CN113981047A - Reverse transcription-strand displacement amplification method for miRNA detection and application - Google Patents
Reverse transcription-strand displacement amplification method for miRNA detection and application Download PDFInfo
- Publication number
- CN113981047A CN113981047A CN202111315193.6A CN202111315193A CN113981047A CN 113981047 A CN113981047 A CN 113981047A CN 202111315193 A CN202111315193 A CN 202111315193A CN 113981047 A CN113981047 A CN 113981047A
- Authority
- CN
- China
- Prior art keywords
- reverse transcription
- reaction
- mirna
- strand displacement
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 238000000034 method Methods 0.000 title claims abstract description 97
- 238000001514 detection method Methods 0.000 title claims abstract description 51
- 230000003321 amplification Effects 0.000 title claims abstract description 46
- 238000006073 displacement reaction Methods 0.000 title claims abstract description 46
- 238000003199 nucleic acid amplification method Methods 0.000 title claims abstract description 46
- 108091070501 miRNA Proteins 0.000 title claims abstract 36
- 239000002679 microRNA Substances 0.000 title claims abstract 36
- 238000006243 chemical reaction Methods 0.000 claims abstract description 97
- 239000000523 sample Substances 0.000 claims abstract description 73
- 238000010839 reverse transcription Methods 0.000 claims abstract description 59
- 238000011144 upstream manufacturing Methods 0.000 claims abstract description 33
- 239000002299 complementary DNA Substances 0.000 claims abstract description 11
- 238000009396 hybridization Methods 0.000 claims abstract description 7
- 230000000295 complement effect Effects 0.000 claims abstract description 5
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 claims description 72
- 239000000975 dye Substances 0.000 claims description 41
- TWRXJAOTZQYOKJ-UHFFFAOYSA-L Magnesium chloride Chemical compound [Mg+2].[Cl-].[Cl-] TWRXJAOTZQYOKJ-UHFFFAOYSA-L 0.000 claims description 40
- QKNYBSVHEMOAJP-UHFFFAOYSA-N 2-amino-2-(hydroxymethyl)propane-1,3-diol;hydron;chloride Chemical compound Cl.OCC(N)(CO)CO QKNYBSVHEMOAJP-UHFFFAOYSA-N 0.000 claims description 36
- 239000011780 sodium chloride Substances 0.000 claims description 36
- 229910001629 magnesium chloride Inorganic materials 0.000 claims description 34
- 238000011901 isothermal amplification Methods 0.000 claims description 26
- 239000011535 reaction buffer Substances 0.000 claims description 26
- 101710147059 Nicking endonuclease Proteins 0.000 claims description 24
- WCUXLLCKKVVCTQ-UHFFFAOYSA-M Potassium chloride Chemical compound [Cl-].[K+] WCUXLLCKKVVCTQ-UHFFFAOYSA-M 0.000 claims description 24
- 239000000243 solution Substances 0.000 claims description 21
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 claims description 20
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 claims description 20
- 102100031780 Endonuclease Human genes 0.000 claims description 20
- 101710124239 Poly(A) polymerase Proteins 0.000 claims description 20
- 108010092799 RNA-directed DNA polymerase Proteins 0.000 claims description 20
- 239000001103 potassium chloride Substances 0.000 claims description 16
- 238000010438 heat treatment Methods 0.000 claims description 14
- 239000002773 nucleotide Substances 0.000 claims description 13
- 125000003729 nucleotide group Chemical group 0.000 claims description 13
- 108091008146 restriction endonucleases Proteins 0.000 claims description 10
- 108020004635 Complementary DNA Proteins 0.000 claims description 4
- 108020004414 DNA Proteins 0.000 claims description 4
- 238000010804 cDNA synthesis Methods 0.000 claims description 4
- 238000001976 enzyme digestion Methods 0.000 claims description 4
- 239000007850 fluorescent dye Substances 0.000 claims description 4
- 230000001681 protective effect Effects 0.000 claims description 4
- 210000001124 body fluid Anatomy 0.000 claims description 3
- 239000010839 body fluid Substances 0.000 claims description 3
- 239000012188 paraffin wax Substances 0.000 claims description 3
- 108091034057 RNA (poly(A)) Proteins 0.000 claims description 2
- ISAKRJDGNUQOIC-UHFFFAOYSA-N Uracil Chemical group O=C1C=CNC(=O)N1 ISAKRJDGNUQOIC-UHFFFAOYSA-N 0.000 claims description 2
- 238000006555 catalytic reaction Methods 0.000 claims description 2
- RWQNBRDOKXIBIV-UHFFFAOYSA-N thymine Chemical group CC1=CNC(=O)NC1=O RWQNBRDOKXIBIV-UHFFFAOYSA-N 0.000 claims description 2
- 238000005580 one pot reaction Methods 0.000 abstract 1
- 108700011259 MicroRNAs Proteins 0.000 description 72
- 108091060302 Mir-320 Proteins 0.000 description 6
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 4
- 238000007397 LAMP assay Methods 0.000 description 4
- 238000012360 testing method Methods 0.000 description 4
- 206010028980 Neoplasm Diseases 0.000 description 3
- 238000011161 development Methods 0.000 description 3
- 230000015572 biosynthetic process Effects 0.000 description 2
- 238000007865 diluting Methods 0.000 description 2
- 239000012895 dilution Substances 0.000 description 2
- 238000010790 dilution Methods 0.000 description 2
- 239000000539 dimer Substances 0.000 description 2
- 239000012452 mother liquor Substances 0.000 description 2
- 239000010413 mother solution Substances 0.000 description 2
- 230000002194 synthesizing effect Effects 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- 241000196324 Embryophyta Species 0.000 description 1
- 241000206602 Eukaryota Species 0.000 description 1
- 241000282414 Homo sapiens Species 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 238000011529 RT qPCR Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000001815 biotherapy Methods 0.000 description 1
- 201000011510 cancer Diseases 0.000 description 1
- 230000015556 catabolic process Effects 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 238000006731 degradation reaction Methods 0.000 description 1
- 238000003745 diagnosis Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000012544 monitoring process Methods 0.000 description 1
- 108020004707 nucleic acids Proteins 0.000 description 1
- 150000007523 nucleic acids Chemical class 0.000 description 1
- 102000039446 nucleic acids Human genes 0.000 description 1
- 238000004393 prognosis Methods 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 238000003762 quantitative reverse transcription PCR Methods 0.000 description 1
- 238000010791 quenching Methods 0.000 description 1
- 230000000171 quenching effect Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000003757 reverse transcription PCR Methods 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 210000002966 serum Anatomy 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
The invention discloses a reverse transcription-strand displacement amplification method for miRNA detection, which combines reverse transcription reaction and strand displacement reaction, takes cDNA synthesized by miRNA tailing reverse transcription as a template, can realize exponential amplification of a target product and exponential growth of a signal through one-step reaction under the condition of constant temperature, and improves the detection efficiency; sequence complementary relation does not exist among the upstream primer, the downstream primer or the downstream probe, so that non-specific amplification generated by mutual hybridization among the primers or between the primers and the probes can be effectively reduced. The invention also provides a reverse transcription-strand displacement amplification dye method kit and a probe method kit for miRNA detection. When any miRNA target molecule is detected, only different upstream primers need to be designed and synthesized according to different miRNA molecule sequences, and different downstream primers or downstream probes do not need to be designed and synthesized repeatedly, so that the quantitative detection of any miRNA target molecule can be realized, and the detection efficiency is improved.
