CN113975397B - Gene/small molecule compound nano drug delivery system and preparation method and application thereof - Google Patents

Gene/small molecule compound nano drug delivery system and preparation method and application thereof Download PDF

Info

Publication number
CN113975397B
CN113975397B CN202111248086.6A CN202111248086A CN113975397B CN 113975397 B CN113975397 B CN 113975397B CN 202111248086 A CN202111248086 A CN 202111248086A CN 113975397 B CN113975397 B CN 113975397B
Authority
CN
China
Prior art keywords
dna
mir
delivery system
drug delivery
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111248086.6A
Other languages
Chinese (zh)
Other versions
CN113975397A (en
Inventor
童建斌
欧阳文
周文虎
朱曲波
欧阳琴
刘凯
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Third Xiangya Hospital of Central South University
Original Assignee
Third Xiangya Hospital of Central South University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Third Xiangya Hospital of Central South University filed Critical Third Xiangya Hospital of Central South University
Priority to CN202111248086.6A priority Critical patent/CN113975397B/en
Publication of CN113975397A publication Critical patent/CN113975397A/en
Application granted granted Critical
Publication of CN113975397B publication Critical patent/CN113975397B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7048—Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin, digitoxin or digoxin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0014—Skin, i.e. galenical aspects of topical compositions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0053—Mouth and digestive tract, i.e. intraoral and peroral administration
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y30/00—Nanotechnology for materials or surface science, e.g. nanocomposites
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y40/00—Manufacture or treatment of nanostructures
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00—Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Nanotechnology (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Neurology (AREA)
  • Biochemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Condensed Matter Physics & Semiconductors (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Neurosurgery (AREA)
  • Biophysics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Dermatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medical Informatics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Composite Materials (AREA)
  • Physiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Materials Engineering (AREA)
  • Manufacturing & Machinery (AREA)
  • Psychiatry (AREA)

Abstract

The invention relates to the technical field of biological medicine, in particular to a gene/micromolecular compound nano drug delivery system and a preparation method and application thereof. The drug delivery system comprises a DNA nanoflower carrier, rutin, miR-124 chimera and a DNA-targeting ligand; rutin and the DNA nanoflower carrier are loaded through pi-pi stacking, and miR-124 chimera, DNA-targeting ligand and the DNA nanoflower carrier are loaded through DNA molecular hybridization reaction. The drug delivery system can relieve the long-term enhanced injury of APP/PS1 mice, reduce the quantity of hippocampal amyloid plaques, reduce the levels of BACE1mRNA and protein, relieve neuroinflammatory reaction, delay the occurrence process of Alzheimer disease, and can be applied to the preparation of targeted therapeutic drugs of AD.

