Disclosure of Invention
The invention aims to solve the technical problems that the existing LAMP method needs more primers or probes for detecting miRNA, has long sequence, causes low detection efficiency, and the miRNA tailing reverse transcription pretreatment process cannot be adapted to isothermal amplification, namely the novel molecular amplification detection technology.
The invention solves the technical problems through the following technical means:
a reverse transcription-strand displacement amplification (RT-SDA) method for miRNA detection, comprising the steps of:
s1, carrying out poly (A) tailing reaction on the miRNA single strand to obtain a C1 strand;
s2, reverse transcription reaction: carrying out reverse transcription reaction on the C1 chain under the action of a reverse transcription primer P1 to generate a C2 chain which is reversely complementary with the C1 chain and is used as a cDNA template for detecting miRNA target molecules in SDA reaction;
s3 and an SDA reaction upstream primer P2 take a C2 chain as a template, and carry out chain hybridization and extension reaction in sequence to generate a C3 chain;
the nucleotide sequence of the upstream primer P2 is shown as the general formula (I):
P-F(I)
wherein, P is the 5' end sequence of the RT-SDA reaction upstream primer P2, and comprises the restriction enzyme cutting site recognition sequence of restriction endonuclease and the protection base thereof; f is a 3 'end sequence of an RT-SDA reaction upstream primer P2, the nucleotide sequence of the F is the same as the 8-14 base sequences at the 5' end of any miRNA target molecule, except that uracil residues are replaced by thymine residues;
after the S4 and the C3 strands and the C2 strand form complementary DNA double strands, carrying out enzyme digestion reaction under the catalysis of a nicking endonuclease, and cutting a nick on the C3 strand;
the sequences of S5 and the 5 'end of the C3 chain nick continue to extend, and the sequence of the 3' end of the C3 chain nick is replaced to generate a C4 chain; meanwhile, a new C3-C2 DNA double-chain structure is formed, and the steps S4 and S5 are continuously repeated to react, so that a large amount of C4 chains are generated;
s6, SDA reaction downstream primer P3 or SDA reaction downstream probe P4 take a C4 chain as a template, and carry out chain hybridization and extension reaction in sequence to generate a C5 chain;
the nucleotide sequence of the downstream primer P3 is shown as a general formula (II):
P-R(II)
wherein, P is the 5 'end sequence of the downstream primer P3 of the RT-SDA reaction, including the restriction site recognition sequence of the restriction endonuclease and the protective base thereof, R is the 3' end sequence of the downstream primer P3 of the RT-SDA reaction, and the nucleotide sequence of the 3 'end sequence is the same as the 8-14 base sequences of the 5' end of the reverse transcription primer P1;
the nucleotide sequence of the downstream probe P4 is shown as a general formula (III):
P-B1-B2-R(III)
wherein, P-B1-B2 is a 5' end sequence of a RT-SDA reaction downstream probe P4, and comprises a restriction enzyme cutting site recognition sequence of a restriction endonuclease and a protective base thereof; bases B1 and B2 are labeled fluorophore and quencher, respectively; r is a 3 'end sequence of a downstream probe P4 of RT-SDA reaction, and the nucleotide sequence of the R is the same as the 8-14 base sequences at the 5' end of a reverse transcription primer P1;
after the S7 and the C5 strands and the C4 strand form complementary DNA double strands, carrying out enzyme digestion reaction under the action of a nicking endonuclease, and cutting a nick on the C5 strand;
the sequences of S8 and the 5 'end of the C5 chain nick continue to extend, and the sequence of the 3' end of the C5 chain nick is replaced to generate a C6 chain; meanwhile, a new C5-C4 DNA double-chain structure is formed, and the steps S7 and S8 are continuously repeated to react, so that a large amount of C6 chains are generated;
the sequences of the S9 and the C6 chains are completely the same as the sequence of the C2 chain, the reactions of the steps S4-S5 can be continuously carried out to generate a large amount of C4 chains, and the reactions of the steps S7-S8 are continuously carried out to generate a large amount of C6 chains again; the amplification reaction can be continuously carried out in a circulating reciprocating way, so that the amplification product and the fluorescence signal are increased exponentially.
Preferably, the miRNA comprises one or more of a humoral miRNA, a fresh tissue or paraffin tissue miRNA, total RNA, an artificially synthesized miRNA molecule.
Preferably, the nicking endonuclease comprises any one of nb.
The upstream primer, the downstream primer or the downstream probe provided by the invention have no sequence complementary relation, so that the nonspecific amplification generated by mutual hybridization between the primers or between the primers and the probes can be effectively reduced, the sequences of the primers and the probes are short, the double-strand binding efficiency cannot be reduced due to the formation of a dimer structure under a constant temperature condition, and the amplification reaction efficiency cannot be influenced.
The invention also provides a reverse transcription-strand displacement amplification dye method kit for miRNA detection, which comprises the reverse transcription primer P1, the upstream primer P2 and the downstream primer P3.
Further, the dye method kit also comprises components for miRNA tailing reverse transcription reaction: poly (A) polymerase, reverse transcriptase, ATP, dNTPs and reaction buffer; the reaction buffer solution comprises Tris-HCl pH 8.3, NaCl, KCl and MgCl2、DTT;
The dye method kit also comprises components for carrying out strand displacement isothermal amplification reaction: DNA polymerase, nicking endonuclease, dNTPs, fluorescent dye and reaction buffer solution; the reaction buffer solution comprises Tris-HCl pH 7.9, NaCl and MgCl2、BSA。
Further, the concentration of each component used by the dye method kit in carrying out miRNA tail-adding reverse transcription in a reaction system is as follows: 10-100mM Tris-HCl pH 8.3, 10-100mM NaCl, 10-100mM KCl, 1-50mM MgCl21-100mM DTT, 1-50nM reverse transcription primer, 0.1-2.0mM ATP, 0.1-10U/. mu.L Poly (A) polymerase, 1-50U/. mu.L reverse transcriptase, 0.1-2.0mM dNTP;
the concentrations of the components used by the dye method kit in the strand displacement isothermal amplification in a reaction system are respectively as follows: 10-100mM Tris-HCl pH 7.9, 50-200mM NaCl, 5-50mM MgCl250-200 mug/mL BSA, 0.05-0.5U/. mu.L DNA polymerase, 0.05-0.5U/. mu.L nicking endonuclease, 0.025-0.5mM dNTPs, 0.025-0.5. mu.M upstream primer, 0.025-0.5. mu.M downstream primerPrimer, 1 × fluorescent dye.
Further, the concentration of each component used by the dye method kit in carrying out miRNA tail-adding reverse transcription in a reaction system is as follows: 20-80mM Tris-HCl pH 8.3, 20-80mM NaCl, 20-80mM KCl, 5-30mM MgCl25-50mM DTT, 2-20nM reverse transcription primer, 0.2-1.0mM ATP, 0.2-5.0U/. mu.L Poly (A) polymerase, 2-20U/. mu.L reverse transcriptase, 0.2-1.0mM dNTP;
the concentrations of the components used by the dye method kit in the strand displacement isothermal amplification in a reaction system are respectively as follows: 20-80mM Tris-HCl pH 7.9, 80-150mM NaCl, 10-30mM MgCl280-150 mu g/mL BSA, 0.1-0.3U/. mu.L DNA polymerase, 0.1-0.3U/. mu.L nicking endonuclease, 0.05-0.4mM dNTPs, 0.05-0.3. mu.M upstream primer, 0.05-0.3. mu.M downstream primer and 1 Xfluorescent dye.
Further, the reaction conditions of the dye method kit in miRNA tailing reverse transcription are as follows: preserving heat at 37-42 deg.C for 15-60min, and heating at 65-95 deg.C for 5-20 min;
the reaction conditions of the dye method kit in the strand displacement isothermal amplification are as follows: preserving heat at 37-65 deg.C for 15-60min, and heating at 70-95 deg.C for 5-20 min.
The invention also provides a reverse transcription-strand displacement amplification probe method kit for miRNA detection, which comprises the reverse transcription primer P1, an upstream primer P2 and a downstream probe P4.
Further, the probe method kit further comprises components for miRNA tailing reverse transcription reaction: poly (A) polymerase, reverse transcriptase, ATP, dNTPs and reaction buffer; the kit for the probe method also comprises components for miRNA tailing reverse transcription reaction: poly (A) polymerase, reverse transcriptase, ATP, dNTPs and reaction buffer;
the probe method kit also comprises components for carrying out a strand displacement isothermal amplification reaction: DNA polymerase, nicking endonuclease, dNTPs and reaction buffer solution; the reaction buffer solution comprises Tris-HCl pH 7.9, NaCl and MgCl2、BSA。
Furthermore, the probe method kit carries out miRNAThe concentrations of the components used in tailing reverse transcription in the reaction system are respectively as follows: 10-100mM Tris-HCl pH 8.3, 10-100mM NaCl, 10-100mM KCl, 1-50mM MgCl21-100mM DTT, 1-50nM reverse transcription primer, 0.1-2.0mM ATP, 0.1-10U/. mu.L Poly (A) polymerase, 1-50U/. mu.L reverse transcriptase, 0.1-2.0mM dNTP;
the concentration of each component used by the probe method kit in carrying out strand displacement isothermal amplification in a reaction system is as follows: 10-100mM Tris-HCl pH 7.9, 50-200mM NaCl, 5-50mM MgCl250-200 mug/mL BSA, 0.05-0.5U/. mu.L DNA polymerase, 0.05-0.5U/. mu.L nicking endonuclease, 0.025-0.5mM dNTPs, 0.025-0.5. mu.M upstream primer and 0.025-0.5. mu.M downstream probe.
Furthermore, the concentration of each component used by the probe method kit in the miRNA tail-adding reverse transcription in a reaction system is as follows: 10-100mM Tris-HCl pH 8.3, 10-100mM NaCl, 10-100mM KCl, 1-50mM MgCl21-100mM DTT, 1-50nM reverse transcription primer, 0.1-2.0mM ATP, 0.1-10U/. mu.L Poly (A) polymerase, 1-50U/. mu.L reverse transcriptase, 0.1-2.0mM dNTP;
the concentration of each component used by the probe method kit in carrying out strand displacement isothermal amplification in a reaction system is as follows: 20-80mM Tris-HCl pH 7.9, 80-150mM NaCl, 10-30mM MgCl280-150 mu g/mL BSA, 0.1-0.3U/. mu.L DNA polymerase, 0.1-0.3U/. mu.L nicking endonuclease, 0.05-0.4mM dNTPs, 0.05-0.3. mu.M upstream primer and 0.05-0.3. mu.M downstream probe.
Furthermore, the reaction conditions of the probe method kit in miRNA tail-adding reverse transcription are as follows: preserving heat at 37-42 deg.C for 15-60min, and heating at 65-95 deg.C for 5-20 min;
the reaction conditions of the probe method kit in the strand displacement isothermal amplification are as follows: preserving heat at 37-65 deg.C for 15-60min, and heating at 70-95 deg.C for 5-20 min.
The invention has the following beneficial effects:
1. the upstream primer, the downstream primer or the downstream probe provided by the invention have no sequence complementary relation, so that the nonspecific amplification generated by mutual hybridization between the primers or between the primers and the probes can be effectively reduced, the sequences of the primers and the probes are short, the double-strand binding efficiency cannot be reduced due to the formation of a dimer structure under a constant temperature condition, and the amplification reaction efficiency cannot be influenced.
2. According to the dye method or probe method reaction system for detecting miRNA by RT-SDA provided by the invention, when any miRNA target molecule is detected, quantitative detection of any miRNA target molecule can be realized only by designing and synthesizing different upstream primers according to different miRNA molecule sequences and without repeatedly designing and synthesizing different downstream primers or downstream probes, so that the detection efficiency is improved, and the detection cost is greatly reduced.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings and the embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Test materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
The specific techniques or conditions not specified in the examples can be performed according to the techniques or conditions described in the literature in the field or according to the product specification.
The reverse transcription-strand displacement amplification method for miRNA detection provided by the invention is suitable for any type of miRNA, including natural miRNA molecules of all eukaryotes such as human beings, animals, plants and the like, such as one or more of body fluid circulating miRNA, fresh tissue or paraffin tissue miRNA and total RNA, and can also include any artificially synthesized miRNA molecules. The method of the present invention is described in the following examples using artificially synthesized miR-320 molecular standards (AAAAGCUGGGUUGAGAGGGCGA, SEQ ID NO:5) as an example.
The sequences referred to in the examples below were all synthesized using known techniques.
Example 1
The dye method for detecting miRNA by RT-SDA comprises the following steps:
in this embodiment, an artificially synthesized miR-320 standard is used as a sample, a dye method detection scheme for detecting miRNA by RT-SDA is constructed according to the technical principle shown in fig. 1, and a 20 μ L reaction system is specifically prepared according to the following requirements:
reaction buffer 2.0. mu.L (final concentrations: 50mM Tris-HCl pH 7.9, 100mM NaCl, 10mM MgCl, respectively)2100. mu.g/mL BSA), 0.125. mu.M upstream primer P2(SEQ ID NO:2), 0.125. mu.M downstream primer P3(SEQ ID NO:3), 0.1U/. mu.L DNA polymerase, 0.2U/. mu.L Nt.BstNBI, 0.125mM dNTPs, 1 XGreen dye, and sequentially diluting cDNA synthesized by tailing reverse transcription of 10pM miR-320 molecular standard into three concentrations of mother solution (10 pM miR-320 molecular standard)-1、10-2And 10-3) Taking 1.0 mu L of mother liquor as templates of three reactions, adding water to 20 mu L, preserving heat at 55 ℃ for 40min, heating at 85 ℃ for 5min to terminate the reaction, wherein each cycle is separated by 1min, collecting a fluorescence signal after each cycle is finished, and collecting the fluorescence signals 40 times in total, wherein the RT-SDA amplification detection result is shown in figure 2.
According to the results shown in fig. 2, it can be seen that three test groups for detecting miRNA by using the RT-SDA dye method all show standard "S" type amplification curves, which fully indicates that the RT-SDA dye method provided by the present invention can achieve effective detection of miRNA; meanwhile, the linear correlation between the amplification curves corresponding to the synthesized cDNA template after three times of gradient dilution is higher, which shows that the RT-SDA dye method provided by the invention can efficiently realize the amplification detection of miRNA molecules.
According to the method for detecting miRNA by RT-SDA, on the premise of not changing the sequences of the upstream primer and the downstream primer, only the base of the downstream primer is modified by a fluorescent group and a quenching group, so that the obtained probe can be used for a probe method detection test, and further, the miRNA can be quantitatively detected by using a RT-SDA probe method detection scheme, which is verified by the following example 2.
Example 2
The detection method of the RT-SDA miRNA detection probe method comprises the following steps:
in this embodiment, an artificially synthesized miR-320 standard is used as a sample, a probe method detection scheme for detecting miRNA by RT-SDA is constructed according to the technical principle shown in fig. 1, and a 20 μ L reaction system is specifically prepared according to the following requirements:
reaction buffer 2.0. mu.L (final concentrations: 50mM Tris-HCl pH 7.9, 100mM NaCl, 10mM MgCl, respectively)2100. mu.g/mL BSA), 0.125. mu.M upstream primer P2(SEQ ID NO:2), 0.125. mu.M downstream probe P4(SEQ ID NO:4), 0.1U/. mu.L DNA polymerase, 0.2U/. mu.L Nt.BstNBI, 0.125mM dNTPs, and sequentially diluting cDNA synthesized by tailing reverse transcription of 10pM miR-320 molecular standard substance by reverse transcription primer P1(SEQ ID NO:1) into mother solution (10) with three concentrations-1、10-2And 10-3) Taking 1.0 mu L of mother liquor as templates of three reactions, adding water to 20 mu L, preserving the temperature at 55 ℃ for 40min, heating at 85 ℃ for 5min to terminate the reaction, wherein the interval of each cycle is 1min, collecting a fluorescence signal once after each cycle is finished, and collecting the fluorescence signals 40 times in total, wherein the RT-SDA amplification detection result is shown in figure 3.
According to the results shown in fig. 3, it can be seen that three test groups for detecting miRNA by the RT-SDA probe method all show a standard "S" type amplification curve, which fully indicates that the RT-SDA probe method provided by the present invention can achieve effective detection of miRNA; meanwhile, the linear correlation between the amplification curves corresponding to the synthesized cDNA template after three times of gradient dilution is higher, which shows that the RT-SDA probe method provided by the invention can efficiently realize the amplification detection of miRNA molecules.
Example 3
Based on the results of example 1, the present invention also provides a dye method kit that can be used for detecting miRNA in RT-SDA in example 1 above.
Provided withThe dye method kit for detecting miRNA by RT-SDA comprises a reverse transcription primer P1, an upstream primer P2 and a downstream primer P3 in example 1, and also comprises components for miRNA tailing reverse transcription reaction: poly (A) polymerase, reverse transcriptase, ATP, dNTPs and reaction buffer; the reaction buffer solution comprises Tris-HCl pH 8.3, NaCl, KCl and MgCl2DTT; the concentrations of all components used by the dye method kit in miRNA tailing reverse transcription in a reaction system are respectively as follows: 10-100mM Tris-HCl pH 8.3, 10-100mM NaCl, 10-100mM KCl, 1-50mM MgCl21-100mM DTT, 1-50nM reverse transcription primer, 0.1-2.0mM ATP, 0.1-10U/. mu.L Poly (A) polymerase, 1-50U/. mu.L reverse transcriptase, 0.1-2.0mM dNTP; preferably 20-80mM Tris-HCl pH 8.3, 20-80mM NaCl, 20-80mM KCl, 5-30mM MgCl25-50mM DTT, 2-20nM reverse transcription primer, 0.2-1.0mM ATP, 0.2-5.0U/. mu.L Poly (A) polymerase, 2-20U/. mu.L reverse transcriptase, 0.2-1.0mM dNTP; meanwhile, the kit also comprises components for carrying out the strand displacement isothermal amplification reaction: DNA polymerase, nicking endonuclease, dNTPs, fluorescent dye and reaction buffer solution; the reaction buffer solution comprises Tris-HCl pH 7.9, NaCl and MgCl2BSA; the concentrations of the components used by the dye method kit in the strand displacement isothermal amplification in the reaction system are respectively as follows: 10-100mM Tris-HCl pH 7.9, 50-200mM NaCl, 5-50mM MgCl250-200 mug/mL BSA, 0.05-0.5U/μ L DNA polymerase, 0.05-0.5U/μ L nicking endonuclease, 0.025-0.5mM dNTPs, 0.025-0.5 μ M upstream primer, 0.025-0.5 μ M downstream primer, 1 Xfluorescent dye; preferably 20-80mM Tris-HCl pH 7.9, 80-150mM NaCl, 10-30mM MgCl280-150 mu g/mL BSA, 0.1-0.3U/mu L DNA polymerase, 0.1-0.3U/mu L nicking endonuclease, 0.05-0.4mM dNTPs, 0.05-0.3 mu M upstream primer, 0.05-0.3 mu M downstream primer and 1 Xfluorescent dye;
the reaction conditions of the dye method kit of the embodiment when miRNA tail-adding reverse transcription is carried out are as follows: preserving heat at 37-42 deg.C for 15-60min, and heating at 65-95 deg.C for 5-20 min; then, the reaction conditions when strand displacement isothermal amplification is performed are as follows: preserving heat at 37-65 deg.C for 15-60min, and heating at 70-95 deg.C for 5-20 min.
Example 4
Based on the results of example 2, the present invention also provides a probe method kit that can be used for detecting miRNA in RT-SDA in example 2 above.
The provided kit for detecting miRNA by RT-SDA comprises a reverse transcription primer P1, an upstream primer P2 and a downstream probe P4 in example 2, and also comprises components for miRNA tailing reverse transcription reaction: poly (A) polymerase, reverse transcriptase, ATP, dNTPs and reaction buffer; the reaction buffer solution comprises Tris-HCl pH 8.3, NaCl, KCl and MgCl2And DTT. The concentration of each component used by the probe method kit in miRNA tailing reverse transcription in a reaction system is respectively as follows: 10-100mM Tris-HCl pH 8.3, 10-100mM NaCl, 10-100mM KCl, 1-50mM MgCl21-100mM DTT, 1-50nM reverse transcription primer, 0.1-2.0mM ATP, 0.1-10U/. mu.L Poly (A) polymerase, 1-50U/. mu.L reverse transcriptase, 0.1-2.0mM dNTP; preferably 20-80mM Tris-HCl pH 8.3, 20-80mM NaCl, 20-80mM KCl, 5-30mM MgCl25-50mM DTT, 2-20nM reverse transcription primer, 0.2-1.0mM ATP, 0.2-5.0U/. mu.L Poly (A) polymerase, 2-20U/. mu.L reverse transcriptase, 0.2-1.0mM dNTP; meanwhile, the kit also comprises components for carrying out the strand displacement isothermal amplification reaction: DNA polymerase, nicking endonuclease, dNTPs and reaction buffer solution; the reaction buffer solution comprises Tris-HCl pH 7.9, NaCl and MgCl2BSA; the concentration of each component used by the probe method kit in carrying out strand displacement isothermal amplification in a reaction system is as follows: 10-100mM Tris-HCl pH 7.9, 50-200mM NaCl, 5-50mM MgCl250-200. mu.g/mL BSA, 0.05-0.5U/. mu.L DNA polymerase, 0.05-0.5U/. mu.L nicking endonuclease, 0.025-0.5mM dNTPs, 0.025-0.5. mu.M upstream primer, 0.025-0.5. mu.M downstream probe, preferably 20-80mM Tris-HCl pH 7.9, 80-150mM NaCl, 10-30mM MgCl280-150 mu g/mL BSA, 0.1-0.3U/mu L DNA polymerase, 0.1-0.3U/mu L nicking endonuclease, 0.05-0.4mM dNTPs, 0.05-0.3 mu M upstream primer and 0.05-0.3 mu M downstream probe;
the reaction conditions of the probe method kit of the embodiment when miRNA tailing reverse transcription is performed are as follows: preserving heat at 37-42 deg.C for 15-60min, and heating at 65-95 deg.C for 5-20 min; then, the reaction conditions when strand displacement isothermal amplification is performed are as follows: preserving heat at 37-65 deg.C for 15-60min, and heating at 70-95 deg.C for 5-20 min.
The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some technical features may be equivalently replaced; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions of the embodiments of the present invention.