Description
Technical Field
The invention relates to the technical field of nucleic acid detection, in particular to a reverse transcription-strand displacement amplification method for miRNA detection and application thereof.
Background
MicroRNA (miRNA) is a non-coding single-stranded RNA which is coded by endogenous genes and has the length of about 22 nucleotides, and is proved to be involved in the regulation and control of various life activities. In recent years, researches show that various circulating miRNA molecules exist in body fluids such as serum and plasma, and early screening and prognosis monitoring of cancers can be realized by quantitatively detecting the expression level of the circulating miRNA molecules of a subject (see, for example, monophan et al, MicroRNA, a new target for cancer diagnosis and treatment, China journal of tumor biotherapy, 2014, volume 21, stage 6: 603-.
RT-qPCR is one of the commonly used methods for quantitative detection of miRNA (see Kramer M F, curr. Protoc. mol. biol.2011,95(1): Chapter 15: Unit 15.10); for example, patent CN105177132A discloses an RT-PCR method for quantitatively detecting miRNA. However, PCR is a temperature-variable amplification technique, and requires continuous temperature variation and precise temperature control to achieve effective amplification of target molecules, which puts high demands on the performance of detection equipment. With the rapid development of isothermal amplification technology, this technical scheme that can react efficiently only at a constant temperature is considered as the development trend of future molecular detection technology. Several new isothermal amplification methods for rapid detection of miRNA have been reported (see Sun Y, chem. commu., 2017,53(80): 11040-. Since miRNA belongs to RNA molecules, untreated miRNA is easily degraded by RNAase, and not only can long-term storage be realized, but also the quantitative accuracy of miRNA expression level in a sample can be influenced. Currently, Reverse transcription (Reverse transcription) pretreatment is considered to be the most effective technical means for preventing the degradation of miRNA and prolonging the storage period of miRNA samples. However, there is only one RT-LAMP study report developed for miRNA detection based on loop-mediated isothermal amplification (LAMP) (see Al-Maskri A AA, Analytica Chimica Acta,2020,1126: 1-6). The LAMP method needs a large number of primers or probes and has a long sequence, so that false positive results are easily generated, and the detection specificity cannot be ensured. Therefore, the development of a new reverse transcription-isothermal amplification method for quantitative detection of miRNA is of great significance.
Disclosure of Invention
The invention aims to solve the technical problems that the existing LAMP method needs more primers or probes for detecting miRNA, has long sequence, causes low detection efficiency, and the miRNA tailing reverse transcription pretreatment process cannot be adapted to isothermal amplification, namely the novel molecular amplification detection technology.
The invention solves the technical problems through the following technical means:
a reverse transcription-strand displacement amplification (RT-SDA) method for miRNA detection, comprising the steps of:
s1, carrying out poly (A) tailing reaction on the miRNA single strand to obtain a C1 strand;
s2, reverse transcription reaction: carrying out reverse transcription reaction on the C1 chain under the action of a reverse transcription primer P1 to generate a C2 chain which is reversely complementary with the C1 chain and is used as a cDNA template for detecting miRNA target molecules in SDA reaction;
s3 and an SDA reaction upstream primer P2 take a C2 chain as a template, and carry out chain hybridization and extension reaction in sequence to generate a C3 chain;
the nucleotide sequence of the upstream primer P2 is shown as the general formula (I):
P-F(I)
wherein, P is the 5' end sequence of the RT-SDA reaction upstream primer P2, and comprises the restriction enzyme cutting site recognition sequence of restriction endonuclease and the protection base thereof; f is a 3 'end sequence of an RT-SDA reaction upstream primer P2, the nucleotide sequence of the F is the same as the 8-14 base sequences at the 5' end of any miRNA target molecule, except that uracil residues are replaced by thymine residues;
after the S4 and the C3 strands and the C2 strand form complementary DNA double strands, carrying out enzyme digestion reaction under the catalysis of a nicking endonuclease, and cutting a nick on the C3 strand;
the sequences of S5 and the 5 'end of the C3 chain nick continue to extend, and the sequence of the 3' end of the C3 chain nick is replaced to generate a C4 chain; meanwhile, a new C3-C2 DNA double-chain structure is formed, and the steps S4 and S5 are continuously repeated to react, so that a large amount of C4 chains are generated;
s6, SDA reaction downstream primer P3 or SDA reaction downstream probe P4 take a C4 chain as a template, and carry out chain hybridization and extension reaction in sequence to generate a C5 chain;
the nucleotide sequence of the downstream primer P3 is shown as a general formula (II):
P-R(II)
wherein, P is the 5 'end sequence of the downstream primer P3 of the RT-SDA reaction, including the restriction site recognition sequence of the restriction endonuclease and the protective base thereof, R is the 3' end sequence of the downstream primer P3 of the RT-SDA reaction, and the nucleotide sequence of the 3 'end sequence is the same as the 8-14 base sequences of the 5' end of the reverse transcription primer P1;
the nucleotide sequence of the downstream probe P4 is shown as a general formula (III):
P-B1-B2-R(III)
wherein, P-B1-B2 is a 5' end sequence of a RT-SDA reaction downstream probe P4, and comprises a restriction enzyme cutting site recognition sequence of a restriction endonuclease and a protective base thereof; bases B1 and B2 are labeled fluorophore and quencher, respectively; r is a 3 'end sequence of a downstream probe P4 of RT-SDA reaction, and the nucleotide sequence of the R is the same as the 8-14 base sequences at the 5' end of a reverse transcription primer P1;
after the S7 and the C5 strands and the C4 strand form complementary DNA double strands, carrying out enzyme digestion reaction under the action of a nicking endonuclease, and cutting a nick on the C5 strand;
the sequences of S8 and the 5 'end of the C5 chain nick continue to extend, and the sequence of the 3' end of the C5 chain nick is replaced to generate a C6 chain; meanwhile, a new C5-C4 DNA double-chain structure is formed, and the steps S7 and S8 are continuously repeated to react, so that a large amount of C6 chains are generated;
the sequences of the S9 and the C6 chains are completely the same as the sequence of the C2 chain, the reactions of the steps S4-S5 can be continuously carried out to generate a large amount of C4 chains, and the reactions of the steps S7-S8 are continuously carried out to generate a large amount of C6 chains again; the amplification reaction can be continuously carried out in a circulating reciprocating way, so that the amplification product and the fluorescence signal are increased exponentially.
Preferably, the miRNA comprises one or more of a humoral miRNA, a fresh tissue or paraffin tissue miRNA, total RNA, an artificially synthesized miRNA molecule.
Preferably, the nicking endonuclease comprises any one of nb.
The upstream primer, the downstream primer or the downstream probe provided by the invention have no sequence complementary relation, so that the nonspecific amplification generated by mutual hybridization between the primers or between the primers and the probes can be effectively reduced, the sequences of the primers and the probes are short, the double-strand binding efficiency cannot be reduced due to the formation of a dimer structure under a constant temperature condition, and the amplification reaction efficiency cannot be influenced.
The invention also provides a reverse transcription-strand displacement amplification dye method kit for miRNA detection, which comprises the reverse transcription primer P1, the upstream primer P2 and the downstream primer P3.
Further, the dye method kit also comprises components for miRNA tailing reverse transcription reaction: poly (A) polymerase, reverse transcriptase, ATP, dNTPs and reaction buffer; the reaction buffer solution comprises Tris-HCl pH 8.3, NaCl, KCl and MgCl2、DTT；
The dye method kit also comprises components for carrying out strand displacement isothermal amplification reaction: DNA polymerase, nicking endonuclease, dNTPs, fluorescent dye and reaction buffer solution; the reaction buffer solution comprises Tris-HCl pH 7.9, NaCl and MgCl2、BSA。
Further, the concentration of each component used by the dye method kit in carrying out miRNA tail-adding reverse transcription in a reaction system is as follows: 10-100mM Tris-HCl pH 8.3, 10-100mM NaCl, 10-100mM KCl, 1-50mM MgCl21-100mM DTT, 1-50nM reverse transcription primer, 0.1-2.0mM ATP, 0.1-10U/. mu.L Poly (A) polymerase, 1-50U/. mu.L reverse transcriptase, 0.1-2.0mM dNTP;
the concentrations of the components used by the dye method kit in the strand displacement isothermal amplification in a reaction system are respectively as follows: 10-100mM Tris-HCl pH 7.9, 50-200mM NaCl, 5-50mM MgCl250-200 mug/mL BSA, 0.05-0.5U/. mu.L DNA polymerase, 0.05-0.5U/. mu.L nicking endonuclease, 0.025-0.5mM dNTPs, 0.025-0.5. mu.M upstream primer, 0.025-0.5. mu.M downstream primerPrimer, 1 × fluorescent dye.
Further, the concentration of each component used by the dye method kit in carrying out miRNA tail-adding reverse transcription in a reaction system is as follows: 20-80mM Tris-HCl pH 8.3, 20-80mM NaCl, 20-80mM KCl, 5-30mM MgCl25-50mM DTT, 2-20nM reverse transcription primer, 0.2-1.0mM ATP, 0.2-5.0U/. mu.L Poly (A) polymerase, 2-20U/. mu.L reverse transcriptase, 0.2-1.0mM dNTP;
the concentrations of the components used by the dye method kit in the strand displacement isothermal amplification in a reaction system are respectively as follows: 20-80mM Tris-HCl pH 7.9, 80-150mM NaCl, 10-30mM MgCl280-150 mu g/mL BSA, 0.1-0.3U/. mu.L DNA polymerase, 0.1-0.3U/. mu.L nicking endonuclease, 0.05-0.4mM dNTPs, 0.05-0.3. mu.M upstream primer, 0.05-0.3. mu.M downstream primer and 1 Xfluorescent dye.
Further, the reaction conditions of the dye method kit in miRNA tailing reverse transcription are as follows: preserving heat at 37-42 deg.C for 15-60min, and heating at 65-95 deg.C for 5-20 min;
the reaction conditions of the dye method kit in the strand displacement isothermal amplification are as follows: preserving heat at 37-65 deg.C for 15-60min, and heating at 70-95 deg.C for 5-20 min.
The invention also provides a reverse transcription-strand displacement amplification probe method kit for miRNA detection, which comprises the reverse transcription primer P1, an upstream primer P2 and a downstream probe P4.
Further, the probe method kit further comprises components for miRNA tailing reverse transcription reaction: poly (A) polymerase, reverse transcriptase, ATP, dNTPs and reaction buffer; the kit for the probe method also comprises components for miRNA tailing reverse transcription reaction: poly (A) polymerase, reverse transcriptase, ATP, dNTPs and reaction buffer;
the probe method kit also comprises components for carrying out a strand displacement isothermal amplification reaction: DNA polymerase, nicking endonuclease, dNTPs and reaction buffer solution; the reaction buffer solution comprises Tris-HCl pH 7.9, NaCl and MgCl2、BSA。
Furthermore, the probe method kit carries out miRNAThe concentrations of the components used in tailing reverse transcription in the reaction system are respectively as follows: 10-100mM Tris-HCl pH 8.3, 10-100mM NaCl, 10-100mM KCl, 1-50mM MgCl21-100mM DTT, 1-50nM reverse transcription primer, 0.1-2.0mM ATP, 0.1-10U/. mu.L Poly (A) polymerase, 1-50U/. mu.L reverse transcriptase, 0.1-2.0mM dNTP;
the concentration of each component used by the probe method kit in carrying out strand displacement isothermal amplification in a reaction system is as follows: 10-100mM Tris-HCl pH 7.9, 50-200mM NaCl, 5-50mM MgCl250-200 mug/mL BSA, 0.05-0.5U/. mu.L DNA polymerase, 0.05-0.5U/. mu.L nicking endonuclease, 0.025-0.5mM dNTPs, 0.025-0.5. mu.M upstream primer and 0.025-0.5. mu.M downstream probe.
Furthermore, the concentration of each component used by the probe method kit in the miRNA tail-adding reverse transcription in a reaction system is as follows: 10-100mM Tris-HCl pH 8.3, 10-100mM NaCl, 10-100mM KCl, 1-50mM MgCl21-100mM DTT, 1-50nM reverse transcription primer, 0.1-2.0mM ATP, 0.1-10U/. mu.L Poly (A) polymerase, 1-50U/. mu.L reverse transcriptase, 0.1-2.0mM dNTP;
the concentration of each component used by the probe method kit in carrying out strand displacement isothermal amplification in a reaction system is as follows: 20-80mM Tris-HCl pH 7.9, 80-150mM NaCl, 10-30mM MgCl280-150 mu g/mL BSA, 0.1-0.3U/. mu.L DNA polymerase, 0.1-0.3U/. mu.L nicking endonuclease, 0.05-0.4mM dNTPs, 0.05-0.3. mu.M upstream primer and 0.05-0.3. mu.M downstream probe.
Furthermore, the reaction conditions of the probe method kit in miRNA tail-adding reverse transcription are as follows: preserving heat at 37-42 deg.C for 15-60min, and heating at 65-95 deg.C for 5-20 min;
the reaction conditions of the probe method kit in the strand displacement isothermal amplification are as follows: preserving heat at 37-65 deg.C for 15-60min, and heating at 70-95 deg.C for 5-20 min.
The invention has the following beneficial effects:
1. the upstream primer, the downstream primer or the downstream probe provided by the invention have no sequence complementary relation, so that the nonspecific amplification generated by mutual hybridization between the primers or between the primers and the probes can be effectively reduced, the sequences of the primers and the probes are short, the double-strand binding efficiency cannot be reduced due to the formation of a dimer structure under a constant temperature condition, and the amplification reaction efficiency cannot be influenced.
2. According to the dye method or probe method reaction system for detecting miRNA by RT-SDA provided by the invention, when any miRNA target molecule is detected, quantitative detection of any miRNA target molecule can be realized only by designing and synthesizing different upstream primers according to different miRNA molecule sequences and without repeatedly designing and synthesizing different downstream primers or downstream probes, so that the detection efficiency is improved, and the detection cost is greatly reduced.
Drawings
FIG. 1 is a schematic diagram of the reaction principle of a reverse transcription-strand displacement amplification (RT-SDA) method for miRNA detection provided by the embodiment of the invention;
FIG. 2 is an amplification curve for detecting miRNA based on RT-SDA dye method provided by the embodiment of the invention;
FIG. 3 is an amplification curve for detecting miRNA based on RT-SDA probe method provided by the embodiment of the invention.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings and the embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Test materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
The specific techniques or conditions not specified in the examples can be performed according to the techniques or conditions described in the literature in the field or according to the product specification.
The reverse transcription-strand displacement amplification method for miRNA detection provided by the invention is suitable for any type of miRNA, including natural miRNA molecules of all eukaryotes such as human beings, animals, plants and the like, such as one or more of body fluid circulating miRNA, fresh tissue or paraffin tissue miRNA and total RNA, and can also include any artificially synthesized miRNA molecules. The method of the present invention is described in the following examples using artificially synthesized miR-320 molecular standards (AAAAGCUGGGUUGAGAGGGCGA, SEQ ID NO:5) as an example.
The sequences referred to in the examples below were all synthesized using known techniques.
Example 1
The dye method for detecting miRNA by RT-SDA comprises the following steps:
in this embodiment, an artificially synthesized miR-320 standard is used as a sample, a dye method detection scheme for detecting miRNA by RT-SDA is constructed according to the technical principle shown in fig. 1, and a 20 μ L reaction system is specifically prepared according to the following requirements:
reaction buffer 2.0. mu.L (final concentrations: 50mM Tris-HCl pH 7.9, 100mM NaCl, 10mM MgCl, respectively)2100. mu.g/mL BSA), 0.125. mu.M upstream primer P2(SEQ ID NO:2), 0.125. mu.M downstream primer P3(SEQ ID NO:3), 0.1U/. mu.L DNA polymerase, 0.2U/. mu.L Nt.BstNBI, 0.125mM dNTPs, 1 XGreen dye, and sequentially diluting cDNA synthesized by tailing reverse transcription of 10pM miR-320 molecular standard into three concentrations of mother solution (10 pM miR-320 molecular standard)-1、10-2And 10-3) Taking 1.0 mu L of mother liquor as templates of three reactions, adding water to 20 mu L, preserving heat at 55 ℃ for 40min, heating at 85 ℃ for 5min to terminate the reaction, wherein each cycle is separated by 1min, collecting a fluorescence signal after each cycle is finished, and collecting the fluorescence signals 40 times in total, wherein the RT-SDA amplification detection result is shown in figure 2.
According to the results shown in fig. 2, it can be seen that three test groups for detecting miRNA by using the RT-SDA dye method all show standard "S" type amplification curves, which fully indicates that the RT-SDA dye method provided by the present invention can achieve effective detection of miRNA; meanwhile, the linear correlation between the amplification curves corresponding to the synthesized cDNA template after three times of gradient dilution is higher, which shows that the RT-SDA dye method provided by the invention can efficiently realize the amplification detection of miRNA molecules.
According to the method for detecting miRNA by RT-SDA, on the premise of not changing the sequences of the upstream primer and the downstream primer, only the base of the downstream primer is modified by a fluorescent group and a quenching group, so that the obtained probe can be used for a probe method detection test, and further, the miRNA can be quantitatively detected by using a RT-SDA probe method detection scheme, which is verified by the following example 2.
Example 2
The detection method of the RT-SDA miRNA detection probe method comprises the following steps:
in this embodiment, an artificially synthesized miR-320 standard is used as a sample, a probe method detection scheme for detecting miRNA by RT-SDA is constructed according to the technical principle shown in fig. 1, and a 20 μ L reaction system is specifically prepared according to the following requirements:
reaction buffer 2.0. mu.L (final concentrations: 50mM Tris-HCl pH 7.9, 100mM NaCl, 10mM MgCl, respectively)2100. mu.g/mL BSA), 0.125. mu.M upstream primer P2(SEQ ID NO:2), 0.125. mu.M downstream probe P4(SEQ ID NO:4), 0.1U/. mu.L DNA polymerase, 0.2U/. mu.L Nt.BstNBI, 0.125mM dNTPs, and sequentially diluting cDNA synthesized by tailing reverse transcription of 10pM miR-320 molecular standard substance by reverse transcription primer P1(SEQ ID NO:1) into mother solution (10) with three concentrations-1、10-2And 10-3) Taking 1.0 mu L of mother liquor as templates of three reactions, adding water to 20 mu L, preserving the temperature at 55 ℃ for 40min, heating at 85 ℃ for 5min to terminate the reaction, wherein the interval of each cycle is 1min, collecting a fluorescence signal once after each cycle is finished, and collecting the fluorescence signals 40 times in total, wherein the RT-SDA amplification detection result is shown in figure 3.
According to the results shown in fig. 3, it can be seen that three test groups for detecting miRNA by the RT-SDA probe method all show a standard "S" type amplification curve, which fully indicates that the RT-SDA probe method provided by the present invention can achieve effective detection of miRNA; meanwhile, the linear correlation between the amplification curves corresponding to the synthesized cDNA template after three times of gradient dilution is higher, which shows that the RT-SDA probe method provided by the invention can efficiently realize the amplification detection of miRNA molecules.
Example 3
Based on the results of example 1, the present invention also provides a dye method kit that can be used for detecting miRNA in RT-SDA in example 1 above.
Provided withThe dye method kit for detecting miRNA by RT-SDA comprises a reverse transcription primer P1, an upstream primer P2 and a downstream primer P3 in example 1, and also comprises components for miRNA tailing reverse transcription reaction: poly (A) polymerase, reverse transcriptase, ATP, dNTPs and reaction buffer; the reaction buffer solution comprises Tris-HCl pH 8.3, NaCl, KCl and MgCl2DTT; the concentrations of all components used by the dye method kit in miRNA tailing reverse transcription in a reaction system are respectively as follows: 10-100mM Tris-HCl pH 8.3, 10-100mM NaCl, 10-100mM KCl, 1-50mM MgCl21-100mM DTT, 1-50nM reverse transcription primer, 0.1-2.0mM ATP, 0.1-10U/. mu.L Poly (A) polymerase, 1-50U/. mu.L reverse transcriptase, 0.1-2.0mM dNTP; preferably 20-80mM Tris-HCl pH 8.3, 20-80mM NaCl, 20-80mM KCl, 5-30mM MgCl25-50mM DTT, 2-20nM reverse transcription primer, 0.2-1.0mM ATP, 0.2-5.0U/. mu.L Poly (A) polymerase, 2-20U/. mu.L reverse transcriptase, 0.2-1.0mM dNTP; meanwhile, the kit also comprises components for carrying out the strand displacement isothermal amplification reaction: DNA polymerase, nicking endonuclease, dNTPs, fluorescent dye and reaction buffer solution; the reaction buffer solution comprises Tris-HCl pH 7.9, NaCl and MgCl2BSA; the concentrations of the components used by the dye method kit in the strand displacement isothermal amplification in the reaction system are respectively as follows: 10-100mM Tris-HCl pH 7.9, 50-200mM NaCl, 5-50mM MgCl250-200 mug/mL BSA, 0.05-0.5U/μ L DNA polymerase, 0.05-0.5U/μ L nicking endonuclease, 0.025-0.5mM dNTPs, 0.025-0.5 μ M upstream primer, 0.025-0.5 μ M downstream primer, 1 Xfluorescent dye; preferably 20-80mM Tris-HCl pH 7.9, 80-150mM NaCl, 10-30mM MgCl280-150 mu g/mL BSA, 0.1-0.3U/mu L DNA polymerase, 0.1-0.3U/mu L nicking endonuclease, 0.05-0.4mM dNTPs, 0.05-0.3 mu M upstream primer, 0.05-0.3 mu M downstream primer and 1 Xfluorescent dye;
the reaction conditions of the dye method kit of the embodiment when miRNA tail-adding reverse transcription is carried out are as follows: preserving heat at 37-42 deg.C for 15-60min, and heating at 65-95 deg.C for 5-20 min; then, the reaction conditions when strand displacement isothermal amplification is performed are as follows: preserving heat at 37-65 deg.C for 15-60min, and heating at 70-95 deg.C for 5-20 min.
Example 4
Based on the results of example 2, the present invention also provides a probe method kit that can be used for detecting miRNA in RT-SDA in example 2 above.
The provided kit for detecting miRNA by RT-SDA comprises a reverse transcription primer P1, an upstream primer P2 and a downstream probe P4 in example 2, and also comprises components for miRNA tailing reverse transcription reaction: poly (A) polymerase, reverse transcriptase, ATP, dNTPs and reaction buffer; the reaction buffer solution comprises Tris-HCl pH 8.3, NaCl, KCl and MgCl2And DTT. The concentration of each component used by the probe method kit in miRNA tailing reverse transcription in a reaction system is respectively as follows: 10-100mM Tris-HCl pH 8.3, 10-100mM NaCl, 10-100mM KCl, 1-50mM MgCl21-100mM DTT, 1-50nM reverse transcription primer, 0.1-2.0mM ATP, 0.1-10U/. mu.L Poly (A) polymerase, 1-50U/. mu.L reverse transcriptase, 0.1-2.0mM dNTP; preferably 20-80mM Tris-HCl pH 8.3, 20-80mM NaCl, 20-80mM KCl, 5-30mM MgCl25-50mM DTT, 2-20nM reverse transcription primer, 0.2-1.0mM ATP, 0.2-5.0U/. mu.L Poly (A) polymerase, 2-20U/. mu.L reverse transcriptase, 0.2-1.0mM dNTP; meanwhile, the kit also comprises components for carrying out the strand displacement isothermal amplification reaction: DNA polymerase, nicking endonuclease, dNTPs and reaction buffer solution; the reaction buffer solution comprises Tris-HCl pH 7.9, NaCl and MgCl2BSA; the concentration of each component used by the probe method kit in carrying out strand displacement isothermal amplification in a reaction system is as follows: 10-100mM Tris-HCl pH 7.9, 50-200mM NaCl, 5-50mM MgCl250-200. mu.g/mL BSA, 0.05-0.5U/. mu.L DNA polymerase, 0.05-0.5U/. mu.L nicking endonuclease, 0.025-0.5mM dNTPs, 0.025-0.5. mu.M upstream primer, 0.025-0.5. mu.M downstream probe, preferably 20-80mM Tris-HCl pH 7.9, 80-150mM NaCl, 10-30mM MgCl280-150 mu g/mL BSA, 0.1-0.3U/mu L DNA polymerase, 0.1-0.3U/mu L nicking endonuclease, 0.05-0.4mM dNTPs, 0.05-0.3 mu M upstream primer and 0.05-0.3 mu M downstream probe;
the reaction conditions of the probe method kit of the embodiment when miRNA tailing reverse transcription is performed are as follows: preserving heat at 37-42 deg.C for 15-60min, and heating at 65-95 deg.C for 5-20 min; then, the reaction conditions when strand displacement isothermal amplification is performed are as follows: preserving heat at 37-65 deg.C for 15-60min, and heating at 70-95 deg.C for 5-20 min.
The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some technical features may be equivalently replaced; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions of the embodiments of the present invention.
Claims (13)
1. A reverse transcription-strand displacement amplification method for miRNA detection is characterized by comprising the following steps:
s1, carrying out poly (A) tailing reaction on the miRNA single strand to obtain a C1 strand;
s2, reverse transcription reaction: carrying out reverse transcription reaction on the C1 chain under the action of a reverse transcription primer P1 to generate a C2 chain which is reversely complementary with the C1 chain and is used as a cDNA template for detecting miRNA target molecules in SDA reaction;
s3 and an SDA reaction upstream primer P2 take a C2 chain as a template, and carry out chain hybridization and extension reaction in sequence to generate a C3 chain;
the nucleotide sequence of the upstream primer P2 is shown as the general formula (I):
P-F (I)
wherein, P is the 5' end sequence of the RT-SDA reaction upstream primer P2, and comprises the restriction enzyme cutting site recognition sequence of restriction endonuclease and the protection base thereof; f is a 3 'end sequence of an RT-SDA reaction upstream primer P2, the nucleotide sequence of the F is the same as the 8-14 base sequences at the 5' end of any miRNA target molecule, except that uracil residues are replaced by thymine residues;
after the S4 and the C3 strands and the C2 strand form complementary DNA double strands, carrying out enzyme digestion reaction under the catalysis of a nicking endonuclease, and cutting a nick on the C3 strand;
the sequences of S5 and the 5 'end of the C3 chain nick continue to extend, and the sequence of the 3' end of the C3 chain nick is replaced to generate a C4 chain; meanwhile, a new C3-C2 DNA double-chain structure is formed, and the steps S4 and S5 are continuously repeated to react, so that a large amount of C4 chains are generated;
s6, SDA reaction downstream primer P3 or SDA reaction downstream probe P4 take a C4 chain as a template, and carry out chain hybridization and extension reaction in sequence to generate a C5 chain;
the nucleotide sequence of the downstream primer P3 is shown as a general formula (II):
P-R (II)
wherein, P is the 5 'end sequence of the downstream primer P3 of the RT-SDA reaction, including the restriction site recognition sequence of the restriction endonuclease and the protective base thereof, R is the 3' end sequence of the downstream primer P3 of the RT-SDA reaction, and the nucleotide sequence of the 3 'end sequence is the same as the 8-14 base sequences of the 5' end of the reverse transcription primer P1;
the nucleotide sequence of the downstream probe P4 is shown as a general formula (III):
P-B1-B2-R (III)
wherein, P-B1-B2 is a 5' end sequence of a RT-SDA reaction downstream probe P4, and comprises a restriction enzyme cutting site recognition sequence of a restriction endonuclease and a protective base thereof; bases B1 and B2 are labeled fluorophore and quencher, respectively; r is a 3 'end sequence of a downstream probe P4 of RT-SDA reaction, and the nucleotide sequence of the R is the same as the 8-14 base sequences at the 5' end of a reverse transcription primer P1;
after the S7 and the C5 strands and the C4 strand form complementary DNA double strands, carrying out enzyme digestion reaction under the action of a nicking endonuclease, and cutting a nick on the C5 strand;
the sequences of S8 and the 5 'end of the C5 chain nick continue to extend, and the sequence of the 3' end of the C5 chain nick is replaced to generate a C6 chain; meanwhile, a new C5-C4 DNA double-chain structure is formed, and the steps S7 and S8 are continuously repeated to react, so that a large amount of C6 chains are generated;
the sequences of the S9 and the C6 chains are completely the same as the sequence of the C2 chain, the reactions of the steps S4-S5 can be continuously carried out to generate a large amount of C4 chains, and the reactions of the steps S7-S8 are continuously carried out to generate a large amount of C6 chains again; the amplification reaction can be continuously carried out in a circulating reciprocating way, so that the amplification product and the fluorescence signal are increased exponentially.
2. The reverse transcription-strand displacement amplification method for miRNA detection according to claim 1, wherein: the miRNA comprises one or more of a body fluid circulation miRNA, a fresh tissue or paraffin tissue miRNA, total RNA and an artificial synthesized miRNA molecule.
3. The reverse transcription-strand displacement amplification method for miRNA detection according to claim 1, wherein: the nicking endonuclease comprises any one of Nb.BbvCI, Nb.BsmI, Nb.BsrDI, Nb.BtsI, Nt.AlwI, Nt.BbvCI, Nt.BsmAI, Nt.BspQI, Nt.BstNBI, Nb.BssSI and Nt.CvipII.
4. A reverse transcription-strand displacement amplification dye method kit for miRNA detection is characterized in that: the dye method kit comprises the reverse transcription primer P1, the forward primer P2 and the reverse primer P3 as described in any one of claims 1 to 3.
5. The reverse transcription-strand displacement amplification dye method kit for miRNA detection according to claim 4, wherein: the dye method kit also comprises components for miRNA tailing reverse transcription reaction: poly (A) polymerase, reverse transcriptase, ATP, dNTPs and reaction buffer; the reaction buffer solution comprises Tris-HCl pH 8.3, NaCl, KCl and MgCl2、DTT；
The dye method kit also comprises components for carrying out strand displacement isothermal amplification reaction: DNA polymerase, nicking endonuclease, dNTPs, fluorescent dye and reaction buffer solution; the reaction buffer solution comprises Tris-HCl pH 7.9, NaCl and MgCl2、BSA。
6. The reverse transcription-strand displacement amplification dye method kit for miRNA detection according to claim 4, wherein: each of the dye method kit is used for miRNA tailing reverse transcriptionThe concentrations of the components in the reaction system are respectively as follows: 10-100mM Tris-HCl pH 8.3, 10-100mM NaCl, 10-100mM KCl, 1-50mM MgCl21-100mM DTT, 1-50nM reverse transcription primer, 0.1-2.0mM ATP, 0.1-10U/. mu.L Poly (A) polymerase, 1-50U/. mu.L reverse transcriptase, 0.1-2.0mM dNTP;
the concentrations of the components used by the dye method kit in the strand displacement isothermal amplification in a reaction system are respectively as follows: 10-100mM Tris-HCl pH 7.9, 50-200mM NaCl, 5-50mM MgCl250-200 mug/mL BSA, 0.05-0.5U/. mu.L DNA polymerase, 0.05-0.5U/. mu.L nicking endonuclease, 0.025-0.5mM dNTPs, 0.025-0.5. mu.M upstream primer, 0.025-0.5. mu.M downstream primer and 1 Xfluorescent dye.
7. The reverse transcription-strand displacement amplification dye method kit for miRNA detection according to claim 4, wherein: the concentration of each component used by the dye method kit in miRNA tailing reverse transcription in a reaction system is respectively as follows: 20-80mM Tris-HCl pH 8.3, 20-80mM NaCl, 20-80mM KCl, 5-30mM MgCl25-50mM DTT, 2-20nM reverse transcription primer, 0.2-1.0mM ATP, 0.2-5.0U/. mu.L Poly (A) polymerase, 2-20U/. mu.L reverse transcriptase, 0.2-1.0mM dNTP;
the concentrations of the components used by the dye method kit in the strand displacement isothermal amplification in a reaction system are respectively as follows: 20-80mM Tris-HCl pH 7.9, 80-150mM NaCl, 10-30mM MgCl280-150 mu g/mL BSA, 0.1-0.3U/. mu.L DNA polymerase, 0.1-0.3U/. mu.L nicking endonuclease, 0.05-0.4mM dNTPs, 0.05-0.3. mu.M upstream primer, 0.05-0.3. mu.M downstream primer and 1 Xfluorescent dye.
8. The reverse transcription-strand displacement amplification dye method kit for miRNA detection according to claim 4, wherein: the reaction conditions of the dye method kit in miRNA tailing reverse transcription are as follows: preserving heat at 37-42 deg.C for 15-60min, and heating at 65-95 deg.C for 5-20 min;
the reaction conditions of the dye method kit in the strand displacement isothermal amplification are as follows: preserving heat at 37-65 deg.C for 15-60min, and heating at 70-95 deg.C for 5-20 min.
9. A reverse transcription-strand displacement amplification probe method kit for miRNA detection is characterized in that: the probe method kit comprises the reverse transcription primer P1, the upstream primer P2 and the downstream probe P4 as described in any one of claims 1 to 3.
10. The reverse transcription-strand displacement amplification probe method kit for miRNA detection according to claim 9, characterized in that: the kit for the probe method also comprises components for miRNA tailing reverse transcription reaction: poly (A) polymerase, reverse transcriptase, ATP, dNTPs and reaction buffer; the kit for the probe method also comprises components for miRNA tailing reverse transcription reaction: poly (A) polymerase, reverse transcriptase, ATP, dNTPs and reaction buffer;
the probe method kit also comprises components for carrying out a strand displacement isothermal amplification reaction: DNA polymerase, nicking endonuclease, dNTPs and reaction buffer solution; the reaction buffer solution comprises Tris-HCl pH 7.9, NaCl and MgCl2、BSA。
11. The reverse transcription-strand displacement amplification probe method kit for miRNA detection according to claim 9, characterized in that: the concentration of each component used by the probe method kit in the miRNA tailing reverse transcription in a reaction system is respectively as follows: 10-100mM Tris-HCl pH 8.3, 10-100mM NaCl, 10-100mM KCl, 1-50mM MgCl21-100mM DTT, 1-50nM reverse transcription primer, 0.1-2.0mM ATP, 0.1-10U/. mu.L Poly (A) polymerase, 1-50U/. mu.L reverse transcriptase, 0.1-2.0mM dNTP;
the concentration of each component used by the probe method kit in carrying out strand displacement isothermal amplification in a reaction system is as follows: 10-100mM Tris-HCl pH 7.9, 50-200mM NaCl, 5-50mM MgCl250-200 mug/mL BSA, 0.05-0.5U/. mu.L DNA polymerase, 0.05-0.5U/. mu.L nicking endonuclease, 0.025-0.5mM dNTPs, 0.025-0.5. mu.M upstream primer and 0.025-0.5. mu.M downstream probe.
12. The method of claim 9The kit for the reverse transcription-strand displacement amplification probe method for miRNA detection is characterized in that: the concentration of each component used by the probe method kit in the miRNA tailing reverse transcription in a reaction system is respectively as follows: 10-100mM Tris-HCl pH 8.3, 10-100mM NaCl, 10-100mM KCl, 1-50mM MgCl21-100mM DTT, 1-50nM reverse transcription primer, 0.1-2.0mM ATP, 0.1-10U/. mu.L Poly (A) polymerase, 1-50U/. mu.L reverse transcriptase, 0.1-2.0mM dNTP;
the concentration of each component used by the probe method kit in carrying out strand displacement isothermal amplification in a reaction system is as follows: 20-80mM Tris-HCl pH 7.9, 80-150mM NaCl, 10-30mM MgCl280-150 mu g/mL BSA, 0.1-0.3U/. mu.L DNA polymerase, 0.1-0.3U/. mu.L nicking endonuclease, 0.05-0.4mM dNTPs, 0.05-0.3. mu.M upstream primer and 0.05-0.3. mu.M downstream probe.
13. The reverse transcription-strand displacement amplification probe method kit for miRNA detection according to claim 9, characterized in that: the reaction conditions of the probe method kit in miRNA tailing reverse transcription are as follows: preserving heat at 37-42 deg.C for 15-60min, and heating at 65-95 deg.C for 5-20 min;
the reaction conditions of the probe method kit in the strand displacement isothermal amplification are as follows: preserving heat at 37-65 deg.C for 15-60min, and heating at 70-95 deg.C for 5-20 min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111315193.6A CN113981047B (en) | 2021-11-08 | 2021-11-08 | Reverse transcription-strand displacement amplification method for miRNA detection and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111315193.6A CN113981047B (en) | 2021-11-08 | 2021-11-08 | Reverse transcription-strand displacement amplification method for miRNA detection and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113981047A true CN113981047A (en) | 2022-01-28 |
| CN113981047B CN113981047B (en) | 2023-11-07 |
Family
ID=79747165
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111315193.6A Active CN113981047B (en) | 2021-11-08 | 2021-11-08 | Reverse transcription-strand displacement amplification method for miRNA detection and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113981047B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116574780A (en) * | 2023-02-24 | 2023-08-11 | 苏州唯善生物科技有限公司 | Design method of primer probe for simultaneously detecting two miRNAs through single fluorescent channel, kit and quantitative detection method |
Citations (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120045768A1 (en) * | 2009-04-16 | 2012-02-23 | Padma Arunachalam | Methods and compositions to detect and differentiate small rnas in rna maturation pathway |
| CN103088128A (en) * | 2013-01-09 | 2013-05-08 | 华中科技大学 | Testing method and kit for secondary circulation amplification of microRNA (Ribose Nucleic Acid) |
| CN103834719A (en) * | 2012-11-28 | 2014-06-04 | 深圳先进技术研究院 | miRNA detection probe and miRNA amplification detection method |
| CN104726549A (en) * | 2014-10-10 | 2015-06-24 | 青岛科技大学 | Novel method for isothermal amplification detection of double-stranded nucleic acid based on nicking enzyme |
| CN105018603A (en) * | 2015-07-01 | 2015-11-04 | 中山大学 | Constant temperature index amplification technology based on triple amplification reaction connection in series and application of constant temperature index amplification technology in microRNA detection |
| CN105177132A (en) * | 2015-09-02 | 2015-12-23 | 苟德明 | RT-PCR method for quantitatively detecting miRNA |
| US20200002756A1 (en) * | 2017-01-25 | 2020-01-02 | Sense Biodetection Limited | Nucleic acid detection method |
| CN110804656A (en) * | 2015-06-02 | 2020-02-18 | 奎克生技光电股份有限公司 | Nucleotide sequence, universal reverse primer, universal reverse transcription primer and miRNA detection method |
| CN110878335A (en) * | 2019-09-26 | 2020-03-13 | 天津大学 | Method for detecting brain glioma marker based on combination of TdT enzyme and NtbspQI nicking enzyme |
| CN112342277A (en) * | 2020-11-11 | 2021-02-09 | 重庆医科大学 | MicroRNA biosensor based on isothermal index amplification |
| CN113481283A (en) * | 2021-06-30 | 2021-10-08 | 上海伯杰医疗科技有限公司北京分公司 | Method for isothermal amplification of nucleic acid target sequences |
| CN113604466A (en) * | 2021-07-29 | 2021-11-05 | 中国科学院合肥物质科学研究院 | Universal reverse transcription primer, cDNA (complementary deoxyribonucleic acid) synthesis method of miRNA (micro ribonucleic acid), synthesis kit and miRNA detection method |
-
2021
- 2021-11-08 CN CN202111315193.6A patent/CN113981047B/en active Active
Patent Citations (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120045768A1 (en) * | 2009-04-16 | 2012-02-23 | Padma Arunachalam | Methods and compositions to detect and differentiate small rnas in rna maturation pathway |
| CN103834719A (en) * | 2012-11-28 | 2014-06-04 | 深圳先进技术研究院 | miRNA detection probe and miRNA amplification detection method |
| CN103088128A (en) * | 2013-01-09 | 2013-05-08 | 华中科技大学 | Testing method and kit for secondary circulation amplification of microRNA (Ribose Nucleic Acid) |
| CN104726549A (en) * | 2014-10-10 | 2015-06-24 | 青岛科技大学 | Novel method for isothermal amplification detection of double-stranded nucleic acid based on nicking enzyme |
| CN110804656A (en) * | 2015-06-02 | 2020-02-18 | 奎克生技光电股份有限公司 | Nucleotide sequence, universal reverse primer, universal reverse transcription primer and miRNA detection method |
| CN105018603A (en) * | 2015-07-01 | 2015-11-04 | 中山大学 | Constant temperature index amplification technology based on triple amplification reaction connection in series and application of constant temperature index amplification technology in microRNA detection |
| CN105177132A (en) * | 2015-09-02 | 2015-12-23 | 苟德明 | RT-PCR method for quantitatively detecting miRNA |
| US20200002756A1 (en) * | 2017-01-25 | 2020-01-02 | Sense Biodetection Limited | Nucleic acid detection method |
| CN110878335A (en) * | 2019-09-26 | 2020-03-13 | 天津大学 | Method for detecting brain glioma marker based on combination of TdT enzyme and NtbspQI nicking enzyme |
| CN112342277A (en) * | 2020-11-11 | 2021-02-09 | 重庆医科大学 | MicroRNA biosensor based on isothermal index amplification |
| CN113481283A (en) * | 2021-06-30 | 2021-10-08 | 上海伯杰医疗科技有限公司北京分公司 | Method for isothermal amplification of nucleic acid target sequences |
| CN113604466A (en) * | 2021-07-29 | 2021-11-05 | 中国科学院合肥物质科学研究院 | Universal reverse transcription primer, cDNA (complementary deoxyribonucleic acid) synthesis method of miRNA (micro ribonucleic acid), synthesis kit and miRNA detection method |
Non-Patent Citations (3)
| Title |
|---|
| SHI C等: "Exponential Strand-Displacement Amplification for Detection of MicroRNAs", pages 336 - 339 * |
| SHU QU等: "Rapid and ultrasensitive detection of microRNA based on strand displacement amplification-mediated entropy-driven circuit reaction", pages 3057 * |
| ZHAO J等: "A self-quenching fluorescence probe-mediated exponential isothermal amplification system for highly sensitive and specific detection of microRNAs", vol. 57, no. 94, pages 12599 - 12602 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116574780A (en) * | 2023-02-24 | 2023-08-11 | 苏州唯善生物科技有限公司 | Design method of primer probe for simultaneously detecting two miRNAs through single fluorescent channel, kit and quantitative detection method |
| CN116574780B (en) * | 2023-02-24 | 2023-11-10 | 苏州唯善生物科技有限公司 | Design method of primer probe for simultaneously detecting two miRNAs through single fluorescent channel, kit and quantitative detection method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113981047B (en) | 2023-11-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8278035B2 (en) | Method and substances for isolating miRNAs | |
| CN103789435B (en) | A kind of miRNA fluorescence detection reagent kit based on cascade constant-temperature amplification and method | |
| EP3880843A1 (en) | Method for detection of rna | |
| CA2750029C (en) | Method for quantification of small rna species | |
| WO2010120853A2 (en) | Methods and compositions to detect and differentiate small rnas in rna maturation pathway | |
| CN107937482B (en) | Kit for detecting polynucleotide kinase and detection method thereof | |
| US20090023151A1 (en) | Method For The Labeling And Detection Of Small Polynucleotides | |
| CN101835905B (en) | Method and kit for detection/quantification of target RNA | |
| CN113981047B (en) | Reverse transcription-strand displacement amplification method for miRNA detection and application thereof | |
| CN111742057A (en) | Improvements in or relating to nucleic acid amplification | |
| JP5207355B2 (en) | Method for detecting nucleic acid having target nucleotide sequence, probe set, and method for identifying nucleic acid | |
| CN112852927A (en) | Isothermal amplification system and method based on fluorescence self-inhibition probe | |
| CN102424833A (en) | Chip and method for real-time PCR (polymerase chain reaction) gene detection at polygenic mutation site | |
| CN113462753B (en) | Click chemistry mediated single quantum dot nano sensor, method for detecting miRNAs and application | |
| CN113604466A (en) | Universal reverse transcription primer, cDNA (complementary deoxyribonucleic acid) synthesis method of miRNA (micro ribonucleic acid), synthesis kit and miRNA detection method | |
| CN111549104B (en) | Non-diagnosis-purpose circRNA detection method based on long-chain DNA scaffold DNA nanobelt | |
| Fesenko et al. | Substrate properties of new fluorescently labeled deoxycytidine triphosphates in enzymatic synthesis of DNA with polymerases of families a and B | |
| KR102343373B1 (en) | Method for multiplex detection of miRNA and miRNA detection kit using the same | |
| KR20210105631A (en) | Biomarker composition for cancer discrimination using LINE-1 chimeric transcriptome | |
| US20230407390A1 (en) | Nucleic acid amplification method, primer set, probe, and kit for nucleic acid amplification method | |
| CN112080552B (en) | Method for detecting target miRNA based on G quadruplex molecular beacon double-enzyme cascade isothermal amplification | |
| CA2505992A1 (en) | Absolute quantitation of nucleic acids by rt-pcr | |
| CN110551794B (en) | Method and kit for processing RNA molecules and complex | |
| CN106676109A (en) | ENST00000418539.1, preparation or diagnostic agent or medicine or kit, and application of ENST00000418539.1 | |
| EP3971302A1 (en) | Method for detecting 5-hydroxymethylated cytosine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20231215 Address after: 230031 Shushan Lake Road, Shushan District, Hefei, Anhui 350 Patentee after: HEFEI INSTITUTES OF PHYSICAL SCIENCE, CHINESE ACADEMY OF SCIENCES Patentee after: Anhui Zhongke Yikangda Biotechnology Co.,Ltd. Address before: 230031 Shushan Lake Road, Shushan District, Hefei, Anhui 350 Patentee before: HEFEI INSTITUTES OF PHYSICAL SCIENCE, CHINESE ACADEMY OF SCIENCES Patentee before: HEFEI ZHONGKE YIKANGDA BIOMEDICAL Co.,Ltd. |
|
| TR01 | Transfer of patent right |