CN113980050B

CN113980050B - Modified nucleotide, composition and reagent

Info

Publication number: CN113980050B
Application number: CN202111262954.6A
Authority: CN
Inventors: 叶彬彬; 刘丰; 徐娅
Original assignee: Zhongyuan Huiji Biotechnology Co Ltd
Current assignee: Zhongyuan Huiji Biotechnology Co Ltd
Priority date: 2021-10-25
Filing date: 2021-10-25
Publication date: 2023-07-28
Anticipated expiration: 2041-10-25
Also published as: CN113980050A

Abstract

The invention relates to the field of biological detection, in particular to a modified nucleotide, a composition and a reagent, wherein the modified nucleotide disclosed by the invention has only one position substitution, and is convenient to synthesize; the modified acyCTP is applied to detection of mass spectrum SNP, so that the molecular weight of a product is distinguished while the extension efficiency of single-base elongase is ensured, the mass spectrum resolution is improved, and the accuracy of result interpretation is ensured.

Description

Modified nucleotide, composition and reagent

Technical Field

The invention relates to the field of biological detection, in particular to a modified nucleotide, a composition and a reagent.

Background

Single Nucleotide Polymorphism (SNP) refers to a DNA sequence polymorphism caused by variation of a single nucleotide at a genome level, and occurs more frequently than 1% in a population, which is one of the most common genetic variations in humans, so that detection of SNP has an important guiding role in diagnosis, screening, and medication of genetic diseases.

At present, the SNP detection methodology mainly comprises a real-time fluorescence PCR method, a PCR gene chip method, a PCR electrophoresis method, a PCR capillary electrophoresis method analysis method, a PCR high resolution dissolution curve method, a flow fluorescence hybridization method, a time-of-flight mass spectrometry method, a pyrosequencing method, a Sanger sequencing method and the like. The advantages of the real-time fluorescence PCR method, the PCR electrophoresis method, the PCR capillary electrophoresis method analysis method, the PCR high-resolution dissolution curve method and the flow fluorescence hybridization method are that the time consumption is short, the sensitivity is high, and the detection under certain scenes can be realized, but the detection requirements of tens of gene loci and even hundreds of gene loci in clinic cannot be met conveniently and rapidly due to the limited flux. Gene chip method, pyrosequencing method and Sanger sequencing method, although the detection is more accurate, the detection cost is higher, the time consumption is longer, and the method is not the primary choice of SNP detection. The time-of-flight mass spectrometry has the advantages of high detection speed, simple data analysis and higher flux, overcomes the defects of the traditional methodology, reduces the cost, is a better choice than the previous methods, but has the problem of inaccurate detection results, and limits the further development of the application of the method.

The nucleic acid mass spectrum SNP detection is mainly based on PCR and primer extension technology, and the principle is that target fragments of SNP loci to be detected are amplified through PCR primers, and the generated PCR products are treated by shrimp alkaline phosphatase (shrimp alkaline phosphatase, SAP) to neutralize residual dNTPs. After the SAP digestion reaction, adding buffer solution, extension primer dideoxynucleotide (ddNTPs), single base extension enzyme and other components into the reaction solution to carry out primer extension reaction. The DNA amplification product is used as a template, and an extension primer can be combined with the 5' end of the SNP locus to be detected and extended by one base. After the primer extension is completed, a positive value is added to the reaction solution for desalting treatment, and metal ions adsorbed on the nucleic acid fragment are removed. After desalting, the sample and the matrix are transferred to a target plate to form co-crystals, and a spectrogram is obtained through mass spectrum detection. The typing of the SNP site of this sample can be analyzed by calculating the difference between the molecular weight of the product in the spectrogram and the molecular weight of the extension primer.

However, when ddNTP is used as a substrate, the single-base elongase has low binding efficiency and poor elongation effect, and the accuracy of judging the result of a spectrogram is affected. Another nucleotide substrate that can be used for single base extension is linear nucleotides (acyclonucleotides, acyNTPs), replacing 2' -deoxyribofuranosyl sugar, which is common in dNTPs, with 2-hydroxyethoxymethyl group (shown below). DNA polymerase recognizes 30 times as much as ordinary ddNTP for acyNTP (ref: gardner, A., and Jack, W. (2002). Acyclic and dideoxy terminator preferences denote divergent sugar recognition by archaeon and Taq DNA polymers.nucleic Acids Res.30,605-613.Doi: 10.1093/nar/30.2.605).

Disclosure of Invention

The invention discloses a modified nucleotide for solving the problem of inaccurate detection result caused by poor extension effect in nucleic acid mass spectrum SNP detection, and utilizing the principle that the molecular weight difference can analyze SNP locus typing, wherein the structure of the modified nucleotide is as follows:

wherein R is selected from alkyl; cycloalkyl; -OR ₁ ；-SR ₁ ；-SO ₃ H；-NR ₁ R ₂ And halogen; optionally substituted aryl or heterocyclyl; n is an integer of 1-12;

a is selected from CH ₂ Or O;

the molecular weight of the nucleotide is 474-924Da.

Preferably, the nucleotides have a molecular weight of 481-924Da.

In the prior art, the aceNTP is mainly applied to sequencing as a substrate, and is less applied to SNP detection of nucleic acid mass spectrum. When the acentp is used as a substrate, the molecular weights of acyCTP, acyATP, acyGTP and acettp are 425.12Da, 449.12Da, 465.14Da and 440.10Da respectively.

It can be seen that the molecular weights of the acyATP and the acyTTP are closely spaced, the difference of the molecular weights between the nucleotides determines that the nucleic acid mass spectrum SNP detection items need to distinguish peak signals of 9Da differences, however, it is difficult for a mass spectrometer to effectively distinguish characteristic peaks of 9Da differences, especially in a large molecular weight detection interval such as 7000Da-12000 Da, so that part of SNP types cannot be accurately distinguished, and only a mass spectrometer with particularly good resolution can realize 9Da resolution, but a common mass spectrometer usually needs peak signals with molecular weights more than 9Da apart to separate, and the closely spaced characteristic peaks can generate partial overlapping, so that the resolution of the mass spectrometer is difficult. When the molecular weights differ by 16Da, the peak signals are separated far enough to be easily and accurately distinguished, even on a conventional mass spectrometer.

Therefore, the invention uses the acyUTP to replace the conventional acyTTP, the molecular weight difference between the acyATP and the acyTTP is pulled open, the performance of the acyUTP is close to that of the acyTTP, and the acyUTP can be complementary paired with the A.

acyCTP, acyATP, acyGTP and acyUTP have molecular weights of 425.12Da, 449.12Da, 465.14Da, 426.10Da, respectively.

The characteristic peaks of the acyCTP and the acyUTP almost overlap and cannot be distinguished, and the molecular weight of one of the peaks can be selectively changed in actual operation, so that the purpose of distinguishing the characteristic peaks is achieved.

The invention selects the nucleotide with the molecular weight more than 474Da, preferably more than 481Da by modifying the acyCTP so as to change the molecular weight, ensures the efficient identification of the single-base elongase on the nucleotide substrate, ensures that the molecular weight among the nucleotides can be distinguished, and improves the resolution of a spectrogram and the interpretation accuracy of a result.

Preferably, said R is selected from C ₁ -C ₁₀ Alkyl, further preferably C ₄ -C ₁₀ An alkyl group;

preferably, the alkyl group may be substituted, and the preferred substituent is-NH ₂ 。

Preferably, said R ₁ ，R ₂ Independently selected from H or C ₁ -C ₂₀ Alkyl, preferably C ₁ -C ₁₀ Alkyl, further preferably C ₃ -C ₁₀ An alkyl group; preferably, the halogen is selected from: F. cl, br or I, more preferably Cl, br or I;

preferably, the heterocyclic group is selected from saturated heterocyclic groups, preferably 5 to 8 membered saturated heterocyclic groups; for example: tetrahydrofuranyl, morpholinyl, piperidinyl, piperazinyl; or the heterocyclic ring is selected from heteroaryl, preferably 5 to 10 membered heteroaryl, such as furyl, pyrrolyl, thienyl, pyrazolyl, imidazolyl, oxazolyl, thiazolyl, pyridyl, pyranyl, pyridazinyl, pyrimidinyl, pyrazinyl. The heterocyclic groups are independently optionally substituted with one or more C ₁ -C ₁₀ An alkyl group; halogen, -OR ₁ or-NR ₁ R ₂ And (3) substitution.

Preferably, illustrative, non-limiting specific examples of compounds of formula I of the present invention are shown below:

in another aspect, the invention discloses a substrate mixture comprising formula 1.

Preferably, the substrate mixture further comprises acyATP, acyGTP and acy UTP, and the structural formula is as follows:

in another aspect, the invention discloses a reagent for primer extension comprising the above substrate mixture.

In another aspect, the invention discloses a kit for nucleic acid mass spectrometry detection comprising the above reagents for primer extension.

The beneficial effects are that:

1. the modified nucleotide disclosed by the invention has only one position substitution, and is convenient to synthesize.

2. The invention creatively applies the modified acyCTP to the detection of mass spectrum SNP, ensures the extension efficiency of single-base extension enzyme, simultaneously distinguishes the molecular weight of the product, improves the resolution of mass spectrum and ensures the accuracy of result interpretation.

Description of the drawings:

fig. 1: an acy sulfo-CTP as a substrate to detect the mutation site 281C > T;

fig. 2: acy sulfo-CTP is used as a substrate clinical detection mass spectrum;

fig. 3: results of detection of mutation site IVS-I-5 (G > C) using acy butyl ether-CTP as substrate;

fig. 4:6 nucleotide detection effect diagram.

The specific embodiment is as follows:

modified Synthesis of preparation examples nucleotide

All added substances are used in excess relative to the compounds I, II, III, the synthesis of the different substances differing in the amount of product obtained.

A: when a is O, n=1

(1) Synthesis of Compound II

30mmol of compound 1 was weighed and added to a clean 250mL three-necked flask; nitrogen substitution three times after 150mL of dichloromethane was added; nitrogen protection; the system is heterogeneous; weighing Wei Celian mmol of acyclovir, and adding the acyclovir into the three-necked flask at one time; the system is heterogeneous; measuring 7.5mL of N, O-bis (trimethylsilyl) acetamide, and adding the N, O-bis (trimethylsilyl) acetamide into the three-neck flask at one time; the reaction mixture was stirred overnight at room temperature; the system is still heterogeneous; measuring 4mL of N, O-bis (trimethylsilyl) acetamide, and adding the N, O-bis (trimethylsilyl) acetamide into the three-neck flask at one time; after stirring the above reaction mixture again at room temperature for 3 hours, the system became clear; cooling the reaction system to 0 ℃ by using ice water bath; 1.2mL of anhydrous tin tetrachloride is measured and added into the three-neck flask at one time; the cold bath is not removed, the reaction mixture naturally warms to room temperature, and then is stirred at room temperature overnight; the reaction mixture was carefully poured into 250mL of saturated aqueous sodium bicarbonate solution, extracted 3 times with 250mL of dichloromethane, and the organic phases were combined and dried over anhydrous sodium sulfate; pulping the residual pale-sulfocolor solid with 200mL of methyl tertiary butyl ether to obtain a white solid;

(2) Synthesis of Compound III

Compound II synthesized in (1) was added to a clean 250mL single-port bottle and dissolved in 100mL methanol; nitrogen protection after three times of nitrogen replacement; weighing 5.2mmol of sodium tert-butoxide by using weighing paper, and adding the weighing paper into the single-neck flask at one time; the reaction mixture was stirred at room temperature overnight, then the reaction mixture was directly dried by spin-drying, the residue was dispersed in 50mL of ethyl acetate, acidified with 1N hydrochloric acid, extracted 4 times with 50mL of ethyl acetate, and the organic phases were combined and dried over anhydrous sodium sulfate to give a white solid.

(3) Synthesis of Compound IV

Weighing 0.2mmol of compound III, and adding into a clean 50mL eggplant-type bottle; adding 2mL of anhydrous acetonitrile, then replacing nitrogen for three times, and protecting nitrogen; weighing 0.65mmol of dried pyridine, and adding into the eggplant-shaped bottle at one time; cooling the reaction system to 0 ℃ by using ice water bath; weighing 0.3mmol of phosphorus oxychloride, and dripping into the eggplant-shaped bottle; the cold bath is not removed, and the reaction mixture is stirred for 30 minutes at the temperature of 0 ℃ and then is used as a solution A for standby; weighing 0.55mmol of tri-n-butylamine pyrophosphate, and adding into another clean 50mL eggplant-type bottle; adding 2mL of anhydrous acetonitrile, then replacing nitrogen for three times, and protecting nitrogen; weighing 1.5mL of dried tri-n-butylamine, and adding the dried tri-n-butylamine into the eggplant-type bottle at one time; cooling the reaction system to 0 ℃ by using ice water bath; dropwise adding the solution A into the reaction system; the cold bath was not removed, and the reaction mixture was stirred at 0deg.C for 30 min; weighing 4mL of deionized water, adding the deionized water into the reaction system at one time, and stirring the mixture at room temperature for 2 hours; concentrating at 0deg.C to remove organic solvent, and separating and purifying the residual water solution with high pressure preparation separation and purification system (Pre-HPLC); the obtained eluent is freeze-dried to obtain white solid, and the white solid is re-dissolved into 1mL of cold deionized water and frozen at-20 ℃.

Among them, various substitutions of X, the following structures can be listed for the compound IV.

When n=1, the molecular weights are shown in table 1.

Compound of table 1 and mass spectrum structure confirmation

B: when A is O and n is greater than 1

It is necessary to add a long chain synthesis step (a: when a is O and n=1) to the synthesis step of a described above, that is, after compound 3, long chain is synthesized first and then triphosphate is modified.

Therefore, the compounds I to III are the same as the above steps, and when X is substituted by other groups, only the compound 1 needs to be replaced, and the synthetic process does not need to be changed.

According to the number n, different amounts of ethylene oxide are added to the compounds III to V to control the main compounds synthesized, and the required compounds are purified by Pre-HPLC. The synthesis process of the compound VI is the same as that of the compound IV in the synthesis step of the A, except that the compound IV is synthesized by taking the synthesized compound III, and the compound VI is synthesized by taking the synthesized compound V, and the rest processes are the same.

This embodiment takes n=5 as an example.

When n=5, except for the amount of compound I, II, III, V, all the added substances are used in excess, and the difference in synthesis of different substances is that the amount of the obtained product is different.

Synthesis of Compound V

10mmol of compound III is weighed, added into a clean 100mL hydrothermal synthesis reaction kettle and dissolved by 35mL of N, N-dimethylformamide; 60mmol of ethylene oxide is added and then the mixture is sealed; stirring at room temperature for 72 hours, directly spin-drying the reaction mixture, purifying the obtained residue by column chromatography, and then separating and purifying by using a high-pressure preparation separation and purification system (Pre-HPLC); the resulting eluate was lyophilized to give a white solid.

According to the method, different X substituents are changed to prepare a series of compounds VI, and the structures of the compounds VI are shown in a table 2;

table 2 Compounds and Mass Spectrometry Structure confirmation

C: when A is CH ₂ When n=1

Except for the amounts of compounds I, VI, VII, all added materials were used in excess, the difference in synthesis of the different materials being the amount of product obtained.

(1) Synthesis of Compound VII

Weighing 30mmol of the compound I, and adding the compound I into a clean 250mL three-necked flask; 150mL of N, N-dimethylformamide was added and nitrogen was replaced three times; nitrogen protection; cooling to 0 ℃ in an ice water bath, weighing 65mmol of sodium hydrogen (60% in oil), and adding into the reaction system in batches; heating to 70 ℃ after the addition is completed, and stirring for 2 hours; then cooling to 0 ℃ by using ice water bath; 35mmol of 4-bromobutyl acetate is weighed and added into the reaction system in a dropwise manner; after the addition, the cooling bath is not removed at room temperature, the temperature is naturally raised to the room temperature, and the mixture is stirred at the room temperature for 48 hours; filtering, carrying out column chromatography (dichloromethane: methanol=9:1) after carrying out water bath high vacuum spin drying on the filtrate at 40 ℃ to obtain a white solid;

(2) Synthesis of Compound VIII

Compound VII in step (1) was added to a clean 100mL single-port bottle and dissolved with 50mL methanol; nitrogen protection after three times of nitrogen replacement; weighing 1.5mmol of sodium tert-butoxide by using weighing paper, and adding the weighing paper into the single-neck flask at one time; the reaction mixture was stirred at room temperature overnight, then the reaction mixture was directly dried by spin-drying, the residue was dispersed in 50mL of ethyl acetate, acidified with 1N hydrochloric acid, extracted 4 times with 50mL of ethyl acetate, and the organic phases were combined and dried over anhydrous sodium sulfate to give a white solid.

(3) Synthesis of Compound IX

Weighing 0.25mmol of compound VIII, and adding into a clean 50mL eggplant-type bottle; adding 2mL of anhydrous acetonitrile, then replacing nitrogen for three times, and protecting nitrogen; weighing 0.65mmol of dried pyridine, and adding into the eggplant-shaped bottle at one time; cooling the reaction system to 0 ℃ by using ice water bath; weighing 0.3mmol of phosphorus oxychloride, and dripping into the eggplant-shaped bottle; the cold bath is not removed, and the reaction mixture is stirred for 30 minutes at the temperature of 0 ℃ and then is used as a solution A for standby; weighing 0.55mmol of tri-n-butylamine pyrophosphate, and adding into another clean 50mL eggplant-type bottle; adding 2mL of anhydrous acetonitrile, then replacing nitrogen for three times, and protecting nitrogen; weighing 1.5mL of dried tri-n-butylamine, and adding the dried tri-n-butylamine into the eggplant-type bottle at one time; cooling the reaction system to 0 ℃ by using ice water bath; dropwise adding the solution A into the reaction system; the cold bath was not removed, and the reaction mixture was stirred at 0deg.C for 30 min; weighing 4mL of deionized water, adding the deionized water into the reaction system at one time, and stirring the mixture at room temperature for 2 hours; concentrating at 0deg.C to remove organic solvent, and separating and purifying the residual water solution with high pressure preparation separation and purification system (Pre-HPLC); the resulting eluate was lyophilized to give 24.4mg of a white solid, reconstituted into 1mL of cold deionized water and stored frozen at-20 ℃.

According to the method, different X substituents are changed to prepare a series of compounds IX, and the structures of the compounds IX are shown in table 3;

table 3 Compounds and Mass Spectrometry Structure confirmation

D: when A is CH ₂ When n is greater than 1

In contrast to the case when A is O, when A is CH ₂ In this case, it is necessary to synthesize a long chain and then to modify the long chain with triphosphate.

In this example, n=5, all the added substances except the compound I, X, XI were used in excess, and the difference in synthesis of different substances was that the amount of the obtained product was different.

The method comprises the following specific steps:

(1) Synthesis of Compound X

Weighing 30mmo of compound I, and adding the compound I into a clean 250mL three-neck flask; 150mL of N, N-dimethylformamide was added and nitrogen was replaced three times; nitrogen protection; cooling to 0 ℃ in an ice water bath, weighing 65mmol sodium hydrogen (60% in oil), and adding into the reaction system in batches; heating to 70 ℃ after the addition is completed, and stirring for 2 hours; then cooling to 0 ℃ by using ice water bath; 25mmol of 16-bromohexadecyl acetate is weighed and added into the reaction system in a dropwise manner; after the addition, the cooling bath is not removed at room temperature, the temperature is naturally raised to the room temperature, and the mixture is stirred at the room temperature for 48 hours; filtering, carrying out column chromatography (dichloromethane: methanol=9:1) after carrying out water bath high vacuum spin drying on the filtrate at 40 ℃ to obtain a white solid;

(2) Synthesis of Compound XI

2.5mmol of Compound X was weighed, added to a clean 100mL single-necked flask, and dissolved in 50mL of methanol; nitrogen protection after three times of nitrogen replacement; weighing 1.2mmol of sodium tert-butoxide by using weighing paper, and adding the weighing paper into the single-neck flask at one time; the reaction mixture was stirred at room temperature overnight, then the reaction mixture was directly dried by spin-drying, the residue was dispersed in 50mL of ethyl acetate, acidified with 1N hydrochloric acid, extracted 4 times with 50mL of ethyl acetate, and the organic phases were combined and dried over anhydrous sodium sulfate to give 0.86g of a white solid.

(3) Synthesis of Compound XII

Weighing 0.15mmol of compound XI, and adding into a clean 50mL eggplant-type bottle; adding 2mL of anhydrous acetonitrile, then replacing nitrogen for three times, and protecting nitrogen; weighing 0.65mmol of dried pyridine, and adding into the eggplant-shaped bottle at one time; cooling the reaction system to 0 ℃ by using ice water bath; weighing 0.3mmol of phosphorus oxychloride, and dripping into the eggplant-shaped bottle; the cold bath is not removed, and the reaction mixture is stirred for 30 minutes at the temperature of 0 ℃ and then is used as a solution A for standby; weighing 0.55mmol of tri-n-butylamine pyrophosphate, and adding into another clean 50mL eggplant-type bottle; adding 2mL of anhydrous acetonitrile, then replacing nitrogen for three times, and protecting nitrogen; weighing 1.5mL of dried tri-n-butylamine, and adding the dried tri-n-butylamine into the eggplant-type bottle at one time; cooling the reaction system to 0 ℃ by using ice water bath; dropwise adding the solution A into the reaction system; the cold bath was not removed, and the reaction mixture was stirred at 0deg.C for 30 min; weighing 4mL of deionized water, adding the deionized water into the reaction system at one time, and stirring the mixture at room temperature for 2 hours; concentrating at 0deg.C to remove organic solvent, and separating and purifying the residual water solution with high pressure preparation separation and purification system (Pre-HPLC); the resulting eluate was lyophilized to give 11.4mg of a white solid, reconstituted into 1mL of cold deionized water and stored frozen at-20 ℃.

According to the method, different X substituents are changed to prepare a series of compounds XII, and the structures of the compounds XII are shown in table 4;

table 4 compounds and mass spectrum structure confirmation

Effect example 1

A: the SNP detection kit comprises the following components:

(1) Extracting the components of the kit: lysate, washing solution I, washing solution II, eluent, proteinase K and magnetic bead solution.

(2) Multiplex PCR kit components: amplification reaction (40 mM Tris-HCl, 800. Mu.M dNTPs, 200nM primer, 8mM MgCl) ₂ ) Amplifying the enzyme solution.

The extraction kit and the multiplex PCR kit are all from Chongqing Dai Biotechnology Co.

(3) Shrimp alkaline phosphatase (SAP enzyme) treatment system: mu.L of 45mM Tris-HCl, 1. Mu.L of 2U/. Mu.L of SAP enzyme, 1. Mu.L of water.

(4) Extension reaction system: mu.l of single base extension reaction (45 mM Tris-HCl, 16. Mu.M single base extension primer, 0.6mM aceNTPs mix), 3. Mu.l of 1U/. Mu.l of single base extension enzyme.

B: the steps of nucleic acid mass spectrometry detection are as follows:

(1) Extraction of sample DNA: DNA was extracted using the midrange metaji extraction kit components, instrument: and an EXM6000 is a full-automatic medium-element Shineway nucleic acid extraction instrument.

Multiplex PCR reactions (shown in table 5):

TABLE 5 PCR reaction System

Reagent name	Volume (mu L)
		Amplification reaction solution	10
Amplification enzyme solution	5
		DNA (extracted DNA described above)	5

The reaction volume can be scaled down according to the experimental requirements to allow high throughput detection by 384PCR plates. The prepared multiplex PCR reaction system was amplified by a PCR apparatus, and the PCR amplification reaction is shown in Table 6:

TABLE 6 PCR amplification reaction

After the PCR amplification is finished, the reaction volume can be reduced proportionally according to the experimental requirement by carrying out digestion for 30min at 37 ℃ and inactivation for 5min at 65 ℃ on the phosphatase so as to realize high-throughput detection through 384PCR plates.

After digestion is completed, a single base extension reaction is performed. An extension reaction system was prepared and added to the SAP digested product at 7. Mu.l per well to effect the reaction.

The single base extension reaction set-up is shown in Table 7.

TABLE 7 Single base extension reaction

Resin desalination: resin 20mg and 30 μl ddH was added per well ₂ O. Resin and ddH can be proportionally reduced according to experimental requirements ₂ O, so that high throughput detection can be performed by 384PCR plates. The resins described above are purchased from commercial products. The reaction tube (sealing membrane if 384PCR plates were used) was covered, inverted on a rotator, shaken for 5 minutes and centrifuged briefly.

And after desalting is finished, detecting the desalting by a machine, wherein an instrument for detecting mass spectrum is from a Chongqing Zhouji EXS3000 mass spectrometer.

When A is O, the detection effect is as shown in effect examples 2-3

Effect example 2

The structure of the nucleotide is exemplified as follows:

molecular weight 505.18, designated acysulfo-CTP. />

The mutation of 281C & gtT of the vestibular aqueduct expansion related gene SLC26A4 is detected, and the SLC26A4 gene mutation can lead to vestibular aqueduct expansion, namely, the vestibular aqueduct expansion simply or the vestibular aqueduct expansion combined with cochlea deformity. Vestibular aqueduct enlargement is the most common deformity of the inner ear, accounting for 1-8% of hereditary hearing loss. Clinically, it is mainly manifested as high-frequency hearing loss, sensorineural hearing loss, and the degree of hearing loss is often manifested as severe or extremely severe hearing loss. The onset of the disease is usually in childhood, and the disease is usually preceded by the causes of increased intracranial pressure such as cold, fever, trauma and the like.

The invention uses the unmodified nucleotide substrate (reaction 1) and the modified nucleotide substrate (reaction 2) to analyze the 281C & gtT locus of the detected sample.

The non-modified nucleic acid substrate in this example was acyATP, acyGTP, acyCTP and acyTTP mixed solution, and the modified nucleic acid substrate was acyATP, acyGTP, acy sulfo-CTP and acyTTP mixed solution.

The results are shown in Table 8 and FIG. 1, and the results show that the analysis sample is a patient carrying the mutant gene at 281C > T site, consistent with the sequencing results.

TABLE 8 mutation site analysis

	Primer(s)	Primer molecular weight (m/z)	Extension base	Molecular weight of extension product
					Reaction 1/2	Primer1-281C＞T	5873.9	C/T	6069.02/6083.02
Reaction 3	Primer1-281C＞T	5873.9	Sulfonic acid CTP/T	6149.08/6083.02

The sequence of Primer1-1174A > T is SEQ ID No.1: gtcatttcgggagttagta

The results show that the modified acysulfo-CTP is more separated from the acyTTP, and the interpretation on the spectrogram is easier.

Clinical trial

The invention uses modified nucleic acid substrate (acyATP, acyGTP, acy sulfo-CTP and aceTTP mixed liquid) to carry out mutation analysis on 20 SNP loci of deafness genes on a detected sample. SNP typing results of deafness-related susceptibility genes are shown in tables 9-11 and FIG. 2:

TABLE 9 multiplex amplification primers

Table 10 single base extension primer

Numbering device	Sequence(s)	Site name
			SEQ.ID.NO.22	ctccacagtcaagca	1975G>C
SEQ.ID.NO.23	aatcctgagaagatgt	1174A>T
			SEQ.ID.NO.24	caccactgctctttccc	1226G>A
SEQ.ID.NO.25	tgttggagtgagatcac	2027T>A
			SEQ.ID.NO.26	cacgaagatcagctgca	235delC
SEQ.ID.NO.27	gcagtagcaattatcgtc	IVS7-2A>G
			SEQ.ID.NO.28	cgtacacaccgcccgtcac	1494C>T
SEQ.ID.NO.29	acgtggactgctacattgcc	538C>T
			SEQ.ID.NO.30	cagcgtggccactagccca	281C>T
SEQ.ID.NO.31	cagtgctctcctggacggcc	1229C>T
			SEQ.ID.NO.32	gatgaacttcctcttcttctc	299_300delAT
SEQ.ID.NO.33	ggattagataccccactatgct	1095T>C
			SEQ.ID.NO.34	tctgtagatagagtatagcatca	2168A>G
SEQ.ID.NO.35	tgtctgcaacaccctgcagccag	176_191del16
			SEQ.ID.NO.36	tgccagtgccctgactctgctggtt	589G>A
SEQ.ID.NO.37	acccctacgcatttatatagaggag	1555A>G
			SEQ.ID.NO.38	aaaacaaatttctagggataaaata	IVS15+5G>A
SEQ.ID.NO.39	gggcacgctgcagacgatcctggggg	35delG
			SEQ.ID.NO.40	ccatgaagtaggtgaagattttcttct	547G>A
SEQ.ID.NO.41	aaaggacacattctttttga	2162C>T

TABLE 11 SNP typing of deafness-related susceptibility genes

The primer group provided by the invention can be used for typing 20 SNP loci of deafness related susceptibility genes, the accuracy is 100%, and the accuracy is consistent with the first-generation sequencing result of the gene detection gold standard.

Effect example 3

The structure of the nucleotide is exemplified as follows:

molecular weight 673.44

For convenience, named acy-butyl ether-CTP (n=5)

In this effect example, the detection effect when n >1 was examined

This effect example detects IVS-I-5 (G > C), which is a mutation site for beta thalassemia.

TABLE 12 mutation site analysis

	Primer(s)	Primer molecular weight (m/z)	Extension base	Molecular weight of extension product
					Reaction 1/2	Primer2-IVS-I-5(G>C)	6172.10	G/C	6407.24/6367.22
Reaction 3	Primer2-IVS-I-5(G>C)	6172.10	G/butyl ether-CTP	6407.24/6615.54

The sequence of the Primer2-IVS-I-5 (G > C) is SEQ ID. NO.42: GCAGGTTGAGGCTATCATTA

The results are shown in fig. 3, where the modified acy-butyl ether-CTP (n=5) is well separated from acyGTP, and the results are very easy to interpret.

Effect example 4 when A is CH ₂ Effect verification of (a)

In this effect example, A is replaced by CH from O ₂ Influence on the detection Effect

Since the number of kinds of nucleotides protected by the present invention is large, it cannot be completely exemplified in examples, and thus this effect example is illustrated by examining the following structural formulae.

The molecular weight of the single-base extension primer of this example was the same as that of example 2, except that the product was extended with a different nucleotide substrate

TABLE 13 molecular weight of extension products

(1)

Molecular weights 551.20 and 549.04, respectively, designated acy I-CTP

(2)

Molecular weights of 501.22 and 499.25, respectively, designated acybenzene-CTP

(3)

Molecular weights 523.27 and 521.03, respectively, designated acy 1, 4-aminopiperidine-CTP

As a result, the spectral lines 1, 2, 3, 4, 5 and 6 in the figure represent the results of detection of mutation sites 281C > T as substrates, respectively, by acy I-TTP (A), acy I-TTP (B), acy benzene-TTP (A), acy benzene-TTP (B), acy 1, 4-aminopiperidine-CTP (A) and acy 1, 4-aminopiperidine-CTP (B), as shown in FIG. 4.

As can be seen from the figure, A is O or CH in terms of molecular weight ₂ The differences are not large, so they are closely spaced on the spectra, but the larger the molecular weight differences relative to the acyCTP, the more can be spaced on the spectra.

Sequence listing

<110> medium-metaji Biotechnology Co., ltd

<120> a modified nucleotide, composition and reagent

<130> 2021.10.18

<160> 42

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Synthetic

<400> 1

gtcatttcgg gagttagta 19

<210> 2

<211> 41

<212> DNA

<213> Synthetic

<400> 2

acgttggatg aagtggcttt aacatatctg aacacacaat a 41

<210> 3

<211> 34

<212> DNA

<213> Synthetic

<400> 3

acgttggatg tcagagcggt caagttgaaa tctc 34

<210> 4

<211> 38

<212> DNA

<213> Synthetic

<400> 4

acgttggatg tgcttgctta cccagactca gagaagtc 38

<210> 5

<211> 35

<212> DNA

<213> Synthetic

<400> 5

acgttggatg tctccccctt gatgaacttc ctctt 35

<210> 6

<211> 33

<212> DNA

<213> Synthetic

<400> 6

acgttggatg gctcatcatt gagttcctct tcc 33

<210> 7

<211> 33

<212> DNA

<213> Synthetic

<400> 7

acgttggatg ctccccagcc tccaccagct tgt 33

<210> 8

<211> 41

<212> DNA

<213> Synthetic

<400> 8

acgttggatg tttgacagtt gttcaagaaa gagagccttt g 41

<210> 9

<211> 34

<212> DNA

<213> Synthetic

<400> 9

acgttggatg cccaggaaga gaactctaag gaag 34

<210> 10

<211> 39

<212> DNA

<213> Synthetic

<400> 10

acgttggatg actatgatag acactgcagc tagagatac 39

<210> 11

<211> 38

<212> DNA

<213> Synthetic

<400> 11

acgttggatg tgatgataag tgagccttaa taagtggg 38

<210> 12

<211> 38

<212> DNA

<213> Synthetic

<400> 12

acgttggatg gcattatttg gttgacaaac aaggaatt 38

<210> 13

<211> 30

<212> DNA

<213> Synthetic

<400> 13

acgttggatg gaacaccaca ctcaccccct 30

<210> 14

<211> 39

<212> DNA

<213> Synthetic

<400> 14

acgttggatg gtaggatcgt tgtcatccag tctcttcct 39

<210> 15

<211> 33

<212> DNA

<213> Synthetic

<400> 15

acgttggatg tgttgccatt cctcgacttg ttc 33

<210> 16

<211> 36

<212> DNA

<213> Synthetic

<400> 16

acgttggatg ggagtgaaga ttcttagatt ttccag 36

<210> 17

<211> 32

<212> DNA

<213> Synthetic

<400> 17

acgttggatg ctattcctga ttggacccca gt 32

<210> 18

<211> 32

<212> DNA

<213> Synthetic

<400> 18

acgttggatg gaacgttccc aaagtgccaa tc 32

<210> 19

<211> 34

<212> DNA

<213> Synthetic

<400> 19

acgttggatg gaaaaccaga accttaccac ccgc 34

<210> 20

<211> 32

<212> DNA

<213> Synthetic

<400> 20

acgttggatg gcaatgcggg ttctttgacg ac 32

<210> 21

<211> 38

<212> DNA

<213> Synthetic

<400> 21

acgttggatg ggaaccttga ccctcttgag atttcact 38

<210> 22

<211> 15

<212> DNA

<213> Synthetic

<400> 22

ctccacagtc aagca 15

<210> 23

<211> 16

<212> DNA

<213> Synthetic

<400> 23

aatcctgaga agatgt 16

<210> 24

<211> 17

<212> DNA

<213> Synthetic

<400> 24

caccactgct ctttccc 17

<210> 25

<211> 17

<212> DNA

<213> Synthetic

<400> 25

tgttggagtg agatcac 17

<210> 26

<211> 17

<212> DNA

<213> Synthetic

<400> 26

cacgaagatc agctgca 17

<210> 27

<211> 18

<212> DNA

<213> Synthetic

<400> 27

gcagtagcaa ttatcgtc 18

<210> 28

<211> 19

<212> DNA

<213> Synthetic

<400> 28

cgtacacacc gcccgtcac 19

<210> 29

<211> 20

<212> DNA

<213> Synthetic

<400> 29

acgtggactg ctacattgcc 20

<210> 30

<211> 19

<212> DNA

<213> Synthetic

<400> 30

cagcgtggcc actagccca 19

<210> 31

<211> 20

<212> DNA

<213> Synthetic

<400> 31

cagtgctctc ctggacggcc 20

<210> 32

<211> 21

<212> DNA

<213> Synthetic

<400> 32

gatgaacttc ctcttcttct c 21

<210> 33

<211> 22

<212> DNA

<213> Synthetic

<400> 33

ggattagata ccccactatg ct 22

<210> 34

<211> 23

<212> DNA

<213> Synthetic

<400> 34

tctgtagata gagtatagca tca 23

<210> 35

<211> 23

<212> DNA

<213> Synthetic

<400> 35

tgtctgcaac accctgcagc cag 23

<210> 36

<211> 25

<212> DNA

<213> Synthetic

<400> 36

tgccagtgcc ctgactctgc tggtt 25

<210> 37

<211> 25

<212> DNA

<213> Synthetic

<400> 37

acccctacgc atttatatag aggag 25

<210> 38

<211> 25

<212> DNA

<213> Synthetic

<400> 38

aaaacaaatt tctagggata aaata 25

<210> 39

<211> 26

<212> DNA

<213> Synthetic

<400> 39

gggcacgctg cagacgatcc tggggg 26

<210> 40

<211> 27

<212> DNA

<213> Synthetic

<400> 40

ccatgaagta ggtgaagatt ttcttct 27

<210> 41

<211> 20

<212> DNA

<213> Synthetic

<400> 41

aaaggacaca ttctttttga 20

<210> 42

<211> 20

<212> DNA

<213> Synthetic

<400> 42

gcaggttgag gctatcatta 20

Claims

1. A modified nucleotide, wherein the modified nucleotide is selected from the group consisting of、、、Or->。

2. A substrate mixture comprising the modified nucleotide of claim 1.

3. The substrate mixture of claim 2, further comprising acyATP, acyGTP and acy UTP, having the following structural formula in order:

、、。

4. a reagent for primer extension comprising the substrate mixture of claim 2 or 3.

5. A kit for mass spectrometry detection of nucleic acids comprising the reagent for primer extension of claim 4.