Description

Gene/small molecule compound nano drug delivery system and preparation method and application thereof
Technical Field
The invention relates to the technical field of biological medicine, in particular to a gene/micromolecular compound nano drug delivery system and a preparation method and application thereof.
Background
Alzheimer's Disease (AD) is a typical irreversible neurodegenerative disease, associated with extracellular amyloid-beta (Abeta) deposition and intracellular hyperphosphorylation of Tau (p-Tau) aggregation. Currently, the main clinical treatments include cholinesterase inhibitors (donepezil, etc.) and N-aspartate receptor antagonists (memantine), but only delay onset time and do not prevent disease. There is currently no effective treatment for diseases. Furthermore, many formulations against aβ and p-Tau failed to demonstrate any efficacy in slowing or improving overall function in phase 3 clinical trials. Thus, there is an urgent need to develop new disease modifying therapies for aβ and p-Tau.
In recent years, microRNAs (miRNAs) drugs are widely used in disease diagnosis and treatment. Of these, miR-124 has great medicinal potential in Alzheimer's disease. miR-124 is specifically expressed in the brain, and at the same time, miR-124 is found to be significantly down-regulated in the brain of Alzheimer's disease patients. miR-124, through binding to mRNA, can regulate expression of various genes (e.g., BACE1, cavelin-1, GSK-3 beta, 9PTPN1, DACT1, etc.), thereby affecting synaptic plasticity, neuroinflammation, production of Abeta and Tau protein phosphorylation. Many studies have also demonstrated that virus-mediated overexpression of miR-124 can inhibit the production of APP/PS1 transgenic mouse beta-amyloid, alleviating its cognitive deficit. In addition, the miR-124 nano particles can inhibit nerve inflammation and alleviate acute brain injury by intraventricular injection or intranasal delivery. However, it is unclear whether exogenous delivery of miR-124 could block or slow AD progression. Can be combined with the small molecular medicine rutin to further synergistically improve the pathological condition of AD.
However, the electronegativity of miRNA and the characteristic of easy enzymolysis in vivo limit the application of the miRNA, so that the development of a drug delivery system with high efficiency, low toxicity and low price is the primary problem to be solved when miR-124 is used for AD treatment. In addition, most AD drugs have low blood brain barrier permeation efficiency and in vivo nonselective distribution problems, so that the construction of a drug delivery system with active targeting has a certain clinical practical significance.
Disclosure of Invention
In order to solve the problems, the invention aims to provide a nano drug delivery system which can realize high-efficiency permeation of blood brain barrier and targeted identification of nerve cells, reduce long-term enhanced (LTP) damage of APP/PS1 mice, reduce the quantity of Aβ plaques of hippocampus, reduce the level of BACE1mRNA and protein, relieve neuroinflammatory reaction and finally improve cognitive dysfunction; can be applied to the preparation of therapeutic targeted therapeutic drugs for AD.
In view of the above, the embodiments of the present invention provide a gene/small molecule compound nano drug delivery system comprising a DNA nanoflower vector, rutin, miR-124 chimera, and a DNA-targeting ligand; the rutin and the DNA nanoflower carrier are loaded through pi-pi stacking, and the miR-124 chimera, the DNA-targeting ligand and the DNA nanoflower carrier are loaded through DNA molecular hybridization reaction;
the DNA nanoflower carrier is prepared by taking a sequence shown as SEQ ID NO. 1 as a template through RCA reaction;
the miR-124 chimera is obtained through annealing hybridization reaction of miR-124 reaction chain and miR-124 long-chain complementary chain;
the DNA-targeting ligand is obtained by taking a sequence shown as SEQ ID NO. 2 as a template chain, and carrying out addition reaction with a targeting ligand with a side chain containing sulfhydryl after MAL modification.
Further, the targeting ligand is a ligand capable of penetrating the blood brain barrier, specifically:
any one of a neurotropic virus-derived peptide, brain targeting nucleic acid aptamer, angiopep2, cell penetrating peptide, D peptide, or T7 peptide.
Further, the molar concentration ratio of the DNA nanoflower carrier to rutin to miR-124 chimera is 1:480:14; the concentration of the DNA nanoflower carrier is 0.1 mu M-3 mu M, the concentration of rutin is 48 mu M-1440 mu M, and the concentration of miR-124 chimera is 1.4 mu M-28 mu M.
Further, the concentration of the targeting ligand is 0.1 mg/mL-0.9 mg/mL.
Based on the same inventive concept, the embodiment of the invention also provides a preparation method of the gene/small molecule compound nano drug delivery system, which specifically comprises the following steps:
s1, mixing a miR-124 reaction chain and a miR-124 long-chain complementary chain in a buffer solution, annealing and hybridizing to obtain a miR-124 chimeric body;
s2: mixing a DNA chain with a sequence shown as SEQ ID NO. 2 and a 5' -modified maleimide group with a targeting ligand solution, and incubating to obtain a DNA-targeting ligand;
s3, mixing a DNA template chain with a sequence shown as SEQ ID NO. 1, a primer and a reaction buffer solution, performing vortex annealing, adding a T4DNA ligase to connect to obtain annular DNA, dripping BSA, dNTPs, DNA polymerase and the buffer solution into the annular DNA under the ice bath condition, and performing RCA reaction to obtain the DNA nanoflower;
s4, preparing rutin into a solution, dripping the DNA nanoflower, and incubating overnight at room temperature to obtain Rutin@DFs;
s5, mixing the Rutin@DFs, the miR-124 chimeric body and the DNA-targeting ligand, and incubating to obtain the gene/small molecule compound nano drug delivery system.
Furthermore, the nucleotide sequences of the miR-124 reaction chain and the miR-124 long-chain complementary chain in the step S1 are shown as SEQ ID NO. 3 and SEQ ID NO. 4.
Furthermore, the deoxynucleotide sequence of the primer in the step S3 is shown as SEQ ID NO. 5.
Based on the same inventive concept, the embodiment of the invention also provides an application of the gene/small molecule compound nano drug delivery system in preparing drugs for treating neurodegenerative diseases.
Based on the same inventive concept, the embodiment of the invention also provides an application of the gene/small molecule compound nano drug delivery system in preparing a targeted therapeutic drug for Alzheimer disease.
Based on the same inventive concept, the embodiment of the invention also provides a targeted therapeutic drug for Alzheimer disease, wherein the drug is an external preparation, an oral preparation or an injection preparation containing the gene/small molecule compound nano drug delivery system.
Further, the external preparation is an external gel; the oral preparation is granules, tablets, oral solutions and the like containing the gene/micromolecular compound nano drug delivery system; the injection is intravenous injection containing the gene/micromolecular compound nano drug delivery system.
The beneficial effects are that:
(1) The gene/small molecule compound nano drug delivery system provided by the invention takes DNA nanoflower (DFs) as a carrier, and can control the particle size by controlling the Rolling Circle Amplification (RCA) time; the RCA template can be edited, the multifunction can be realized through the design of the template, the structure is compact, the RCA template can be protected from degradation, other toxic organic or inorganic substances are not contained, and the potential toxic and side effects are reduced.
(2) The gene/small molecule compound nano drug delivery system provided by the invention is loaded and modified with a specific targeting ligand, such as a neurotropic virus derived peptide (RVG 29), so that nano delivery can be combined with a Blood Brain Barrier (BBB) and an alpha 7 nicotinic acetylcholine receptor (alpha 7 nAChR) which is highly expressed on neurons, and the gene/small molecule compound nano drug delivery system can pass through the BBB in a noninvasive way under the action of the alpha 7nAChR, thereby avoiding damage caused by other modes, and can be administered by intravenous injection, and compared with the traditional brain diseases administration by a cerebral perfusion mode, the administration is more convenient and quicker.
(3) According to the gene/micromolecular compound nano drug delivery system provided by the invention, the DNA nanoflower carrier (DFs) is obtained through RCA reaction, rutin, miR-124 chimera and targeting ligand RVG29 high-efficiency load can be realized through pi-pi accumulation and hybridization, and the preparation process is simple and controllable.
(4) The invention provides an application of a gene/small molecule compound nano drug delivery system in the preparation of Alzheimer's disease drugs, which comprises the following steps: the nanometer drug delivery system can target neurons, reduce the quantity of the Aβ plaques of the hippocampus, reduce the mRNA and protein levels of BACE1, relieve the neuroinflammatory reaction, and finally delay the occurrence process of Alzheimer's disease by reducing the long-term enhanced (LTP) injury of APP/PS1 mice after tail intravenous injection, and can be applied to preparing targeted therapeutic drugs of AD.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 is a gel electrophoresis chart of DFs provided in example 1 of the present invention;
FIG. 2 is a graph of particle size and potential change of DFs, rutin@DF-miR-124 (RDM) and Rutin@DF-miR-124/RVG29 (RDMR) provided by the embodiment of the invention;
FIG. 3 is a scanning electron microscope (A-C) and a transmission electron microscope (D) of an RDMR provided by an embodiment of the present invention;
FIG. 4 is an ultraviolet absorbance spectrum of RDMR-loaded rutin provided by the embodiment of the invention;
FIG. 5 is a graph of fluorescence absorption spectra of RDMR provided by an embodiment of the present invention; FIG. 5A is a fluorescence absorption spectrum of the RDMR captured miR-124 chimera, and FIG. 5B is a fluorescence absorption spectrum of the RDMR linked DNA-RVG 29;
FIG. 6 is a graph showing the release of rutin and miR-124 from RDMR under different conditions provided by an embodiment of the invention;
FIG. 7 is a graph showing the change in particle size of DFs and RDMR incubated in PBS, DMEM (10% FBS) for 24h according to the examples of the present invention;
FIG. 8 is an evaluation of blood brain barrier (blood brain barrier, BBB) permeation in vitro by RDMR provided by an embodiment of the present invention; FIG. 8A is a graph of a tanswell cell model, FIG. 8B is a graph of in vitro BBB transmembrane resistance TEER over time, and FIG. 8C is a graph of BBB permeation efficiency in the lower chamber measured after RDMR is added to the upper chamber;
FIG. 9 is a graph showing the targeted uptake of RDMR by SH-SY5Y cells provided by an embodiment of the present invention;
FIG. 10 shows the results of cell viability of DFs, free rutin, free miR-124 and RDMR incubated with different cells for 24h in accordance with an embodiment of the invention; HBMEC cells (FIG. 10A), SH-SY5Y cells (FIG. 10B), SH-SY5YAPPswe cells (FIG. 10C) and SVG P10 cells (FIG. 10D);
FIG. 11 shows the protein expression of BACE1 in SH-SY5YAPPswe cells provided by the examples of the present invention; FIG. 11A is a Western blot of BACE1 and FIG. 11B is a quantitative analysis of FIG. 11A 24h after PBS, DR, RDR, DMR and RDMR treatments;
FIG. 12 is a graph showing the in vivo distribution of RDMR provided by an embodiment of the present invention; FIG. 12A is a plot of in vivo fluorescence profiles of PBS, free cy5.5-miR-124, cy5.5-RDM and cy5.5-RDMR, FIG. 12B is a plot of fluorescence profiles of cy5.5-miR-124-NC, cy5.5-RDM and cy5.5-RDMR in isolated organs, FIG. 12C is a quantitative statistical plot of 12B, FIG. 12D is a plot of fluorescence co-localization of a 7nAChR (RVG 29 target) in brain tissue sections after blocking of PBS, free cy5.5-miR-124, cy5.5-RDM, cy5.5-RDMR and RVG29 in the RDMR group.
FIG. 13 is a diagram showing the improvement of AD pathology in APP/PS1 mice by RDMR according to an embodiment of the present invention; FIG. 13A is a schedule of animal experiments, FIG. 13B is mRNA levels of hippocampal miR-124, FIGS. 13C-13E are changes in hippocampal LTP, FIGS. 13F-13H are changes in hippocampal Abeta, and FIGS. 13I-13L are changes in neuroinflammatory markers (Iba 1 positive area, mRNA levels of IL-6, IL-1 beta and TNF-alpha).
FIG. 14 is an H & E staining chart of the major organs (heart, liver, spleen, lung and kidney) of mice of each group provided in the examples of the present invention.
Detailed Description
For a clearer explanation of the technical content of the present invention, reference is made to the detailed description herein with reference to specific examples and drawings, it being evident that the examples cited are only preferred embodiments of the present technical solution, and that other technical solutions obvious to those skilled in the art from the disclosed technical content still fall within the scope of the present invention.
The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise indicated; the reagents used in the examples were all commercially available unless otherwise specified.
The percentage "%" referred to in the present invention refers to mass percent unless otherwise specified; however, the percentage of the solution, unless otherwise specified, refers to the grams of solute contained in 100ml of solution.
The parts by weight of the present invention may be those known in the art such as mu g, mg, g, kg, or may be multiples thereof such as 1/10, 1/100, 10 times, 100 times, etc.
In the embodiment of the invention, the adopted chemical reagents are all analytical grade reagents and are prepared by purchasing or existing methods.
In the following examples, details of the instruments and manufacturers used are shown in Table 1:
table 1 Main Instrument names and manufacturers
In the following examples, the names of the main reagents used and the manufacturers are shown in Table 2:
TABLE 2 Main reagent names and manufacturers
Example 1
Preparation of DNA nanoflower (DFs) in a gene/small molecule compound nanodelivery system:
(1) Preparing cDNA: mu.L of 10. Mu.M DNA template strand (T) (DNA template strand: phospho-TATCGTACAGATTGACGACGCGGCGGCCCTTGATATGCCGCAGCAGCATCTAACCGTACAGTATTTGCTGCTGCAGCGATACGCGTATCGCTATGGCA) and 120. Mu.L of 10. Mu.M primer strand (P) (primer strand: CTGTACGATATGCCATAGCG) were added to 1.5mL of enzyme-free EP tube, 100. Mu.L of 10 XT 4 ligation buffer (50 mM Tris-HCl,10mM MgCl 2, 10mM DTT,1mM ATP) and 720. Mu.L of ddH2O were gently vortexed, mixed, heated at 95℃for 5min, and cooled slowly to room temperature. The above mixed solution was added with 25. Mu.L of T4DNA ligase at a concentration of 4000U/. Mu.L and ligated overnight at 16℃to give circular DNA (cDNA).
(2) Preparation DFs: mu.L of the cDNA mixture of step (1) above was taken, 200. Mu.L of dNTPs at a concentration of 10mM, 100. Mu.L of BSA solution at a concentration of 10X, 100. Mu.L of Phi29 buffer (500 mM Tris-HCl,100mM (NH) 4 ) 2 SO 4 ,40mM Dithiothreitol,100mM MgCl 2 pH 7.5), 100. Mu.L of Phi29 DNA polymerase at a concentration of 100U/. Mu.L, gently vortexing, mixing well, incubating at 30℃for 3h, and heating at 75℃for 10min to give DFs. The reaction solution was centrifuged at 16000 rpm for 10min and ddH 2 O is washed twice and stored at 4 ℃ for standby.
Example 2
A gene/small molecule compound nanometer drug delivery system comprises DFs, rutin, miR-124 chimera and DNA-RVG29. Rutin is inserted into DFs through pi-pi stacking, and miR-124 chimera and DNA-RVG29 are connected with DFs through DNA molecular hybridization reaction.
The preparation method comprises the following steps:
(1) Preparation of miR-124 chimeras: in a ligation buffer (200 mM N-2-Hydroxy-ethyl-pi-perazine-N' -2-ethane sulfonic acid, pH 7.4,1.5M NaCl,20mM CaCl 2 ) To this, 250. Mu.L of miR-124 reaction chain (miR-124 reaction chain sequence: FAM/Cy5.5-UAAGGCACGCGGUGAAUGCCAA) and 250. Mu.L of miR-124 long-chain complementary strand (miR-124 long-chain complementary strand has the sequence: cguguucacagcggaccuugauacgatctaaccgtacagtatt) to 1.5mL enzyme-free EP tube, gently vortexed, transferred to PCR instrument and reacted according to the following procedure: the reaction is carried out for 5 minutes at 95 ℃,10 minutes at 55 ℃,20 minutes at 37 ℃, and after the reaction is slowly cooled to room temperature, the reaction is stored at 4 ℃ for standby.
(2) Preparation of DNA-RVG29: 10mg RVG29 polypeptide is precisely weighed, dissolved in 1mL PBS (Ph 8.0), gently vortexed and uniformly mixed to prepare 10mg/mL RVG29 mother liquor. A700. Mu.L concentration of 15. Mu.M maleimide-modified DNA strand (the sequence of the DNA strand: ATTGACGACGCGGCGGCCCTT) (DNA-MAL) was taken in a 1.5ml enzyme-free EP tube, and RVG29 solution was slowly added dropwise thereto, and incubated at room temperature for 8 hours to give DNA-RVG29. After purification by ultrafiltration membrane for 2 days, the mixture was stored at 4℃for further use.
(3) Preparing rutin stock solution: 3mg of Rutin (Rutin) is precisely weighed, and dissolved in 1mL of DMSO to prepare 3mg/mL of Rutin solution.
(4) Preparation of Rutin@DFs: taking 1mL of DFs solution prepared in the step (1), slowly dripping 5 mu L of rutin solution with the concentration of 3mg/mL, and incubating overnight at room temperature to obtain Rutin@DFs (RD). The reaction solution was centrifuged at 16000 rpm for 10min and ddH 2 O is washed twice and stored at 4 ℃ for standby.
(5) Preparing Rutin@DF-miR-124/RVG29: mu.L of the miR-124 chimera prepared in the step (2) and 15 mu M of DNA-RVG29 prepared in the step (3) are added into 100 mu.L of Rutin@DFs in 1.5mL enzyme-free EP tube, and incubated for 3h at 30 ℃ to obtain Rutin@DF-miR-124/RVG29 (RDMR). The reaction solution was centrifuged at 16000 rpm for 10min and ddH 2 O is washed twice and stored at 4 ℃ for standby.
(6) Other nano-formulations were prepared: in particular, DF-RVG29 (DR), rutin@DF-RVG29 (RDR), rutin@DF-miR-124 (RDM) and DF-miR-124/RVG29 (DMR) are prepared respectively by referring to the methods from the step (1) to the step (5).
RCA reaction verification:
agarose gel electrophoresis for respectively detecting a primer strand (P), a template strand (T), a circular DNA (cDNA), DFs and a DNA marker, and the measuring method comprises the following steps: accurately weighing 25mg agarose, adding into a 100ml conical flask, adding 100ml ultrapure water, reversing, mixing, heating in a microwave oven with medium fire for 2 min to dissolve, standing at room temperature for several min, cooling to 60deg.C, adding 1 μl Gel Red with concentration of 1000×into the flask, mixing, introducing into a Gel preparation device, inserting into a comb, standing at room temperature for about half an hour, and solidifying. The electrophoresis tank was filled with 1×TAE buffer until the gel was immersed. Loading: p, T, cDNA, DFs and DNAmarker were applied in sequence from left to right, 10. Mu.L each well. Setting the electrophoresis voltage to 80V, electrophoresis for 45 minutes, stopping electrophoresis when the indication line electrophoresis reaches about two thirds of the colloid, and performing imaging and photographing by using ultraviolet imaging equipment. The results are shown in fig. 1, and it can be seen that: DFs was successfully prepared, DFs increased in molecular weight due to the RCA reaction, uppermost in the gum.
Particle size and potential measurement:
particle diameters and potentials of the Rutin@DF-miR-124 (RDM) obtained in the embodiment 1 and the Rutin@DF-miR-124/RVG29 (RDMR) obtained in the embodiment 2 are measured by the following steps: sample solution was placed in a marlvennnano ZS instrument, particle size was detected by dynamic light laser scattering, cell temperature was set to 25 ℃, and 3 parts of each sample was run in parallel. The results are shown in fig. 2, and it can be seen that: the particle size of the DNA nanoflower carrier DFs is 181nm, the potential is-10.26 mV, and the RDMR particle size of the rutin, miR-124 chimera and RVG29 are increased to 229nm, and the potential is increased to-3.40 mV.
Morphological analysis:
and respectively observing the form of the RDMR by adopting a scanning electron microscope and a transmission electron microscope. The method for detecting the morphology comprises the following steps: the sample is dripped on a 400-mesh copper mesh covered with a carbon film, placed in a dryer, and after the sample is naturally dried, placed under a scanning electron microscope JSM-7500F and a transmission electron microscope Titan G2-F20 for observation. FIG. 3 shows a scanning electron microscope (A-C) and a transmission electron microscope (D) of RDMR, from which: the RDMR of the present invention is a flower-like structure under a transmission electron microscope.
Ultraviolet spectrum analysis:
ultraviolet spectrum scanning is respectively carried out on DFs, free rutin and RDMR, and the determination method comprises the following steps: DFs is taken as a blank control liquid, and the free rutin and RDMR ultraviolet absorption patterns are measured. The results are shown in fig. 4, and it can be seen that: simple DFs has no obvious absorption peak near 364nm, and free rutin and RDMR have plasma resonance absorption peaks at about 364nm, which proves that rutin has been successfully encapsulated in DFs. In addition, the rutin loading capacity of RDMR can be quantified through ultraviolet absorption spectrum.
Fluorescence spectrum analysis:
fluorescence spectroscopy scans were performed on FAM-labeled miR-124 and rhodamine B-labeled RVG29 in RDMR, respectively. FIG. 5A is a fluorescence absorption spectrum of miR-124 in RDMRZ. From the graph, the RDMR has a fluorescence characteristic absorption peak of FAM-miR-124 at 520nm, while pure DFs has no absorption near 520nm, which proves that miR-124 is successfully connected with DFs. Figure 5B is a fluorescence absorption spectrum of RVG29 in RDMR. From the figure, RDMR has a fluorescence characteristic absorption peak of rhodamine B-RVG29 at 580nm, while pure DFs has no absorption near 580nm, which proves that RVG29 is modified on DFs. In addition, the ability of RDMR to capture miR-124 and link RVG29 can be quantified by fluorescence absorbance spectroscopy.
In vitro release behavior:
and measuring the release efficiency of rutin and miR-124 by adopting a membraneless dissolution method. The detection method comprises the following steps: 1.0ml RDMR was placed in 2 10ml enzyme-free EP tubes, 4.0ml PBS with pH 7.4 and PBS with pH 6.0 were added, and the EP tubes were placed in a constant temperature shaking oven at 37℃and set at a rotational speed of 100 revolutions per minute. After taking out 100. Mu.L of the solution in the EP tube at 1, 2, 4, 8, 12, 24, 48 hours, centrifuging at 16000 rpm for 10 minutes, the absorbance A was measured by ultraviolet spectrum and fluorescence spectrum, respectively, and the absorbance of the nanoparticles not released was A0, and the cumulative release rate= (1-A/A0). Times.100. FIG. 7 is a graph showing the release profile of rutin and miR-124 under different conditions of RDMR. The result shows that RDMR has certain acid sensitivity; compared with the pH 7.4PBS, the release rate of the pH 6.0PBS is faster and the release efficiency within 48 hours reaches 60%, which shows that the RDMR is effectively released at the lesion site of the AD. Whereas the cumulative release efficiency in pH 7.4PBS for 48h was less than 25%, which also demonstrates good stability of RDMR under normal physiological conditions.
Stability determination:
DFs and RDMR were placed in PBS and DMEM complete medium containing 10% Fetal Bovine Serum (FBS), respectively, at 37℃and the particle sizes of both were determined at different time points. FIG. 6 shows the particle size change of DFs and RDMR incubated with PBS and DMEM (10% FBS) for 24h at room temperature. As can be seen from the figure: DFs and RDMR particle sizes were not significantly varied, indicating high stability of DFs and RDMR.
The permeation of the gene/small molecule compound nano drug delivery system to the BBB is examined, and the specific steps are as follows:
(1) Preparation: referring to the procedure in examples 1 and 2 above, FAM-labeled free miR-124 solutions, RDM and RDMR were prepared and diluted to 400nM (in RDMR) of sample solution with DMEM medium (without FBS).
(2) Establishing an in vitro BBB model: taking logarithmic growth HBMEC cells (human brain microvascular endothelial cells, given from the release army 921 hospital), performing digestion count, and obtaining a proper amount of DMEM complete mediumDiluted to 2X 10 5 cell suspensions of cells/mL, 1mL per well, were inoculated into a 12 well transwell upper chamber, and an in vitro BBB model was established. During this time, the transmembrane resistance values of the upper and lower chambers were measured by TEER transmembrane cytoresimetry (WPI EVOM 2).
(3) BBB permeation efficiency evaluation: and (3) respectively adding the sample solution prepared in the step (1) into the upper chamber of the transwell chamber, culturing for 4 hours in a carbon dioxide incubator, taking down the chamber solution, centrifuging, measuring the fluorescence intensity of FAM in the supernatant by using an enzyme-labeling instrument, and calculating the permeation efficiency of the BBB. Each experiment was repeated three times.
(4) Primary validation of BBB permeation mechanism: the medium of one well of the transwell chamber was pipetted off, washed 2 times with PBS, then added with 500. Mu.L of RVG29 solution (pre-saturated. Alpha.7 nAChR receptor) at a concentration of 10mg/ml for 2h in a carbon dioxide incubator, added with the RDMR sample solution prepared in step (3), incubated in the carbon dioxide incubator for 4h, centrifuged in the chamber solution removed, and the fluorescence intensity of FAM in the supernatant was measured by a microplate reader and the permeation efficiency of BBB was calculated. Each experiment was repeated three times.
As a result, as shown in FIG. 8, an in vitro BBB model was established according to FIG. 8A, and after 7 days of culture, an in vitro BBB was established according to FIG. 8B, and as shown in FIG. 8C, FAM-RDM and FAM-RDMR were added to the transwell upper chamber and incubated with HBMEC cells for 4 hours, fluorescence of FAM was detected in the lower chamber, and fluorescence of RDMR was strongest. BBB efficiency was significantly reduced when HBMEC cells and RVG29 were pre-incubated for 2h. BBB penetration of RDMR was demonstrated to be effected by RVG29. Only weak fluorescence was detected by free FAM-miR-124 in the lower chamber.
The targeted uptake of the gene/small molecule compound nano drug delivery system to nerve cells is examined, and the specific steps are as follows:
(1) Preparation: referring to the procedure in examples 1 and 2 above, FAM-labeled free miR-124 solutions, RDM and RDMR were prepared and diluted to 400nM (in RDMR) of sample solution with DMEM medium (without FBS).
(2) Cell preparation: taking logarithmic growth SH-SY5Y cells (human neuroblastoma cells, given from the release army 921 hospital), performing digestion count, diluting a proper amount of DMEM complete medium to 2×10 5 cell suspensions of cells/mL, 2 mL/well inoculated at 24-well plate, and culturing for 24h.
(3) Targeted uptake evaluation: and (3) respectively adding the sample solution prepared in the step (1) into the SH-SY5Y cells cultured in the step (2), and performing fluorescence imaging acquisition after culturing for 4 hours in a carbon dioxide incubator.
(4) Fluorescence imaging acquisition: 1mL of paraformaldehyde is added to each well, the mixture is fixed for 20min at room temperature in a dark place, the supernatant is sucked and discarded, and PBS is used for washing three times. 0.5mL of 1. Mu.g/mL DAPI was added to each well, nuclei were stained at room temperature in the dark for 15min, supernatant was aspirated, washed 3 times with PBS, and image was collected by fluorescence microscopy and quantified by image J. Each experiment was repeated three times.
(5) Preliminary verification of targeted uptake mechanism: the medium of one well of SH-SY5Y cells cultured in the step (1) was aspirated, washed 2 times with PBS, then added with 500. Mu.L of RVG29 solution (pre-saturated. Alpha.7 nAChR receptor) at a concentration of 10mg/ml, cultured for 2 hours in a carbon dioxide incubator, added with the RDMR sample solution prepared in the step (3), cultured for 4 hours in a carbon dioxide incubator, and then aspirated and removed, and fluorescence image acquisition was performed according to the method of the step (4). Each experiment was repeated three times.
FIG. 9 is a targeted uptake of nanoformulations by SH-SY5Y cells. FIG. 9A is a fluorescence imaging of RDMR after incubation with SH-SY5Y cells. Scale = 50 μm. FIG. 9B is a quantitative analysis of 9A. As can be seen from the figure: the nano preparation is incubated with SH-SY5Y cells for 4 hours, and obvious green fluorescence is visible in the cells under a fluorescence microscope, which indicates that the nano particles are taken up by the cells, wherein the fluorescence of the RDMR holes is stronger than that of the RDM holes. However, after 2h pretreatment of free RVG29, its green color is significantly reduced. The results demonstrate that RVG29 has an important role in enhancing neuronal uptake by RDMR.
The in vitro safety evaluation of the gene/small molecule compound nanometer drug delivery system is examined, and the specific steps are as follows:
(1) Preparation: with reference to the procedure in examples 1 and 2 above, DFs, free rutin, free miR-124 and RDMR were prepared and diluted with DMEM medium (without FBS) to give sample solutions diluted to a series of concentration gradients (0, 50, 100, 200, 400, 800nM, respectively, in RDMR).
(2) Cell preparation: logarithmic growth of HBMEC cells, SH-SY5Y APPswe cells, and SVG P10 cells was performed by diluting them with DMEM medium containing 10% fetal bovine serum to a cell suspension density of 5X 104cells/mL, and in particular, SH-SY5 YAPPswee cells were diluted with F12/DMEM medium containing 10% fetal bovine serum to a cell suspension density of 5X 104cells/mL, and 100. Mu.L per well was inoculated into 96-well plates. After culturing in a carbon dioxide incubator for 24 hours, the culture solution was removed and washed 3 times with PBS.
(3) In vitro safety evaluation: and (3) respectively adding the sample solution prepared in the step (1) into the different types of cells cultured in the step (2), and after culturing for 24 hours in a carbon dioxide incubator, rinsing with PBS for 3 times. 10 μLMTT solution (5 mg/mL) was added to each well and incubation was continued for 4h before the incubation was terminated. The supernatant was aspirated off. 150 μl of DMSO solution was added to each well, and the mixture was shaken on a shaking table at low speed for 10min to dissolve the crystals completely, and the absorbance (OD) at 490nm was measured with an ELISA reader.
FIG. 10 shows the results of cell viability of DFs, free rutin, free miR-124 and RDMR with different cells incubated for 24h. FIG. 10A shows HBMEC cells, FIG. 10B shows SH-SY5Y cells, FIG. 10C shows SH-SY5YAPPswe cells, and FIG. 10D shows SVG P10 cells. As can be seen from FIG. 10, with increasing dose (from 0-800nM, in RDMR), the cell viability of DFs and RDMR of the present invention did not significantly decrease, demonstrating DFs and RDMR are safe, non-toxic, and in vivo experimental related evaluations were performed.
The inhibition effect of a gene/small molecule compound nano drug delivery system on a BACE1 gene is examined, and the specific steps are as follows:
(1) Preparation: with reference to the procedure in examples 1 and 2 above, DF-RVG29 (DR), RDR, DMR and RDMR were prepared and diluted to 400nM (in RDMR) of sample solution with DMEM medium (without FBS).
(2) Cell preparation: taking logarithmic growth SH-SY5YAPPswe cells, performing digestion count, and diluting the appropriate amount of DMEM complete medium to 2×10 5 cell suspensions of cells/mL were inoculated in 6-well plates at 2mL per well and cultured for 24h by adherence.
(3) Preparation treatment: the sample solution prepared in the step (1) is added into SH-SY5YAPPswe cells cultured in the step (2) respectively, and after the cells are cultured for 24 hours in a carbon dioxide incubator, PBS is used for rinsing 3 times.
(4) Protein sample preparation: lysing the SH-SY5Y APPswe cells treated in the step (3) by using a protein lysate, collecting a protein sample in the cells, and determining the protein concentration of the protein sample by using a BCA kit. An appropriate amount of concentrated SDS-PAGE protein loading buffer was added to the collected protein samples and heated at 100℃or in a boiling water bath for 3-5 minutes to substantially denature the proteins.
(5) western blot experiment: 1) And (5) preparing glue. 10% SDS-PAGE gel was prepared according to the instructions; 2) Loading and electrophoresis. Protein samples were directly loaded into SDS-PAGE gel loading wells for electrophoresis, and bromophenol blue stopped electrophoresis near the bottom end of the gel. 3) And (5) transferring films. PVDF membrane was selected for transfer, and a standard wet transfer apparatus of Bio-Rad was used. 4) And (5) sealing. Adding 5% skimmed milk, and sealing at room temperature for 1 hr. 5) Applying an anti-cancer agent. The blocking solution was blotted off, diluted primary antibody was added and incubated overnight at room temperature. 6) And (5) washing. Recovering primary antibody, adding western washing liquid, and washing at room temperature for 3 times and 10 min/time. 7) And (5) applying a secondary antibody. Horseradish peroxidase (HRP) labeled secondary antibodies were diluted with a western secondary antibody dilution in the appropriate ratio. The washing liquid is sucked out, diluted secondary antibody is added, and the mixture is incubated for 2 hours at room temperature. 8) And (5) washing. Adding a western washing solution, and washing for 3 times at room temperature for 10 min/time. 9) And (5) developing. Development was performed using ECL luminescence liquid such as Beyo ECLPlus (P0018).
FIG. 11 shows the protein expression of BACE1 in SH-SY5YAPPswe cells. FIG. 11A is a BACE1 Western blot 24h after PBS, DR, RDR, DMR and RDMR treatments. FIG. 11B is a quantitative analysis of FIG. 11A. It can be seen from the figure that the RDMR group exhibited the strongest inhibition of BACE1 protein expression. The expression of BACE1 in the RDR and DMR groups is reduced to a certain extent, but is lower than that in the RDMR groups, which shows that rutin and miR-124 have a synergistic effect in reducing the expression of BACE 1. The results show that the gene/small molecule compound nano drug delivery system can inhibit BACE1 gene expression.
The in vivo distribution research of the gene/small molecule compound nano drug delivery system is examined, and the specific steps are as follows:
(1) Preparation: referring to the procedure in examples 1 and 2 above, solutions of cy5.5 labeled free miR-124, RDM and RDMR were prepared.
(2) Animal preparation: the nanoparticles prepared in step (1) above were tail-intravenously injected into female BALB/c nude mice (18.+ -.2 g, available from Hunan Stokes Lemonda laboratory animal Co., ltd.) in a single dose (equivalent to 1mg/kg of Cy5.5).
(3) RDMR in vivo distribution: the mice were anesthetized 1h,2h,4h, 8h,12h and 24h after the injection in step (2), and were subjected to fluorescence imaging acquisition by an IVIS luminea III imaging system. And at the time point of highest fluorescence (12 h after injection), the major organs (heart, liver, spleen, lung, kidney, brain) were isolated and image acquisition was performed by IVIS luminea III imaging system.
(4) Targeted uptake of RDMR by brain slices (co-localization with RVG29 target α7 nachrs): taking fetal mouse brain slices, adding the preparation prepared in the step (1), incubating for 6 hours at 37 ℃, co-locating with RVG29 target alpha 7nAChR through immunofluorescence, and collecting fluorescence images.
(5) Preliminary verification of brain slice targeted uptake mechanism: pre-incubating brain slices with free RVG29 for 2 hours, then adding the Cy5.5-RDMR prepared in the step (1) for 6 hours, co-locating with the RVG29 target alpha 7nAChR through immunofluorescence, and collecting fluorescent images.
Fig. 12 is a study of the in vivo distribution of a drug. The mouse tail was intravenously injected with PBS, free Cy5.5-miR-124, cy5.5-RDM and Cy5.5-RDMR, respectively, and fluorescence images were collected at different time points. FIG. 12A is a graph showing in vivo fluorescence profiles of mice 1h,2h,4h, 8h,12h and 24h after tail vein injection; FIG. 12B is a plot of fluorescence profiles of the mice sacrificed after 12h of injection, separated centrifugation, liver, spleen, lung, kidney and brain. FIG. 12C depicts a fluorescence co-localization map of Cy5.5 and RVG29 target α7nAChR after pretreatment of the mouse brain slice with free Cy5.5-miR-124, cy5.5-RDM, cy5.5-RDMR and RVG29 for 2h and further treatment with Cy5.5-RDMR for 6h, respectively.
As shown in FIG. 12A, cy5.5-RDMR accumulated most strongly in the brain when injected for 12h in the tail vein. As shown in fig. 12B, in vitro organs, the fluorescence of the nanoparticle-injected mice was mainly at the liver and kidney sites. In brain tissue, the Cy5.5-RDMR group showed the strongest fluorescent accumulation compared to the free Cy5.5-miR-124 solution and Cy5.5-RDM. FIG. 12C shows that co-localization with α7nAChR (green) shows that Cy5.5-RDMR (red) shows the strongest fluorescence overlap. The gene/micromolecular compound nano drug delivery system of the invention shows that RVG29 has brain targeting.
The method for examining the gene/small molecule compound nano drug delivery system to improve pathological symptoms of APP/PS1 mice comprises the following specific steps:
(1) Preparation: RDR, DMR and RDMR were prepared according to example (1) and example (2) and concentrated to a sample solution of 1.5. Mu.M in RDMR, PBS solution as a control.
(2) Animal preparation: male APP/PS1 mice at 5 months of age were purchased from Fukang biotechnology Co., ltd., beijing, randomly grouped, 4-8 per group. Male C57 mice (WT) at 5 months of age served as normal controls.
(2) Mice were dosed: the solution prepared in step (1) was injected into APP/PS1 mice grouped in step (2) by tail vein while the WT group was given an equal volume of PBS injection. Once every 5 days, 6 times after the administration, the mice were anesthetized and sacrificed. Centrifugation, liver, spleen, lung, kidney and brain were performed, and peripheral blood was collected.
(3) Hippocampal miR-124 content assay: after the procedure according to step (2), hippocampus was isolated from brain tissue, total microRNAs were extracted by microRNA extraction kit, reverse transcribed by reverse transcription kit, amplified by qPCR, and analyzed relatively quantitatively.
(3) Long-term potentiation (LTP): placing the brain tissue in the step (2) in artificial cerebrospinal fluid in an ice bath in advance, continuously supplying oxygen during the period, maintaining the activity of the brain tissue, and setting the slice thickness of a brain slice to be 300 mu m. The LTPs of the hippocampus of the different groups of brain slices were recorded and analyzed relatively quantitatively by administration of electrical stimulation.
(4) Aβ immunohistochemistry: the brain tissue in the above step (2) was washed with physiological saline, and the filter paper was blotted to dry the water, and 4% paraformaldehyde was fixed for 24 hours. Tissue embedding, frozen sections, aβ immunohistochemical staining, and changes in plaque size and number were observed with an optical microscope, and quantitative analysis was performed.
(5) Hippocampal BACE1 gene expression: after the operation according to the step (2), separating hippocampus from brain tissue, adding protein lysate for cleavage, collecting protein sample, and determining protein concentration of protein sample by BCA kit. Protein denaturation, loading, electrophoresis, transfer, blocking, primary and secondary incubation were performed as in example 6. The protein bands were visualized and quantitatively analyzed.
(6) Neuroinflammatory response: 1) Percent Ibal positive area: washing the brain tissue in the step (2) by using normal saline, sucking the water by using filter paper, and fixing 4% paraformaldehyde for 24 hours. Tissue embedding, frozen section and Iba1 immunohistochemical staining are carried out, the change condition of the area size and the number of the positive glial cells is observed by using an optical microscope, and quantitative analysis is carried out; 2) Detection of neuroinflammation markers: the mRNA levels of IL-6, IL-1. Beta. And TNF-alpha were mainly detected. After the procedure according to step (2), hippocampus was isolated from brain tissue, trizol was added to extract total RNA, transcribed into cDNA by reverse transcription kit, gene amplification was performed by qPCR, and relative quantitative analysis was performed.
FIG. 13 shows the improvement of AD pathology in APP/PS1 mice by RDMR. Fig. 13A is a schedule of animal experiments. FIG. 13B is mRNA level of hippocampal miR-124. FIGS. 13C-13E are changes in hippocampal LTP. FIGS. 13F-13H show changes in hippocampal Abeta. FIGS. 13I-13L are changes in neuroinflammatory markers (Iba 1 positive area, mRNA levels of IL-6, IL-1. Beta. And TNF-. Alpha.). Data are expressed as mean ± standard deviation, P <0.05, P <0.01, P <0.001.
As can be seen from the figure: compared with the WT-PBS group, the level of the sea horse miR-124 in the AD-PBS group is obviously reduced, LTP is obviously damaged, abeta plaque, BACE1mRNA and protein are up-regulated, and a neuroinflammation marker is increased. These symptoms were significantly improved after RDMR treatment. These data show that RDMR treatment can effectively increase the level of miR-124 in hippocampus, alleviate pathological changes of AD and delay AD progression. The RDMR group has a significantly better therapeutic effect than the RDR group or the DMR group in improving LTP damage, reducing Abeta deposition and relieving neuroinflammation.
And (3) examining in-vivo safety evaluation of a gene/small molecule compound nano drug delivery system:
(1) Preparation of mice: mice were treated as in example 8, and five groups of mice were sacrificed after 6 doses.
(2) The mice treated in the step (1) are taken out, main organs (heart, liver, spleen, lung and kidney) are washed by normal saline, filter paper is used for absorbing water, and 4% paraformaldehyde is fixed for 24 hours. Tissue was paraffin embedded, sectioned, H & E stained and observed for pathological changes using an optical microscope.
FIG. 14 is a graph showing the analysis of heart, liver, spleen, lung, kidney, pathological sections of each group of mice. Scale = 100 μm. In contrast to the WT-PBS group, there was no apparent pathological change in each of the other four groups. The RDMR has good safety in vivo.
The above embodiments are only preferred embodiments of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art should be able to apply equivalents and modifications according to the technical solution and the concept of the present invention within the scope of the present invention.
Sequence listing
<110> Xiangya three Hospital at university of south China
<120> a gene/small molecule compound nano drug delivery system, and preparation method and application thereof
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 98
<212> DNA
<213> Artificial Sequence
<400> 1
tatcgtacag attgacgacg cggcggccct tgatatgccg cagcagcatc taaccgtaca 60
gtatttgctg ctgcagcgat acgcgtatcg ctatggca 98
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 2
attgacgacg cggcggccct t 21
<210> 3
<211> 22
<212> RNA
<213> Artificial Sequence
<400> 3
uaaggcacgc ggugaaugcc aa 22
<210> 4
<211> 43
<212> DNA/RNA
<213> Artificial Sequence
<400> 4
cguguucaca gcggaccuug auacgatcta accgtacagt att 43
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 5
ctgtacgata tgccatagcg 20

Claims (7)

1. A gene/small molecule compound nano drug delivery system, which is characterized by comprising a DNA nanoflower carrier, rutin, miR-124 chimera and a DNA-targeting ligand; the rutin and the DNA nanoflower carrier are loaded through pi-pi stacking, and the miR-124 chimera, the DNA-targeting ligand and the DNA nanoflower carrier are loaded through DNA molecular hybridization reaction;
the DNA nanoflower carrier is prepared by taking a sequence shown as SEQ ID NO. 1 as a template through RCA reaction;
the miR-124 chimera is obtained through annealing hybridization reaction of miR-124 reaction chain and miR-124 long-chain complementary chain;
the DNA-targeting ligand is obtained by taking a sequence shown as SEQ ID NO. 2 as a template chain, and carrying out addition reaction on the modified DNA-targeting ligand and a targeting ligand with a side chain containing a sulfhydryl group after MAL modification;
the targeting ligand is a ligand capable of penetrating the blood brain barrier, and specifically comprises the following components:
any one of a neurotropic virus-derived peptide, brain targeting nucleic acid aptamer, angiopep2, cell penetrating peptide, D peptide, or T7 peptide;
the molar concentration ratio of the DNA nanoflower carrier to rutin to miR-124 chimera is 1:480:14; the concentration of the DNA nanoflower carrier is 0.1 mu M-3 mu M, the concentration of rutin is 48 mu M-1440 mu M, and the concentration of miR-124 chimera is 1.4 mu M-28 mu M;
the concentration of the targeting ligand is 0.1 mg/mL-0.9 mg/mL.
2. A method for preparing a gene/small molecule compound nano drug delivery system as defined in claim 1, comprising the steps of:
s1, mixing a miR-124 reaction chain and a miR-124 long-chain complementary chain in a buffer solution, annealing and hybridizing to obtain a miR-124 chimeric body;
s2: mixing a DNA chain with a sequence shown as SEQ ID NO. 2 and a 5' -modified maleimide group with a targeting ligand solution, and incubating to obtain a DNA-targeting ligand;
s3, mixing a DNA template chain with a sequence shown as SEQ ID NO. 1, a primer and a reaction buffer solution, performing vortex annealing, adding a T4DNA ligase to connect to obtain annular DNA, dripping BSA, dNTPs, DNA polymerase and the buffer solution into the annular DNA under the ice bath condition, and performing RCA reaction to obtain the DNA nanoflower;
s4, preparing rutin into a solution, dripping the DNA nanoflower, and incubating overnight at room temperature to obtain Rutin@DFs;
s5, mixing the Rutin@DFs, the miR-124 chimeric body and the DNA-targeting ligand, and incubating to obtain the gene/small molecule compound nano drug delivery system.
3. The method for preparing the gene/small molecule compound nano drug delivery system according to claim 2, wherein the sequences of the miR-124 reaction chain and the miR-124 long-chain complementary chain in the step S1 are shown as SEQ ID NO. 3 and SEQ ID NO. 4.
4. The method for preparing a gene/small molecule compound nano drug delivery system according to claim 2, wherein the deoxynucleotide sequence of the primer in the step S3 is shown as SEQ ID NO. 5.
5. Use of the gene/small molecule compound nano drug delivery system of claim 1 or the gene/small molecule compound nano drug delivery system obtained by any one of the preparation methods of claims 2-4 in the preparation of a medicament for treating neurodegenerative diseases.
6. Use of the gene/small molecule compound nano drug delivery system of claim 1 or the gene/small molecule compound nano drug delivery system obtained by any one of the preparation methods of claims 2-4 in the preparation of a targeted therapeutic drug for alzheimer's disease.
7. The targeted drug for treating the Alzheimer disease is characterized by comprising an external preparation, an oral preparation or an injection preparation of the gene/small molecule compound nano drug delivery system obtained by the gene/small molecule compound nano drug delivery system according to claim 1 or the preparation method according to any one of claims 2 to 4.
CN202111248086.6A 2021-10-26 2021-10-26 Gene/small molecule compound nano drug delivery system and preparation method and application thereof Active CN113975397B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111248086.6A CN113975397B (en) 2021-10-26 2021-10-26 Gene/small molecule compound nano drug delivery system and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111248086.6A CN113975397B (en) 2021-10-26 2021-10-26 Gene/small molecule compound nano drug delivery system and preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN113975397A CN113975397A (en) 2022-01-28
CN113975397B true CN113975397B (en) 2023-08-22

Family

ID=79741661

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111248086.6A Active CN113975397B (en) 2021-10-26 2021-10-26 Gene/small molecule compound nano drug delivery system and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN113975397B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113897397B (en) * 2021-09-30 2024-04-02 中南大学 DNAzyme-based gene editing regulation and control method
CN115813860A (en) * 2022-12-10 2023-03-21 郑州大学 Preparation method and application of subminiature programmable pure nucleic acid nanoparticles

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106754894A (en) * 2017-02-28 2017-05-31 临沂大学 A kind of multifunction magnetic DNA nanospheres and preparation method and application
CN112587670A (en) * 2021-03-02 2021-04-02 中国农业大学 Preparation method of DNA nanoflower medicine for targeted regulation and control of browning of white fat

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2015502365A (en) * 2011-12-12 2015-01-22 オンコイミューニン，インコーポレイティド In vivo delivery of oligonucleotides
WO2018187240A1 (en) * 2017-04-03 2018-10-11 The Regents Of The University Of California Deformable nano-scale vehicles (dnvs) for trans-blood brain barrier, trans-mucosal, and transdermal drug delivery

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106754894A (en) * 2017-02-28 2017-05-31 临沂大学 A kind of multifunction magnetic DNA nanospheres and preparation method and application
CN112587670A (en) * 2021-03-02 2021-04-02 中国农业大学 Preparation method of DNA nanoflower medicine for targeted regulation and control of browning of white fat

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
基于miRNA特异响应的Cas9/sgRNA纳米递送系统用于细胞质蛋白直接递送和增强基因编辑的研究;杨雪;《中国优秀硕士学位论文全文数据库（工程科技Ⅰ辑）》(第2期) *

Also Published As

Publication number Publication date
CN113975397A (en) 2022-01-28

Similar Documents

Publication Publication Date Title
Sun et al. HIF-1α overexpression in mesenchymal stem cell-derived exosomes mediates cardioprotection in myocardial infarction by enhanced angiogenesis
CN113975397B (en) Gene/small molecule compound nano drug delivery system and preparation method and application thereof
Ren et al. Effect of exosomes derived from MiR-133bmodified ADSCs on the recovery of neurological function after SCI.
Fu et al. Therapeutic siCCR2 loaded by tetrahedral framework DNA nanorobotics in therapy for intracranial hemorrhage
AU2011271830B2 (en) Microvesicles derived from cell protoplast, and use thereof
Yue et al. Ultrasound-triggered effects of the microbubbles coupled to GDNF plasmid-loaded PEGylated liposomes in a rat model of Parkinson's disease
Peng et al. Microglia-derived exosomes improve spinal cord functional recovery after injury via inhibiting oxidative stress and promoting the survival and function of endothelia cells
CN110511267B (en) Anti-obesity polypeptide, composition and application thereof, and medicine for treating obesity
Liu et al. Extracellular vesicles derived from M2 microglia reduce ischemic brain injury through microRNA-135a-5p/TXNIP/NLRP3 axis
Hercher et al. Extracellular vesicles and their role in peripheral nerve regeneration
JP2019519515A (en) Methods of treating or preventing Alzheimer&#39;s disease and diseases associated with Alzheimer&#39;s disease
Song et al. Biocompatible PEGylated Gold nanorods function As cytokinesis inhibitors to suppress angiogenesis
Sela et al. Brain‐Targeted Liposomes Loaded with Monoclonal Antibodies Reduce Alpha‐Synuclein Aggregation and Improve Behavioral Symptoms in Parkinson's Disease
CN109876156B (en) Folic acid modified liposome compound and preparation method and application thereof
Zhou et al. Genetic deficiency of MicroRNA‐15a/16‐1 confers resistance to neuropathological damage and cognitive dysfunction in experimental vascular cognitive impairment and dementia
US20230330136A1 (en) Blood-brain barrier-penetrating nanotheranostics for acute and chronic neurodegenerative diseases and the like
Huang et al. Immunomodulation of MiRNA-223-based nanoplatform for targeted therapy in retinopathy of prematurity
CN103773771A (en) Transcription factor system as well as preparation method and application thereof
CN116869962A (en) Preparation method and application of bionic nano-enzyme for treating Alzheimer&#39;s disease
Wang et al. CCR2 improves homing and engraftment of adipose-derived stem cells in dystrophic mice
US20230159935A1 (en) CIRCULAR BIFUNCTIONAL APTAMERS AND TRIFUNCTIONAL APTAMERS TARGETING Tau
CN109771667A (en) The purposes of Spy1 gene and its expression albumen in treatment amyotrophic lateral sclerosis
Su et al. MicroRNA-195 liposomes for therapy of Alzheimer's disease
Liu et al. MALAT1 improves functional recovery after traumatic brain injury through promoting angiogenesis in experimental mice
CN111686124A (en) Application of miR-486-3p in preparation of product for treating neuroinflammation caused by SAH (neuroinflammation)

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant