching a molecular mechanism of follicular cyst formation and researching and developing targeted drugs. However, there is currently no effective method for establishing an in vitro model of granulosa cells from follicular cysts.
Disclosure of Invention
In order to solve the above technical problems, the present invention provides a method for establishing an in vitro model of granulosa cells of follicular cysts.
In order to achieve the purpose, the invention adopts the following technical scheme that:
a method of establishing an in vitro model of granulosa cells of a follicular cyst, comprising the steps of:
s1, culturing the follicular granulosa cells in vitro;
s2, culturing the granular cells cultured in the step S1 in a DMEM/F12 culture medium without fetal bovine serum, adding cortisol for continuous culture, removing supernatant after the cells are attached to the wall, washing the cells with PBS for later use, taking part of the cells for detection in the step S3, and meanwhile, setting the culture medium without cortisol for culture as a control;
s3, detecting the molecular marker of the cyst-follicular granulosa cells cultured in vitro by RT-QPCR and Western Blot, and if the cultured cortisol-treated granulosa cells significantly express GR and 11 beta-HSD compared with the control, indicating that the granulosa cell in vitro model of the follicular cyst is successful.
The method as described above, preferably, in step S1, the concentration of fetal calf serum is 10% by volume, the concentration of streptomycin is 100U/ml, and the culture conditions are 37 ℃ and 5% CO295% air, 100% relative humidity CO2Culturing in an incubator for 48 h.
As described above, preferably, in step S2, DMEM/F12 without FBS is cultured for 12 hours, and cortisol is continued to culture the cells for 24 hours.
In the method, the cortisol is preferably added at a concentration of 10-2000mmol/L in step S2. Further, cortisol was added at a concentration of 1000 mmol/L.
The method as described above, preferably, in step S3, in the RT-qPCR assay, the primers used for detecting the expression level of GR mRNA are shown in SEQ ID NO.1 and SEQ ID NO. 2; primers used for detecting the mRNA expression quantity of 11 beta-HSD 1 are shown as SEQ ID NO.3 and SEQ ID NO. 4; western Blot was used to detect GR protein expression.
As described above, preferably, in step S3, the significant expression is statistically analyzed using SPSS. Furthermore, when the expression level of GR mRNA, the expression level of GR protein and the expression level of 11 β -HSD1 were 1.2 times or more higher than the control, it was shown that the granulosa cell in vitro model with follicular cyst was successful.
The invention has the beneficial effects that:
the invention provides a method for establishing a granulosa cell in vitro model of a follicular cyst, which particularly adopts cortisol to treat in vitro granulosa cells and stimulates the granulosa cells to specifically and highly express cyst follicular marker molecules GR and 11 beta-HSD, so as to establish an in vitro cyst follicular granulosa cell culture model which can be used for molecular mechanism related research of follicular cyst diseases or for research and development of reagents or medicines for clinical prevention and treatment of follicular cyst.
The granulosa cell is an important component of the structure and function of the follicle, and the granulosa cell model in the follicular cyst state provided by the invention can provide a research tool for the occurrence, development, formation and treatment of the follicular cyst.
Drawings
FIG. 1 is the relative expression intensity of the granulosa cell immunohistochemical GR.
FIG. 2 shows relative expression intensities of granulosa cells immunohistochemistry for 11 β -HSD1, Primary (Primary), Secondary (Secondary), Tertiary (Tertiary), and cystic (Cyst).
FIG. 3 shows the relative expression intensity of granular cell immunohistochemistry for 11 β -HSD 2.
FIG. 4 shows the granulosa cell viability 24h after treatment of granulosa cells with different concentrations of cortisol
FIG. 5 shows the Western Blot detection of GR after 1000mmol/L cortisol treatment of granulosa cells for 24 h.
FIG. 6 shows the relative expression level of GR protein 24h after 1000mmol/L cortisol treatment of granulosa cells
FIG. 7 shows the relative expression level of GR mRNA 24h after 1000mmol/L cortisol-treated granulosa cells.
FIG. 8 shows the relative expression of 11 β -HSD1mRNA 24h after treatment of granulosa cells with 1000mmol/L cortisol.
FIG. 9 shows the relative expression of 11 β -HSD2mRNA 24h after treatment of granulosa cells with 1000mmol/L cortisol.
Detailed Description
Research shows that whether the organism is a spontaneous or induced follicular cyst, the immunohistochemical result of the cyst follicular granular cell shows that the expressions of Glucocorticoid Receptor (GR) and Glucocorticoid metabolic enzyme (11 beta-hydroxysteroid dehydrogenase, 11 beta-HSD) are obviously higher than those of a normal tertiary follicle (as shown in figure 1, figure 2 and figure 3), so that compared with the normal follicular granular cell, based on the specific expression results of a pathological cyst follicular granular cell marker gene and protein, whether the expression molecules of the in vitro granular cell are consistent with the expression of granular cells in a natural cyst follicle is detected by culturing the granular cell in vitro, and the success of the granular cell model cultured in vitro (granular cells in a cyst follicular state) is judged. The invention establishes the cyst follicular granular cell in vitro model by means of cortisol treatment, and has important significance for researching molecular mechanism of follicular cyst formation and researching and developing targeted drugs.
The following examples are intended to further illustrate the invention but should not be construed as limiting it. Modifications and substitutions may be made thereto without departing from the spirit and scope of the invention.
Unless otherwise indicated, the technical means used in the examples are conventional means well known to those skilled in the art, and unless otherwise specified, the reagents used in the methods are analytically pure or above.
Example 1
1. Cell culture
In the present invention, makeAnd (3) extracting follicular fluid in healthy follicles with the diameter of 3-6 mm on the ovary by using a 10 mL syringe with a No. 12 needle, collecting supernatant by adopting a standing method, centrifuging for 5 min at 1000 r/min, and removing the supernatant to obtain ovarian granulosa cells. The ovarian granulosa cells were distributed at 25 cm2Cell culture flasks (Corning) containing 10% FBS (fetal bovine serum, Biological Industries) and 100U/ml streptomycin (Biological Industries) in DMEM/F12 (Biological Industries) were placed at 37 ℃ and 5% CO295% air, 100% relative humidity CO2Culturing in an incubator for 48 h. When the cell fusion degree reaches 70-80%, 5 × 105Individual cells/well were seeded in six-well plates.
2. Cortisol treatment
And (3) replacing the culture medium with FBS-free DMEM/F12 containing 100U/ml streptomycin, placing the cells obtained in the step 1 into an incubator to be cultured for 12 hours continuously, adding cortisol into the FBS-free DMEM/F12 according to the concentration of 0, 10, 100, 200, 500, 1000 and 2000mmol/L to stimulate and culture the ovarian granulosa cells for 24 hours, allowing the cells to adhere to the wall, discarding the supernatant, injecting 3 ml PBS into the adherent cells, slightly washing the adherent cells in an inclined culture bottle for later use, repeating at least 3 times in each experiment, and repeating each batch of ovaries.
3. Detection method
Digesting the obtained adherent ovarian granulosa cells obtained by culture with trypsin (Biological Industries) at a concentration of 0.25%, blowing out the cells after digesting for 2 min, centrifuging for 5 min at 1000 r/min, discarding the supernatant, collecting the cell pellet, and counting the cells by using a TZ20TM counter (BIO-RAD).
A significant feature of follicular cysts is the massive disappearance of granulosa cells, indicating a significant reduction in cell viability during follicular cyst formation. The results show that: MTT cell activity detection method is adopted to find that when the concentration of cortisol is 1000mmol/L, the cell activity is obviously reduced, so that the concentration is adopted to carry out related experiments in subsequent treatment. Granulosa cell viability after 24h treatment of granulosa cells with different concentrations of cortisol, see figure 4.
Total protein detection was performed on the collected cells by Western blotting (Western Blot) as follows: adding protease inhibitor (Byunyan) and RIPA lysate (Biological Industries) into the cell sediment, cracking for 2 min on ice, repeatedly blowing and beating by using a pipette, transferring the cracked cells into a centrifugal tube of 1.5 mL, centrifuging for 5 min at 12000 r/min at 4 ℃, sucking supernatant, detecting the qualified protein concentration of each group by using a BCA kit, adding a loading buffer with the same volume into the centrifugal tube, heating for 7 min by using boiling water, cooling and storing at-20 ℃. 10 mul of denatured protein was sampled and electrophoretically separated in 12% SDS-PAGE with 80V 30 min and 120V 55 min. Then, PVDF membrane 260 mA is used for constant current transformation for 2h, PBS is used for washing once after the completion, the PVDF membrane is put into a sealing solution for sealing for 2h at room temperature, TBST is used for washing once, and primary anti-dilution solution of beta-actin (1: 4000, Proteintech) and GR (1: 2000, Abcam) is added respectively for incubation at 4 ℃ overnight. Washing the membrane with TBST for 5 min 3 times, adding secondary antibody of goat-anti-mouse and goat-anti-rabbit marked with HRP (1: 4000, Proteintech) respectively, incubating at room temperature for 2h, and washing with TBST for 5 min 3 times. Soaking the PVDF film in ECL developing solution (BIO-RAD) for 3 min, and exposing, developing and fixing in a dark room. Image Lab chamber (BIO-RAD) software was used to read the band grayscale values. Each experiment was repeated 3 times.
The results of Western Blot are shown in FIG. 5, which shows that the protein contains β -actin and GR. Beta-actin is used as a conventional reference, and the presence of beta-actin indicates that the test is operated correctly and the test conditions are consistent in the test. By measuring the content of glucocorticoid receptor protein by Western Blot, the expression of the invention after treatment with cortisol is increased by 1.40 times compared with that in a control group (the added amount of cortisol is 0), SPSS statistical analysis is obvious and is consistent with the research result of granulosa cells of spontaneous follicular cyst in the prior art (shown in figure 1), wherein the result of measuring the content of glucocorticoid receptor protein is shown in figure 6 when the amount of cortisol is 1000 mmol/L.
And carrying out fluorescent quantitative PCR detection on the granulocyte marker molecules-GR and 11 beta-HSD of the follicular cyst. The PCR primer sequences for GR and 11. beta. -HSD1/2 are shown in Table 1 below.
TABLE 1
| Follicular cyst marker molecule | Primer sequences |
| GR | Upstream (SEQ ID NO. 1): CCAGTGTTCCAGAGAACCCC |
| GR | Downstream (SEQ ID NO. 2): TCTGACCCTTCACATTCGGC |
| 11β-HSD1 | Upstream (SEQ ID NO. 3): TTAGGGCTGGGCATGATAAG |
| 11β-HSD1 | Downstream (SEQ ID NO. 4): AGCTTGTGAGATGCGATGTG |
| 11β-HSD2 | Upstream (SEQ ID NO. 5): CAATGCAGGCCACAACATCC |
| 11β-HSD2 | Downstream (SEQ ID NO. 6): GGCAGACAAGCACGGAAATG |
The specific operation is as follows:
extracting total RNA of cells, extracting the total RNA and carrying out reverse transcription according to the operation instructions of an RNA extraction kit (RNAzol RT) and a reverse transcription kit (BIO-RAD), diluting the obtained cDNA by 10 times for later use or storing at the temperature of minus 20 ℃ after the reverse transcription reaction is finished, and the reaction procedures are shown in tables 2 and 3.
TABLE 2 reverse transcription System
| Reagent | Usage amount of mu L |
| 5×iScript Reaction Mix | 4 |
| iScript Reverse Transcriptase | 1 |
| Nuclease-free water | 11 |
| RNAtemplate（100fg-1ug total RNA） | 4 |
| |
20 |
TABLE 3 fluorescent quantitative PCR reaction procedure
| Item | Step (ii) of |
| Priming | 5 min at 25 |
| Reverse transcription | |
| 20 min at 46 ℃ | |
| RT inactivation | 1 min at 95 ℃ |
| Optional step | Hold at 4 ℃ |
After the ovarian granulosa cells are treated by cortisol in vitro for 24 hours, the mRNA and protein expression levels of the follicular cyst marker molecule GR are obviously higher than those of a control group, and for example, the mRNA and protein expression levels are respectively increased by 1.24 times and 1.40 times after the cortisol body with the concentration of 1000mmol/L compared with that of the control group (the protein expression levels are respectively increased by (1.24 times and 1.40 times) ((the protein expression levels are respectively increased by)P< 0.05) (see FIGS. 7 and 6). Meanwhile, the mRNA expression level of the cortisol-treated granulosa cell 11 beta-HSD 1 is obviously increased, wherein when the cortisol is treated at the concentration of 1000mmol/L, the mRNA expression level of 11 beta-HSD 1 is improved by 1.52 times compared with that of a control group (figure 8), and the mRNA expression level of 11 beta-HSD 2 is not obviously changed compared with that of the control group (figure 9), which is consistent with the research result of the granulosa cell with spontaneous follicular cyst in the prior art (figures 2 and 3).
The results of the present invention indicate that, when granulosa cells are cultured with cortisol added in vitro, the granulosa cells show the state (increased expression of GR, 11 β -HSD 1) exhibited by granulosa cells in follicular cysts in vivo, indicating that the granulosa cells are identical to or close to granulosa cells in follicular cysts. Thereby judging the success of establishing the cyst granular cell in vitro model.
Through the cell model, drugs for potentially preventing and treating the follicular cyst can be added in the culture process, and the screening of time and dosage is carried out, so that a guidance basis is provided for in vivo experiments.
Sequence listing
<110> agriculture and forestry academy of sciences of Beijing City
<120> a method for establishing a granulosa cell in vitro model of follicular cyst
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
Claims (7)
1. A method of establishing an in vitro model of granulosa cells of a follicular cyst, comprising the steps of:
s1, obtaining ovarian granulosa cells for in vitro culture; culturing the granular cells by adopting a DMEM/F12 culture medium containing the streptomycin and the fetal calf serum;
s2, culturing the granular cells cultured in the step S1 in a DMEM/F12 culture medium without fetal bovine serum, adding cortisol for continuous culture, removing supernatant after the cells are attached to the wall, washing the cells with PBS for later use, taking part of the cells for detection in the step S3, and meanwhile, setting the culture medium without cortisol for culture as a control;
s3, detecting cyst-follicular granulosa cells molecules of granulosa cells cultured in vitro by RT-QPCR and Western Blot, and if the granulosa cells treated by the cultured cortisol significantly express GR and 11 beta-HSD compared with a control, indicating that the granulosa cell in vitro model of the follicular cyst is successful.
2. The method according to claim 1, wherein in step S1, the concentration of fetal calf serum is 10% by volume, the concentration of streptomycin is 100U/ml, and the culture conditions are 37 ℃ and 5% CO295% air, 100% relative humidity CO2Culturing in an incubator for 48 h.
3. The method of claim 1, wherein in step S2, DMEM/F12 without FBS is cultured for 12h, and cortisol is continued to culture the cells for 24 h.
4. The method of claim 1, wherein in step S2, the cortisol is added at a concentration of 10-2000 mmol/L.
5. The method of claim 4, wherein in step S2, cortisol is added at a concentration of 1000 mmol/L.
6. The method according to claim 1, wherein in step S3, in the RT-QPCR assay, primers for detecting the expression level of GR mRNA are shown as SEQ ID NO.1 and SEQ ID NO. 2; primers used for detecting the mRNA expression quantity of 11 beta-HSD 1 are shown as SEQ ID NO.3 and SEQ ID NO. 4; western Blot is used for detecting the expression of beta-actin and GR proteins.
7. The method of claim 1, wherein in step S3, statistical analysis of SPSS is performed to show that the success of the granulosa cell in vitro model of follicular cyst is achieved when the expression level of GR mRNA, the expression level of GR protein, and the expression level of 11 β -HSD1 are 1.2 times or more higher than the control.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210000606.XA CN113999811B (en) | 2022-01-04 | 2022-01-04 | Method for establishing granulosa cell in vitro model of follicular cyst |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210000606.XA CN113999811B (en) | 2022-01-04 | 2022-01-04 | Method for establishing granulosa cell in vitro model of follicular cyst |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113999811A true CN113999811A (en) | 2022-02-01 |
| CN113999811B CN113999811B (en) | 2022-04-05 |
Family
ID=79932545
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210000606.XA Active CN113999811B (en) | 2022-01-04 | 2022-01-04 | Method for establishing granulosa cell in vitro model of follicular cyst |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113999811B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20170065561A1 (en) * | 2014-05-02 | 2017-03-09 | Cambridge Enterprise Limited | Methods of cancer therapy |
| CN106701659A (en) * | 2016-10-31 | 2017-05-24 | 四川农业大学 | Porcine ovarian granulosa cell primary culture method |
| CN110499280A (en) * | 2018-11-26 | 2019-11-26 | 北京市水产科学研究所（国家淡水渔业工程技术研究中心） | The vitro construction method and its agents useful for same of a kind of sterlet thecacells system |
| CN112852712A (en) * | 2021-02-08 | 2021-05-28 | 大理大学 | Method for separating, primary culturing and subculturing granulosa cells in pig ovary GV stage follicle |
| CN113462635A (en) * | 2021-07-27 | 2021-10-01 | 河北农业大学 | Method for separating, culturing and identifying sheep ovarian granulosa cells |
-
2022
- 2022-01-04 CN CN202210000606.XA patent/CN113999811B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20170065561A1 (en) * | 2014-05-02 | 2017-03-09 | Cambridge Enterprise Limited | Methods of cancer therapy |
| CN106701659A (en) * | 2016-10-31 | 2017-05-24 | 四川农业大学 | Porcine ovarian granulosa cell primary culture method |
| CN110499280A (en) * | 2018-11-26 | 2019-11-26 | 北京市水产科学研究所（国家淡水渔业工程技术研究中心） | The vitro construction method and its agents useful for same of a kind of sterlet thecacells system |
| CN112852712A (en) * | 2021-02-08 | 2021-05-28 | 大理大学 | Method for separating, primary culturing and subculturing granulosa cells in pig ovary GV stage follicle |
| CN113462635A (en) * | 2021-07-27 | 2021-10-01 | 河北农业大学 | Method for separating, culturing and identifying sheep ovarian granulosa cells |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113999811B (en) | 2022-04-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108949988A (en) | A kind of application of long-chain non-coding RNA SNHG6 in breast cancer diagnosis or treatment | |
| CN110129428A (en) | The application of miR-26a adjusting apoptosis of germ cells | |
| CN113999811B (en) | Method for establishing granulosa cell in vitro model of follicular cyst | |
| CN110511903A (en) | A kind of Study on Molecular Mechanism method and its application of miR-21-5p targeting Smad7 regulation pig ovary granular cell | |
| CN111748559B (en) | Application of CTNNB1 gene in porcine ovary granular cells | |
| CN110229901A (en) | Gene hsa_circ_0027089 relevant to triple negative breast cancer diagnosis and treatment and its application | |
| CN113817846A (en) | circRNA related to porcine luminal ovarian follicular atresia, siRNA inhibitor thereof and application thereof | |
| CN116355843A (en) | Autologous mitochondria for improving oocyte quality | |
| CN111118170B (en) | Application of chi-miR-450-5p as goat follicle maturation miRNA marker | |
| Gao et al. | Glutamic acid decarboxylase message isoforms in human suprachiasmatic nucleus | |
| CN108676874B (en) | Application of circulating exosome long-chain non-coding RNA-TC0101441 as marker for diagnosing endometriosis | |
| CN110157708A (en) | It is a kind of inhibit human glioma targeting linc01023 gene inhibitor and its application | |
| CN104232643A (en) | RNAi (ribonucleic acid interference) interference segment, interference vector, and preparation method and application thereof | |
| CN111073900B (en) | Method for improving development efficiency of pig cloned embryo | |
| CN109750038B (en) | Long non-coding RNA and application thereof in preparation of medicines for diagnosing preeclampsia and treating target spot | |
| Yingping et al. | The effect of LINC9137 targeting miR-140-3p-NKAIN3 signal axis on the development of goose testis sertoli cells | |
| CN110106182B (en) | Application of p65 gene in porcine ovarian granulosa cells | |
| CN113832235A (en) | lncRNA marker related to piglet bacterial diarrhea resistance and application thereof | |
| CN104726459B (en) | A kind of DNA sequence dna of shRNA sequences of IER 5-coded gene and its carrier and application | |
| CN109486953A (en) | Application and reagent of the ECM1 molecular labeling in preparation bladder cancer detection reagent | |
| CN110257522A (en) | Gene hsa_circ_0045881 relevant to breast cancer diagnosis and treatment and its application | |
| CN117144014A (en) | Molecular marker for monitoring and evaluating breast cancer metastasis risk and application thereof | |
| CN110669815B (en) | Application of cell model in detection of SNAI1 gene expression change caused by propofol | |
| CN112662621B (en) | Method for reversing mesenchymal stem cell aging and application | |
| CN114134146B (en) | Long-chain non-coding RNA and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |