CN113975397A - Gene/small molecule compound nano drug delivery system and preparation method and application thereof - Google Patents
Gene/small molecule compound nano drug delivery system and preparation method and application thereof Download PDFInfo
- Publication number
- CN113975397A CN113975397A CN202111248086.6A CN202111248086A CN113975397A CN 113975397 A CN113975397 A CN 113975397A CN 202111248086 A CN202111248086 A CN 202111248086A CN 113975397 A CN113975397 A CN 113975397A
- Authority
- CN
- China
- Prior art keywords
- dna
- mir
- delivery system
- drug delivery
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7048—Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin, digitoxin or digoxin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
- A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0014—Skin, i.e. galenical aspects of topical compositions
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0053—Mouth and digestive tract, i.e. intraoral and peroral administration
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B82—NANOTECHNOLOGY
- B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
- B82Y30/00—Nanotechnology for materials or surface science, e.g. nanocomposites
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B82—NANOTECHNOLOGY
- B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
- B82Y40/00—Manufacture or treatment of nanostructures
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B82—NANOTECHNOLOGY
- B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
- B82Y5/00—Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Nanotechnology (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Neurology (AREA)
- Biochemistry (AREA)
- General Physics & Mathematics (AREA)
- Condensed Matter Physics & Semiconductors (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Neurosurgery (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Dermatology (AREA)
- General Chemical & Material Sciences (AREA)
- Medical Informatics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Composite Materials (AREA)
- Physiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Materials Engineering (AREA)
- Manufacturing & Machinery (AREA)
- Psychiatry (AREA)
Abstract
The invention relates to the technical field of biological medicines, in particular to a gene/small molecular compound nano drug delivery system and a preparation method and application thereof. The drug delivery system comprises a DNA nanoflower carrier, rutin, a miR-124 chimera and a DNA-targeting ligand; rutin and the DNA nanoflower carrier are loaded through pi-pi stacking, and the miR-124 chimera, the DNA-targeting ligand and the DNA nanoflower carrier are loaded through DNA molecular hybridization reaction. The drug delivery system can relieve the long-term enhancement injury of APP/PS1 mice, reduce the number of hippocampal amyloid plaques, reduce the levels of BACE1mRNA and protein, relieve neuroinflammatory reaction and delay the occurrence and progress of Alzheimer disease, and can be applied to the preparation of targeted therapeutic drugs for AD.
Description
Technical Field
The invention relates to the technical field of biological medicines, in particular to a gene/small molecular compound nano drug delivery system and a preparation method and application thereof.
Background
Alzheimer's Disease (AD) is a typical irreversible neurodegenerative disease associated with extracellular amyloid- β (Α β) deposition and intracellular accumulation of hyperphosphorylated Tau (p-Tau). Currently, the main clinical therapeutic approaches include cholinesterase inhibitors (donepezil and the like) and N-aspartate receptor antagonists (memantine), but they only delay the onset of disease and do not prevent the onset of disease. There is currently no effective treatment for the disease. In addition, many formulations directed against a β and p-Tau failed to demonstrate any efficacy in slowing or improving overall function in phase 3 clinical trials. Therefore, there is an urgent need to develop new disease modification therapies for a β and p-Tau.
In recent years, microRNAs (miRNAs) drugs have been widely used in disease diagnosis and treatment. Among them, miR-124 shows a great medicinal potential in Alzheimer's disease. miR-124 is specifically expressed in the brain, and meanwhile, miR-124 is found to be remarkably reduced in the brain of an Alzheimer disease patient. miR-124 can regulate the expression of various genes (such as BACE1, Caveolin-1, GSK-3 beta, 9PTPN1, DACT1 and the like) by binding with mRNA, thereby influencing synaptic plasticity, neuroinflammation, A beta production and Tau protein phosphorylation. A plurality of researches also prove that virus-mediated miR-124 overexpression can inhibit the generation of beta-amyloid of APP/PS1 transgenic mice and relieve cognitive defects of the mice. In addition, the miR-124 nanoparticles can be injected intracerebroventricularly or delivered intranasally to inhibit neuroinflammation and relieve acute brain injury. However, it is unclear whether exogenous delivery of miR-124 can block or slow AD progression. Can be combined with small molecular drug rutin to further improve AD pathological condition.
However, the application of miRNA is limited by the electronegativity of miRNA and the characteristic of easy enzymolysis in vivo, so the development of a high-efficiency, low-toxicity and low-price drug delivery system is the primary problem to be solved when miR-124 is used for AD treatment. In addition, most AD drugs have the problems of low blood brain barrier permeation efficiency and in-vivo non-selective distribution, so that the construction of an active targeting drug delivery system has certain clinical practice significance.
Disclosure of Invention
In order to solve the above problems, the present invention aims to provide a nano drug delivery system which can achieve high-efficiency blood brain barrier penetration and target recognition of nerve cells, reduce the long-term potentiation (LTP) injury of APP/PS1 mice, reduce the number of hippocampal Α β plaques, reduce BACE1mRNA and protein levels, alleviate neuroinflammatory response, and finally improve cognitive dysfunction; can be applied to the preparation of the AD treatment targeted therapy medicine.
Aiming at the aim, the embodiment of the invention provides a gene/small molecular compound nano drug delivery system, which comprises a DNA nano flower carrier, rutin, a miR-124 chimera and a DNA-targeting ligand; the rutin and the DNA nanoflower carrier are loaded through pi-pi stacking, and the miR-124 chimera, the DNA-targeting ligand and the DNA nanoflower carrier are loaded through DNA molecular hybridization reaction;
the DNA nanoflower vector is prepared by taking a sequence shown as SEQ ID NO. 1 as a template through RCA reaction;
the miR-124 chimera is obtained through annealing hybridization reaction of a miR-124 reaction chain and a miR-124 long-chain complementary chain;
the DNA-targeting ligand is obtained by taking a sequence shown as SEQ ID NO. 2 as a template chain, modifying by MAL, and then carrying out addition reaction with a targeting ligand of which the side chain contains sulfydryl.
Further, the targeting ligand is a ligand capable of penetrating the blood brain barrier, and specifically comprises:
any one of a neurotropic virus-derived peptide, a brain-targeting aptamer, Angiopep2, a cell-penetrating peptide, a D peptide, or a T7 peptide.
Further, the molar concentration ratio of the DNA nanoflower carrier to the rutin to the miR-124 chimera is 1: 480: 14; the concentration of the DNA nanoflower carrier is 0.1-3 mu M, the concentration of rutin is 48-1440 mu M, and the concentration of the miR-124 chimera is 1.4-28 mu M.
Furthermore, the concentration of the targeting ligand is 0.1 mg/mL-0.9 mg/mL.
Based on the same inventive concept, the embodiment of the invention also provides a preparation method of the gene/small molecule compound nano drug delivery system, which specifically comprises the following steps:
s1, mixing, annealing and hybridizing the miR-124 reaction chain and the miR-124 long-chain complementary chain in a buffer solution to obtain a miR-124 chimera;
s2: 2 and 5' modified maleimide group DNA chain and targeting ligand solution are mixed, and DNA-targeting ligand is obtained after incubation;
s3, mixing a DNA template chain with a sequence shown as SEQ ID NO. 1, a primer and a reaction buffer solution, performing vortex annealing, adding T4DNA ligase to connect to obtain a circular DNA, and dripping BSA, dNTPs, DNA polymerase and the buffer solution into the circular DNA under an ice bath condition to perform RCA reaction to obtain DNA nanoflowers;
s4, preparing Rutin into a solution, dripping the solution into the DNA nanoflower, and incubating overnight at room temperature to obtain Rutin @ DFs;
s5, mixing Rutin @ DFs, miR-124 chimera and DNA-targeting ligand, and incubating to obtain the gene/small molecule compound nano drug delivery system.
Further, the nucleotide sequences of the miR-124 reaction chain and the miR-124 long-chain complementary chain in the step S1 are shown as SEQ ID NO. 3 and SEQ ID NO. 4.
Further, the deoxynucleotide sequence of the primer in the step S3 is shown as SEQ ID NO. 5.
Based on the same inventive concept, the embodiment of the invention also provides application of the gene/small molecule compound nano drug delivery system in preparation of drugs for treating neurodegenerative diseases.
Based on the same inventive concept, the embodiment of the invention also provides application of the gene/small molecule compound nano drug delivery system in preparation of targeted therapeutic drugs for Alzheimer's disease.
Based on the same inventive concept, the embodiment of the invention also provides a targeted therapeutic drug for the Alzheimer disease, and the drug is an external preparation, an oral preparation or an injection preparation containing the gene/small molecule compound nano drug delivery system.
Further, the external preparation is an external gel; the oral preparation is granules, tablets, oral solutions and the like containing the gene/small molecular compound nano drug delivery system; the injection is intravenous injection containing the gene/small molecule compound nano drug delivery system.
Has the advantages that:
(1) the gene/small molecule compound nano drug delivery system provided by the invention takes DNA nanoflower (DFs) as a carrier, and can control the particle size by controlling the time of Rolling Circle Amplification (RCA); the RCA template can be edited, the template can be designed to be multifunctional, the structure is compact, the template can be protected and protected from degradation, other toxic organic or inorganic substances are not contained, and potential toxic and side effects are reduced.
(2) The gene/small molecule compound nano drug delivery system provided by the invention is loaded and modified with a specific targeting ligand, such as neurotropic virus derived peptide (RVG29), so that nano delivery can be combined with a Blood Brain Barrier (BBB) and an alpha 7 nicotinic acetylcholine receptor (alpha 7nAChR) highly expressed on neurons, and the nano drug delivery system can pass through the BBB in a non-invasive manner under the action of the alpha 7nAChR, so that damages caused by other manners are avoided, and the gene/small molecule compound nano drug delivery system can be used for drug delivery through intravenous injection, and is more convenient and faster than the traditional mode of delivering drugs to brain diseases through a ventricular perfusion manner.
(3) According to the gene/small molecule compound nano drug delivery system provided by the invention, the DNA nanoflower carrier (DFs) is obtained through RCA reaction, the high-efficiency load of rutin, the miR-124 chimera and the targeting ligand RVG29 can be realized through pi-pi accumulation and hybridization, and the preparation process is simple and controllable.
(4) The invention provides an application of a gene/small molecule compound nano drug delivery system in preparation of Alzheimer disease drugs, which comprises the following steps: the nano drug delivery system can be targeted to neurons, can reduce the number of hippocampal Abeta plaques, reduce the levels of BACE1mRNA and protein, relieve neuroinflammatory response and finally delay the occurrence and the process of Alzheimer disease by relieving long-term potentiation (LTP) injury of APP/PS1 mice after tail vein injection, has no damage to heart, liver, spleen, lung, kidney and the like, and can be applied to the preparation of targeted therapeutic drugs for AD.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.
FIG. 1 is a gel electrophoresis image of DFs provided in example 1 of the present invention;
FIG. 2 is a graph showing the variation of particle size and potential of DFs, Rutin @ DF-miR-124(RDM) and Rutin @ DF-miR-124/RVG29(RDMR) provided by the embodiment of the present invention;
FIG. 3 is a scanning electron micrograph (A-C) and a transmission electron micrograph (D) of an RDMR provided by an embodiment of the present invention;
fig. 4 is an ultraviolet absorption spectrum of RDMR loaded with rutin provided in the embodiment of the present invention;
FIG. 5 is a graph of the fluorescence absorption spectrum of RDMR provided by an embodiment of the present invention; FIG. 5A is a fluorescence absorption spectrum of an RDMR captured miR-124 chimera, and FIG. 5B is a fluorescence absorption spectrum of RDMR connecting DNA-RVG 29;
FIG. 6 is a graph showing the release of rutin and miR-124 from RDMR under different conditions according to an embodiment of the invention;
FIG. 7 is a graph of particle size change of DFs and RDMR incubated in PBS, DMEM (10% FBS) for 24h, provided by an example of the present invention;
FIG. 8 is a block Blood Brain Barrier (BBB) permeation evaluation of RDMR provided in an embodiment of the present invention; FIG. 8A is a model diagram of a tandswell cell, FIG. 8B is a graph of the in vitro BBB transmembrane resistance TEER as a function of time, and FIG. 8C is a graph of the BBB permeation efficiency in the lower chamber measured after RDMR was added to the upper chamber;
FIG. 9 shows the targeted uptake of RDMR by SH-SY5Y cells provided by an embodiment of the present invention;
FIG. 10 shows the results of cell survival rates of DFs, free rutin, free miR-124 and RDMR incubated with different cells for 24h, which are provided by the embodiment of the invention; HBMEC cells (FIG. 10A), SH-SY5Y cells (FIG. 10B), SH-SY5YAPPswe cells (FIG. 10C), and SVG P10 cells (FIG. 10D);
FIG. 11 shows protein expression of BACE1 in SH-SY5YAPPswe cells provided by the present invention; FIG. 11A is a Western blot of BACE1 after 24h of PBS, DR, RDR, DMR, and RDMR treatment, FIG. 11B is a quantitative analysis of FIG. 11A;
FIG. 12 shows the distribution of RDMRs in vivo according to an embodiment of the present invention; FIG. 12A is the in vivo fluorescence profiles of PBS, free Cy5.5-miR-124, Cy5.5-RDM and Cy5.5-RDMR, FIG. 12B is the fluorescence profiles of Cy5.5-miR-124-NC, Cy5.5-RDM and Cy5.5-RDMR in ex vivo organs, FIG. 12C is the quantitative statistical chart of 12B, FIG. 12D is the fluorescence co-localization chart of PBS, free Cy5.5-miR-124, Cy5.5-RDM, Cy5.5-RDMR and RVG29 in brain tissue sections with the addition of RDMR groups after blocking.
FIG. 13 shows that RDMR provided by the present invention improves AD pathology in APP/PS1 mice; FIG. 13A is an animal experimental schedule, FIG. 13B is mRNA levels of hippocampal miR-124, FIGS. 13C-13E are changes in hippocampal LTP, FIGS. 13F-13H are changes in hippocampal Abeta, FIGS. 13I-13L are changes in neuroinflammatory markers (Iba1 positive area, mRNA levels of IL-6, IL-1 beta and TNF-alpha).
FIG. 14 is a graph of H & E staining of major organs (heart, liver, spleen, lung and kidney) of various groups of mice provided by an example of the present invention.
Detailed Description
In order to more clearly illustrate the technical content of the present invention, the detailed description is given herein with reference to specific examples and drawings, and it is obvious that the examples are only preferred embodiments of the technical solution, and other technical solutions that can be obviously derived by those skilled in the art from the technical content disclosed still belong to the protection scope of the present invention.
Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art; all reagents used in the examples are commercially available unless otherwise specified.
The percentage "%" referred to in the present invention means mass% unless otherwise specified; but the percentage of the solution, unless otherwise specified, refers to the grams of solute contained in 100ml of the solution.
The weight parts in the invention can be the weight units known in the art such as mu g, mg, g, kg, and the like, and can also be multiples thereof, such as 1/10, 1/100, 10, 100, and the like.
In the embodiment of the invention, the chemical reagents used are all analytical grade reagents, and are obtained by purchasing or preparing by an existing method.
In the following examples, details of the equipment and manufacturer used are given in Table 1:
TABLE 1 name of main instrument and manufacturer
In the following examples, the names of the main reagents and the manufacturers used are shown in Table 2:
TABLE 2 Main reagent names and manufacturers
Example 1
Preparation of DNA nanoflower (DFs) in gene/small molecule compound nano drug delivery system:
(1) preparation of cDNA: mu.L of 10. mu.M DNA template strand (T) (DNA template strand: phosphate-TATCGTACAGATTGACGACGCGGCGGCCCTTGATATGCCGCAGCAGCATCTAACCGTACAGTATTTGCTGCTGCAGCGATACGCGTATCGCTATGGCA) and 120. mu.L of 10. mu.M primer strand (P) (primer strand: CTGTACGATATGCCATAGCG) were put into a 1.5mL enzyme-free EP tube, 100. mu.L of 10X T4 ligation buffer (50mM Tris-HCl,10 mM MgCl 2, 10mM DTT, 1mM ATP) and 720. mu.L of ddH2O were added, vortexed gently, homogenized, heated at 95 ℃ for 5min, and slowly cooled to room temperature. The above mixed solution was added with 25. mu.L of T4DNA ligase at a concentration of 4000U/. mu.L, and ligated overnight at 16 ℃ to obtain circular DNA (cDNA).
(2) Preparation DFs: mu.L of the cDNA mixed solution of the above step (1) was taken, and 200. mu.L of dNTPs with a concentration of 10mM, 100. mu.L of BSA solution with a concentration of 10X, and 100. mu.L of Phi29 buffer (500mM Tris-HCl,100mM (NH)4)2SO4,40mM Dithiothreitol,100mM MgCl2pH 7.5), 100. mu.L Phi29 DNA polymerase at 100U/. mu.L, gently vortexed, mixed well, incubated at 30 ℃ for 3h, heated at 75 ℃ for 10min to give DFs. The reaction solution was centrifuged at 16000 rpm for 10min in ddH2After two O washes, the mixture was stored at 4 ℃ for further use.
Example 2
A gene/small molecule compound nano drug delivery system comprises DFs, rutin, miR-124 chimera and DNA-RVG 29. Rutin is embedded into DFs through pi-pi stacking, and miR-124 chimera and DNA-RVG29 are connected to DFs through DNA molecular hybridization reaction.
The preparation method comprises the following steps:
(1) preparing a miR-124 chimera: in ligation buffer (200mM N-2-Hydroxy-ethyl pi-perazine-N' -2-ethanesulfonic acid, pH 7.4,1.5M NaCl,20mM CaCl2) Adding 250 mu L of miR-124 reaction chain with the concentration of 30 mu M (the sequence of the miR-124 reaction chain is: FAMCy5.5-UAAGGCACGCGGUGAAUGCCAA) and 250 mu L of miR-124 long-chain complementary chain with the concentration of 45 mu M (the sequence of the miR-124 long-chain complementary chain is as follows: cguguucacagcggaccuugauacgatctaaccgtacagtatt) to 1.5mL enzyme-free EP tube, gently vortexed, mixed, transferred to a PCR instrument, and reacted according to the following procedure: reacting at 95 ℃ for 5 minutes, at 55 ℃ for 10 minutes and at 37 ℃ for 20 minutes, slowly cooling to room temperature, and storing at 4 ℃ for later use.
(2) Preparation of DNA-RVG 29: 10mg of RVG29 polypeptide was precisely weighed, dissolved in 1mL of PBS (Ph 8.0), gently vortexed, and mixed to prepare a 10mg/mL RVG29 stock solution. mu.L of a maleimide-modified DNA strand (the sequence of the DNA strand is ATTGACGACGCGGCGGCCCTT) (DNA-MAL) at a concentration of 15. mu.M was taken in a 1.5ml enzyme-free EP tube, and RVG29 solution was slowly dropped and incubated at room temperature for 8 hours to obtain DNA-RVG 29. After 2 days of ultrafiltration membrane purification, the membrane was stored at 4 ℃ until use.
(3) Preparing a rutin stock solution: precisely weighing 3mg of Rutin (Rutin), dissolving in 1mL of DMSO, and preparing into a Rutin solution of 3 mg/mL.
(4) Preparation of Rutin @ DFs: 1mL of DFs solution prepared in the step (1) is slowly dropped with 5. mu.L of Rutin solution with the concentration of 3mg/mL and incubated overnight at room temperature to obtain Rutin @ DFs (RD). The reaction solution was centrifuged at 16000 rpm for 10min in ddH2After two O washes, the mixture was stored at 4 ℃ for further use.
(5) Preparing Rutin @ DF-miR-124/RVG 29: and (3) adding 500 mu L of Rutin @ DFs into a 1.5mL enzyme-free EP tube, adding 100 mu L of the miR-124 chimera with the concentration of 15 mu M prepared in the step (2) and 100 mu L of DNA-RVG29 with the concentration of 15 mu M prepared in the step (3), and incubating for 3h at 30 ℃ to obtain Rutin @ DF-miR-124/RVG29 (RDMR). The reaction solution was centrifuged at 16000 rpm for 10min in ddH2After two O washes, the mixture was stored at 4 ℃ for further use.
(6) Preparation of other nano-formulations: specifically, with reference to the methods of the above-described steps (1) to (5), DF-RVG29(DR), Rutin @ DF-RVG29(RDR), Rutin @ DF-miR-124(RDM) and DF-miR-124/RVG29(DMR) were prepared, respectively.
RCA reaction verification:
respectively detecting the primer chain (P), the template chain (T), the circular DNA (cDNA), the DFs and the DNA marker by agarose gel electrophoresis, wherein the measuring method comprises the following steps: accurately weighing 25mg of agarose, adding the agarose into a 100ml conical flask, adding 100ml of ultrapure water, reversing and uniformly mixing, heating in a microwave oven for 2 minutes until the agarose is dissolved, standing for a few minutes at room temperature, cooling to 60 ℃, adding 1 mu L of Gel Red with the concentration of 1000X, uniformly mixing, introducing into a Gel preparation device, inserting into a comb, standing for about half an hour at room temperature, and waiting for the Gel to solidify. The electrophoresis tank was poured with 1 XTAE buffer until the gel was immersed. Loading: from left to right, P, T, cDNA, DFs and DNAmarker were sequentially added to each well at 10. mu.L. The electrophoresis voltage is set to be 80V, electrophoresis is carried out for 45 minutes, electrophoresis is stopped when the indicator line electrophoresis reaches about two thirds of the colloid, and imaging and photographing are carried out by using ultraviolet imaging equipment. The results are shown in FIG. 1, which shows that: DFs, the molecular weight of DFs increased due to the RCA reaction, at the top of the gel.
Particle size and potential measurements:
the particle size and the potential of the Rutin @ DF-miR-124(RDM) and the Rutin @ DF-miR-124/RVG29(RDMR) obtained in DFs and example 2 obtained in the embodiment 1 are measured by the following methods: a sample solution is placed in a Marlvenn Nano ZS instrument, the particle size is detected by adopting a dynamic light laser scattering method, the temperature of a measuring cell is set to be 25 ℃, and 3 parts of each sample are operated in parallel. The results are shown in FIG. 2, which shows that: the particle size of the DNA nanoflower carrier DFs is 181nm, the potential is-10.26 mV, and the particle size of the RDMR loaded with rutin, the miR-124 chimera and the RVG29 is increased to 229nm, and the potential is increased to-3.40 mV.
Morphological analysis:
and respectively observing the form of the RDMR by adopting a scanning electron microscope and a transmission electron microscope. The form detection method comprises the following steps: the sample is dripped on a 400-mesh copper net covered with a carbon film, placed in a dryer, naturally dried and then placed under a scanning electron microscope JSM-7500F and a transmission electron microscope Titan G2-F20 for observation. FIG. 3 shows scanning electron micrographs (A-C) and transmission electron micrographs (D) of RDMR, from which: the RDMR of the invention is a flower-like structure under a transmission electron microscope.
Ultraviolet spectrum analysis:
respectively carrying out ultraviolet spectrum scanning on DFs, free rutin and RDMR, and determining the method as follows: DFs is used as blank control solution, and free rutin and RDMR ultraviolet absorption spectrum are determined. The results are shown in FIG. 4, which shows that: pure DFs has no distinct absorption peak near 364nm, and free rutin and RDMR have plasmon resonance absorption peaks at about 364nm, demonstrating that rutin has been successfully encapsulated in DFs. In addition, the capacity of loading rutin by the RDMR can be quantified through ultraviolet absorption spectroscopy.
Fluorescence spectrum analysis:
fluorescence spectrum scans were performed on FAM-labeled miR-124 and rhodamine B-labeled RVG29 in RDMR, respectively. FIG. 5A is a graph of the fluorescence absorption spectrum of miR-124 in RDMRZ. From the figure, the RDMR has a FAM-miR-124 fluorescence characteristic absorption peak at 520nm, and pure DFs has no absorption near 520nm, which proves that miR-124 has been successfully connected with DFs. FIG. 5B is a graph showing the fluorescence absorption spectrum of RVG29 in RDMR. As can be seen from the figure, the RDMR has a fluorescence characteristic absorption peak of rhodamine B-RVG29 at 580nm, while the simple DFs has no absorption near 580nm, which proves that the RVG29 is modified on DFs. In addition, the ability of the RDMR to capture miR-124 and link RVG29 can be quantified by fluorescence absorption spectroscopy.
In vitro release behavior:
and (3) measuring the release efficiency of rutin and miR-124 by adopting a membraneless dissolution method. The detection method comprises the following steps: 1.0ml of RDMR was placed in 2 10ml enzyme-free EP tubes, 4.0ml of PBS (pH 7.4) and pH 6.0PBS were added, and the tubes were placed in a 37 ℃ incubator at a rotation speed of 100 rpm. After a 100. mu.L solution in an EP tube was taken out at 1, 2, 4, 8, 12, 24 and 48 hours, and centrifuged at 16000 rpm for 10 minutes, the absorbance A was measured by UV spectroscopy and fluorescence spectroscopy, and the absorbance of the nanoparticle which was not released was A0, and the cumulative release rate was (1-A/A0). times.100. FIG. 7 is a graph showing the release curves of rutin and miR-124 by RDMR under different conditions. The result shows that the RDMR has certain acid sensitivity; compared to pH 7.4PBS, the release rate was faster with pH 6.0PBS and reached 60% release efficiency over 48 hours, indicating that RDMR was effectively released at the AD lesion. While the cumulative release efficiency at 48h in PBS pH 7.4 was less than 25%, which also demonstrates the good stability of RDMR under normal physiological conditions.
And (3) stability determination:
DFs and RDMR were placed in PBS and DMEM complete medium containing 10% Fetal Bovine Serum (FBS) at 37 deg.C, respectively, and the particle sizes were determined at different time points. FIG. 6 shows the change in particle size of DFs and RDMR incubated with PBS and DMEM (10% FBS) for 24h at room temperature. As can be seen from the figure: DFs and RDMR showed no significant change in particle size, indicating that DFs and RDMR had high stability.
The method for investigating the osmotic action of the gene/small molecule compound nano drug delivery system on the BBB comprises the following specific steps:
(1) preparation of a preparation: with reference to the procedures described in examples 1 and 2 above, FAM-labeled free miR-124 solution, RDM, and RDMR were prepared and diluted with DMEM medium (no FBS) to a sample solution of 400nM (as RDMR).
(2) Establishing an in vitro BBB model: taking logarithmically grown HBMEC cells (human brain microvascular endothelial cells, given in release military 921 Hospital), digesting and counting, and diluting with appropriate amount of DMEM complete medium to 2 × 105cells/mL of cell suspension, 1mL per well, were seeded in a 12-well transwell upper chamber to establish an in vitro BBB model. Meanwhile, transmembrane resistance values of the upper and lower chambers were measured by TEER transmembrane cell resistance meter (WPI EVOM 2).
(3) Evaluation of BBB permeation efficiency: respectively adding the sample solution prepared in the step (1) into an upper chamber of a transwell chamber, culturing for 4 hours in a carbon dioxide incubator, taking down the chamber solution, centrifuging, measuring the fluorescence intensity of FAM in the supernatant by using an enzyme-labeling instrument, and calculating the permeation efficiency of BBB. Each experiment was performed in triplicate.
(4) Preliminary validation of BBB permeation mechanism: and (3) sucking and removing the culture medium in one hole of the transwell chamber, washing the culture medium with PBS for 2 times, adding 500 mu L of RVG29 solution (presaturating alpha 7nAChR receptor) with the concentration of 10mg/ml into a carbon dioxide incubator for incubation for 2 hours, adding the RDMR sample solution prepared in the step (3), incubating the RDMR sample solution in the carbon dioxide incubator for 4 hours, taking the chamber solution out for centrifugation, measuring the fluorescence intensity of FAM in the supernatant by using an enzyme-labeling instrument, and calculating the permeation efficiency of the BBB. Each experiment was performed in triplicate.
As a result, as shown in FIG. 8, the in vitro BBB model was constructed as shown in FIG. 8A, the in vitro BBB was constructed after 7 days of culture, and as shown in FIG. 8C, FAM-RDM and FAM-RDMR were added to the upper transwell chamber and incubated with HBMEC cells for 4 hours, FAM fluorescence was detected in the lower chamber, and RDMR fluorescence was the strongest. When HBMEC cells were preincubated with RVG29 for 2h, BBB efficiency decreased significantly. BBB penetration of RDMR was demonstrated to be effected by RVG 29. Free FAM-miR-124 was only weakly fluorescent in the lower chamber.
The method for investigating the targeted uptake of the gene/small molecule compound nano drug delivery system to nerve cells comprises the following specific steps:
(1) preparation of a preparation: with reference to the procedures described in examples 1 and 2 above, FAM-labeled free miR-124 solution, RDM, and RDMR were prepared and diluted with DMEM medium (no FBS) to a sample solution of 400nM (as RDMR).
(2) Cell preparation: taking logarithmically grown SH-SY5Y cells (human neuroblastoma cells, gift from release military 921), digesting and counting, and diluting with appropriate amount of DMEM complete medium to 2 × 105cells/mL, 2mL per well, were seeded in 24-well plates and cultured for 24 h.
(3) Targeted uptake evaluation: respectively adding the sample solution prepared in the step (1) into the SH-SY5Y cells cultured in the step (2), and collecting fluorescence images after culturing for 4 hours in a carbon dioxide incubator.
(4) And (3) fluorescence imaging acquisition: add 1mL paraformaldehyde to each well and fix in the dark for 20min at room temperature, aspirate the supernatant and wash with PBS three times. 0.5mL of 1. mu.g/mL DAPI was added to each well, nuclei were stained in the dark at room temperature for 15min, supernatants were aspirated and discarded, washed 3 times with PBS, image acquisition was performed by fluorescence microscopy and quantified by image J. Each experiment was performed in triplicate.
(5) Preliminary verification of the targeted uptake mechanism: the culture medium of one well of SH-SY5Y cells cultured in step (1) was discarded by pipetting, washed with PBS 2 times, then added with 500. mu.L of an RVG29 solution (presaturated. alpha.7 nAChR receptor) having a concentration of 10mg/ml for 2 hours in a carbon dioxide incubator, added with the RDMR sample solution prepared in step (3), incubated for 4 hours in the carbon dioxide incubator, and then discarded by pipetting, and fluorescence image acquisition was performed according to the method of step (4). Each experiment was performed in triplicate.
FIG. 9 shows the targeted uptake of SH-SY5Y cells into the nano-preparation. FIG. 9A is a photograph of the fluorescence image of the RDMR cells after incubation with SH-SY5Y cells. Scale bar 50 μm. FIG. 9B is a quantitative analysis of 9A. As can be seen from the figure: the nano preparation is incubated with SH-SY5Y cells for 4h, and obvious green fluorescence is observed in the cells under a fluorescence microscope, which indicates that the nano particles are taken up by the cells, wherein the fluorescence of the RDMR hole is stronger than that of the RDM hole. However, the green color was significantly reduced after 2h pretreatment with free RVG 29. The results demonstrate that RVG29 has an important role in enhancing neuronal uptake by RDMR.
The in vitro safety evaluation of the gene/small molecule compound nano drug delivery system is examined, and the method comprises the following specific steps:
(1) preparation of a preparation: with reference to the procedures described in examples 1 and 2 above, DFs, a free rutin solution, a free miR-124 solution and RDMR were prepared and diluted with DMEM medium (without FBS) into sample solutions diluted in a series of concentration gradients (0, 50, 100, 200, 400, 800nM, respectively, as RDMR).
(2) Cell preparation: logarithmic growth of HBMEC cells, SH-SY5Y cells, SH-SY5Y APPsw cells, and SVG P10 cells was taken, diluted with a DMEM medium containing 10% fetal bovine serum to a cell suspension having a density of 5X 104cells/mL, and in particular, SH-SY5YAPPswe cells were diluted with a F12/DMEM medium containing 10% fetal bovine serum to a cell suspension having a density of 5X 104cells/mL, and seeded at 100. mu.L per well in a 96-well plate. After culturing in a carbon dioxide incubator for 24 hours, the culture medium was removed and washed 3 times with PBS.
(3) In vitro safety evaluation: respectively adding the sample solution prepared in the step (1) into the different types of cells cultured in the step (2), and after culturing for 24 hours in a carbon dioxide incubator, rinsing with PBS 3 times. mu.L MTT solution (5mg/mL) was added to each well and incubation was continued for 4h before termination of the culture. The supernatant was aspirated off. Add DMSO solution 150 μ L into each well, shake on a shaker for 10min at low speed to dissolve the crystals completely, and measure the absorbance (OD) at 490nm with a microplate reader.
FIG. 10 shows the cell survival results of DFs, free rutin, free miR-124 and RDMR incubated with different cells for 24 h. FIG. 10A shows HBMEC cells, FIG. 10B shows SH-SY5Y cells, FIG. 10C shows SH-SY5YAPPswe cells, and FIG. 10D shows SVG P10 cells. As can be seen in FIG. 10, there was no significant decrease in cell viability of DFs and RDMR of the present invention with increasing doses (from 0-800nM, as measured by RDMR), demonstrating that DFs and RDMR are safe, non-toxic and amenable to in vivo assay-related evaluation.
The method for investigating the inhibition effect of the gene/small molecule compound nano drug delivery system on the BACE1 gene comprises the following specific steps:
(1) preparation of a preparation: DF-RVG29(DR), RDR, DMR and RDMR were prepared and diluted to a sample solution of 400nM (in RDMR) with DMEM medium (without FBS) with reference to the procedures described in example 1 and example 2 above.
(2) Cell preparation: taking logarithmic growth SH-SY5YAPPswe cells, digesting and counting, and diluting to 2 x 10 by using a proper amount of DMEM complete culture medium5cells/mL, 2mL per well, were seeded in 6-well plates and cultured for 24h adherent.
(3) Preparation treatment: respectively adding the sample solution prepared in the step (1) into the SH-SY5YAPPswe cells cultured in the step (2), and after culturing for 24 hours in a carbon dioxide incubator, rinsing with PBS 3 times.
(4) Protein sample preparation: and (3) using a protein lysate to lyse the SH-SY5Y APPsw cells treated in the step (3), collecting a protein sample in the cells, and determining the protein concentration of the protein sample by using a BCA kit. Adding a proper amount of concentrated SDS-PAGE protein loading buffer into the collected protein samples, and heating for 3-5 minutes at 100 ℃ or in a boiling water bath to fully denature the protein.
(5) western blot experiment: 1) and (5) preparing glue. A 10% SDS-PAGE gel was prepared according to the instructions; 2) and (4) loading and carrying out electrophoresis. And directly loading the protein sample into an SDS-PAGE gel loading hole for electrophoresis, and stopping electrophoresis when bromophenol blue reaches the position near the bottom end of the gel. 3) And (5) transferring the film. PVDF membrane is selected for membrane transfer, and a standard wet-type membrane transfer device of Bio-Rad is used. 4) And (5) sealing. Adding 5% skimmed milk, and sealing at room temperature for 1 hr. 5) Applying a primary antibody. The blocking solution was aspirated, diluted primary antibody was added and incubated overnight at room temperature. 6) And (6) washing. Recovering primary antibody, adding western washing solution, and washing at room temperature for 3 times and 10 min/time. 7) Applying a secondary antibody. Horseradish peroxidase (HRP) -labeled secondary antibody was diluted with western secondary antibody dilution according to the appropriate ratio. The wash was aspirated, diluted secondary antibody was added and incubated for 2h at room temperature. 8) And (6) washing. The mixture was washed 3 times for 10 min/time at room temperature by adding a western-style washing solution. 9) And (6) developing. Development was performed using an ECL luminescence solution such as Beyo ECLPlus (P0018).
FIG. 11 shows protein expression of BACE1 in SH-SY5YAPPswe cells. FIG. 11A is a Western blot of BACE1 after 24h of PBS, DR, RDR, DMR, and RDMR treatment. FIG. 11B is the quantitative analysis of FIG. 11A. It can be seen from the figure that the RDMR group showed the strongest inhibitory effect on BACE1 protein expression. The expression of BACE1 in the RDR and DMR groups is also reduced to a certain extent, but the reduction is lower than that in the RDMR group, which shows that rutin and miR-124 have synergistic effect on the reduction of BACE1 expression. The results show that the gene/small molecule compound nano drug delivery system can inhibit BACE1 gene expression.
The in vivo distribution research of the gene/small molecule compound nano drug delivery system is examined, and the specific steps are as follows:
(1) preparation of a preparation: with reference to the procedures described in examples 1 and 2 above, Cy5.5-labeled free miR-124 solutions, RDM and RDMR were prepared.
(2) Animal preparation: nanoparticles prepared in step (1) above were injected tail-intravenously in a single dose (equivalent to 1mg/kg of Cy5.5) into female BALB/c nude mice (18. + -.2 g, purchased from Splakeda laboratory animals Co., Ltd., Hunan).
(3) RDMR in vivo distribution: mice were anesthetized at 1h,2h,4h,4h, 8h,12h, and 24h after injection in step (2), respectively, and fluorescence imaging acquisition was performed on the mice by IVIS luminea III imaging system. And at the time point of strongest fluorescence (12 h after injection), major organs (heart, liver, spleen, lung, kidney, brain) were isolated and image acquisition was performed by IVIS lumine III imaging system.
(4) Targeted uptake of RDMR by brain slices (colocalization with the RVG29 target α 7 nAChR): and (2) adding the preparation prepared in the step (1) into a fetal mouse brain slice, incubating for 6h at 37 ℃, co-localizing with the RVG29 target alpha 7nAChR through immunofluorescence, and collecting a fluorescence image.
(5) Preliminary verification of a brain slice target uptake mechanism: the brain slices are pre-incubated with free RVG29 for 2h, then added with Cy5.5-RDMR prepared in the step (1) for treatment for 6h, co-localized with the RVG29 target alpha 7nAChR through immunofluorescence, and fluorescence image acquisition.
FIG. 12 is a study of the distribution of drugs in vivo. The tail vein of the nude mouse is injected with PBS, free Cy5.5-miR-124, Cy5.5-RDM and Cy5.5-RDMR respectively, and fluorescence images are collected at different time points. FIG. 12A is a graph of fluorescence profiles in vivo at 1h,2h,4h,4h, 8h,12h and 24h after tail vein injection; FIG. 12B is a graph of fluorescence profiles from heart, liver, spleen, lung, kidney and brain isolated from mice sacrificed 12h after injection. FIG. 12C is a fluorescent co-localization diagram of α 7nAChR targets of Cy5.5 and RVG29 after pretreatment of mouse brain slices by free Cy5.5-miR-124, Cy5.5-RDM, Cy5.5-RDMR and RVG29 for 2h and then by Cy5.5-RDMR for 6 h.
As shown in FIG. 12A, Cy5.5-RDMR accumulated most strongly in the brain 12h after tail vein injection. Fig. 12B shows that in isolated organs, fluorescence of mice injected with nanoparticles was mainly in liver and kidney. In brain tissue, the Cy5.5-RDMR group showed the strongest fluorescence accumulation compared to free Cy5.5-miR-124 solution and Cy5.5-RDM. FIG. 12C shows that co-localization with α 7nAChR (green) shows that Cy5.5-RDMR (red) shows the strongest fluorescence overlap. Shows that RVG29 in the gene/small molecule compound nano drug delivery system has brain targeting.
The method for improving the pathological symptoms of APP/PS1 mice by investigating a gene/small molecule compound nano drug delivery system comprises the following specific steps:
(1) preparation of a preparation: RDR, DMR and RDMR were prepared according to example (1) and example (2) and concentrated to a sample solution of 1.5 μ M on RDMR with PBS solution as a control.
(2) Animal preparation: male APP/PS1 mice of 5 months of age were purchased from Beijing Huafukang Biotech GmbH, and randomly grouped, with 4-8 mice per group. Male C57 mice (wide-type, WT) at 5 months of age served as normal controls.
(2) Administration to mice: the solution prepared in the above step (1) was injected into APP/PS1 mice grouped in the above step (2) through the tail vein, while an equal volume of PBS was injected into the WT group. Once every 5 days, 6 times after dosing, mice were anesthetized and sacrificed. The heart, liver, spleen, lung, kidney and brain were isolated and peripheral blood was collected.
(3) Measuring the content of the sea horse miR-124: after the operation according to the step (2), separating the hippocampus from the brain tissue, extracting total microRNAs through a microRNA extraction kit, carrying out reverse transcription through a reverse transcription kit, carrying out amplification through qPCR, and carrying out relative quantitative analysis.
(3) Long-term potentiation (LTP): and (3) placing the brain tissue in the step (2) in artificial cerebrospinal fluid which is pre-iced in ice, continuously supplying oxygen during the period, maintaining the activity of the brain tissue, and setting the slice thickness of the brain slice to be 300 mu m. Electrical stimulation was given and LTP was recorded for different groups of brain slices in the hippocampal region and relative quantification was performed.
(4) Immunohistochemistry for a β: and (3) washing the brain tissue in the step (2) by using normal saline, sucking water by using filter paper, and fixing for 24 hours by using 4% paraformaldehyde. Tissue embedding, cryosectioning, abeta immunohistochemical staining, changes in plaque size and number observed using an optical microscope, and quantitative analysis.
(5) Hippocampal BACE1 gene expression: after the operation according to the step (2), separating the hippocampus from the brain tissue, adding a protein lysate for lysis, collecting a protein sample, and determining the protein concentration of the protein sample by using a BCA kit. Protein denaturation, loading, electrophoresis, membrane transfer, blocking, primary antibody and secondary antibody incubation were performed as in example 6. Protein bands were visualized and quantified.
(6) Neuroinflammatory reaction: 1) percentage of Ibal positive area: and (3) washing the brain tissue normal saline obtained in the step (2), sucking water by using filter paper, and fixing by using 4% paraformaldehyde for 24 hours. Embedding tissues, freezing and slicing, carrying out immunohistochemical staining on Iba1, observing the change condition of the area size and the quantity of positive glial cells by using an optical microscope, and carrying out quantitative analysis; 2) detection of neuroinflammation markers: mainly, mRNA levels of IL-6, IL-1. beta. and TNF-. alpha.were measured. After the operation according to the step (2), separating hippocampus from brain tissue, adding Trizol to extract total RNA, transcribing into cDNA by a reverse transcription kit, performing gene amplification by qPCR, and performing relative quantitative analysis.
FIG. 13 shows that RDMR improved the AD pathology in APP/PS1 mice. Fig. 13A is an animal experiment schedule. FIG. 13B is the mRNA levels of hippocampal miR-124. FIGS. 13C-13E show changes in hippocampal LTP. FIGS. 13F-13H show changes in hippocampal A β. FIGS. 13I-13L are changes in neuroinflammatory markers (Iba1 positive area, mRNA levels of IL-6, IL-1 β and TNF- α). Data are expressed as mean ± standard deviation, # P <0.05, # P <0.01, # P < 0.001.
As can be seen from the figure: compared with the WT-PBS group, the level of miR-124 in the hippocampal region of the AD-PBS group is remarkably reduced, LTP is obviously damaged, A beta plaque, BACE1mRNA and protein are up-regulated, and neuroinflammation markers are increased. These symptoms were significantly improved after RDMR treatment. These data show that RDMR treatment can effectively increase the level of hippocampal miR-124, alleviate AD pathological changes, and delay AD progression. The treatment effect of the RDMR group is obviously better than that of the RDR group or the DMR group in the aspects of improving LTP injury, reducing A beta deposition and relieving neuroinflammation.
And (3) examining the in vivo safety evaluation of the gene/small molecule compound nano drug delivery system:
(1) mouse preparation: mice were treated according to the method of example 8, and after 6 times of administration, five groups of mice were sacrificed.
(2) And (3) taking the mouse treated in the step (1), taking out main organs (heart, liver, spleen, lung and kidney), washing with normal saline, sucking water by using filter paper, and fixing for 24 hours by using 4% paraformaldehyde. Tissues were paraffin embedded, sectioned, H & E stained, and pathological changes were observed using an optical microscope.
FIG. 14 shows the analysis of the heart, liver, spleen, lung and kidney physiological sections of the mice in each group. Scale bar 100 μm. Compared with the WT-PBS group, no obvious pathological changes were observed in the other four groups of organs. Indicating that RDMR has good in vivo safety.
The above-mentioned embodiments are only preferred embodiments of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art should be considered as the technical scope of the present invention, and equivalents and modifications of the technical solutions and concepts of the present invention should be covered by the scope of the present invention.
Sequence listing
<110> Xiangya three hospitals of Zhongnan university
<120> gene/small molecule compound nano drug delivery system, preparation method and application thereof
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 98
<212> DNA
<213> Artificial Sequence
<400> 1
tatcgtacag attgacgacg cggcggccct tgatatgccg cagcagcatc taaccgtaca 60
gtatttgctg ctgcagcgat acgcgtatcg ctatggca 98
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 2
attgacgacg cggcggccct t 21
<210> 3
<211> 22
<212> RNA
<213> Artificial Sequence
<400> 3
uaaggcacgc ggugaaugcc aa 22
<210> 4
<211> 43
<212> DNA/RNA
<213> Artificial Sequence
<400> 4
cguguucaca gcggaccuug auacgatcta accgtacagt att 43
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 5
Claims (10)
1. A gene/small molecule compound nano drug delivery system is characterized in that the drug delivery system comprises a DNA nano-flower carrier, rutin, a miR-124 chimera and a DNA-targeting ligand; the rutin and the DNA nanoflower carrier are loaded through pi-pi stacking, and the miR-124 chimera, the DNA-targeting ligand and the DNA nanoflower carrier are loaded through DNA molecular hybridization reaction;
the DNA nanoflower vector is prepared by taking a sequence shown as SEQ ID NO. 1 as a template through RCA reaction;
the miR-124 chimera is obtained through annealing hybridization reaction of a miR-124 reaction chain and a miR-124 long-chain complementary chain;
the DNA-targeting ligand is obtained by taking a sequence shown as SEQ ID NO. 2 as a template chain, modifying by MAL, and then carrying out addition reaction with a targeting ligand of which the side chain contains sulfydryl.
2. The gene/small molecule compound nano drug delivery system according to claim 1, wherein the targeting ligand is a ligand capable of penetrating the blood brain barrier, specifically:
any one of a neurotropic virus-derived peptide, a brain-targeting aptamer, Angiopep2, a cell-penetrating peptide, a D peptide, or a T7 peptide.
3. The gene/small molecule compound nano drug delivery system according to claim 1, wherein the molar concentration ratio of the DNA nanoflower vector, rutin, and miR-124 chimera is 1: 480: 14; the concentration of the DNA nanoflower carrier is 0.1-3 mu M, the concentration of rutin is 48-1440 mu M, and the concentration of the miR-124 chimera is 1.4-28 mu M.
4. The gene/small molecule compound nano drug delivery system according to claim 1, wherein the concentration of the targeting ligand is 0.1mg/mL to 0.9 mg/mL.
5. A method for preparing the gene/small molecule compound nano drug delivery system of any claim 1 to 4, which is characterized by comprising the following steps:
s1, mixing, annealing and hybridizing the miR-124 reaction chain and the miR-124 long-chain complementary chain in a buffer solution to obtain a miR-124 chimera;
s2: 2 and 5' modified maleimide group DNA chain and targeting ligand solution are mixed, and DNA-targeting ligand is obtained after incubation;
s3, mixing a DNA template chain with a sequence shown as SEQ ID NO. 1, a primer and a reaction buffer solution, performing vortex annealing, adding T4DNA ligase to connect to obtain a circular DNA, and dripping BSA, dNTPs, DNA polymerase and the buffer solution into the circular DNA under an ice bath condition to perform RCA reaction to obtain DNA nanoflowers;
s4, preparing Rutin into a solution, dripping the solution into the DNA nanoflower, and incubating overnight at room temperature to obtain Rutin @ DFs;
s5, mixing Rutin @ DFs, miR-124 chimera and DNA-targeting ligand, and incubating to obtain the gene/small molecule compound nano drug delivery system.
6. The preparation method of the gene/small molecule compound nano drug delivery system according to claim 5, wherein the sequences of the miR-124 reaction chain and the miR-124 long-chain complementary chain in the step S1 are shown in SEQ ID NO 3 and SEQ ID NO 4.
7. The method for preparing a gene/small molecule compound nano drug delivery system according to claim 5, wherein the deoxynucleotide sequence of the primer in the step S3 is shown as SEQ ID NO. 5.
8. Use of a gene/small molecule compound nano drug delivery system obtained by any of claims 1-4 or any of the preparation methods of claims 5-7 in the preparation of a medicament for treating neurodegenerative diseases.
9. The application of the gene/small molecule compound nano drug delivery system obtained by the preparation method of any claim 1 to 4 or any claim 5 to 7 in the preparation of the Alzheimer disease targeted therapeutic drug.
10. A targeted drug for treating Alzheimer's disease, which is an external preparation, an oral preparation or an injection preparation comprising the gene/small molecule compound nano drug delivery system according to any claim 1 to 4 or obtained by the preparation method according to any claim 5 to 7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111248086.6A CN113975397B (en) | 2021-10-26 | 2021-10-26 | Gene/small molecule compound nano drug delivery system and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111248086.6A CN113975397B (en) | 2021-10-26 | 2021-10-26 | Gene/small molecule compound nano drug delivery system and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113975397A true CN113975397A (en) | 2022-01-28 |
| CN113975397B CN113975397B (en) | 2023-08-22 |
Family
ID=79741661
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111248086.6A Active CN113975397B (en) | 2021-10-26 | 2021-10-26 | Gene/small molecule compound nano drug delivery system and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113975397B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113897397A (en) * | 2021-09-30 | 2022-01-07 | 中南大学 | DNAzyme based gene editing regulation method |
| CN115813860A (en) * | 2022-12-10 | 2023-03-21 | 郑州大学 | Preparation method and application of subminiature programmable pure nucleic acid nanoparticles |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160040161A1 (en) * | 2011-12-12 | 2016-02-11 | Oncoimmunin Inc. | In Vivo Delivery of Oligonucleotides |
| CN106754894A (en) * | 2017-02-28 | 2017-05-31 | 临沂大学 | A kind of multifunction magnetic DNA nanospheres and preparation method and application |
| US20200030457A1 (en) * | 2017-04-03 | 2020-01-30 | The Regents Of The University Of California | Deformable nano-scale vehicles (dnvs) for trans-blood brain barrier, trans-mucosal, and transdermal drug delivery |
| CN112587670A (en) * | 2021-03-02 | 2021-04-02 | 中国农业大学 | Preparation method of DNA nanoflower medicine for targeted regulation and control of browning of white fat |
-
2021
- 2021-10-26 CN CN202111248086.6A patent/CN113975397B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160040161A1 (en) * | 2011-12-12 | 2016-02-11 | Oncoimmunin Inc. | In Vivo Delivery of Oligonucleotides |
| CN106754894A (en) * | 2017-02-28 | 2017-05-31 | 临沂大学 | A kind of multifunction magnetic DNA nanospheres and preparation method and application |
| US20200030457A1 (en) * | 2017-04-03 | 2020-01-30 | The Regents Of The University Of California | Deformable nano-scale vehicles (dnvs) for trans-blood brain barrier, trans-mucosal, and transdermal drug delivery |
| CN112587670A (en) * | 2021-03-02 | 2021-04-02 | 中国农业大学 | Preparation method of DNA nanoflower medicine for targeted regulation and control of browning of white fat |
Non-Patent Citations (1)
| Title |
|---|
| 杨雪: "基于miRNA特异响应的Cas9/sgRNA纳米递送系统用于细胞质蛋白直接递送和增强基因编辑的研究", 《中国优秀硕士学位论文全文数据库（工程科技Ⅰ辑）》, no. 2 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113897397A (en) * | 2021-09-30 | 2022-01-07 | 中南大学 | DNAzyme based gene editing regulation method |
| CN115813860A (en) * | 2022-12-10 | 2023-03-21 | 郑州大学 | Preparation method and application of subminiature programmable pure nucleic acid nanoparticles |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113975397B (en) | 2023-08-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113975397B (en) | Gene/small molecule compound nano drug delivery system and preparation method and application thereof | |
| Fu et al. | Therapeutic siCCR2 loaded by tetrahedral framework DNA nanorobotics in therapy for intracranial hemorrhage | |
| Gao et al. | Brain endothelial cell-derived exosomes induce neuroplasticity in rats with ischemia/reperfusion injury | |
| CN110229214B (en) | Exosome sustained-release polypeptide hydrogel and preparation method and application thereof | |
| Ouyang et al. | Brain‐Penetration and Neuron‐Targeting DNA Nanoflowers Co‐Delivering miR‐124 and Rutin for Synergistic Therapy of Alzheimer's Disease | |
| Peng et al. | Microglia-derived exosomes improve spinal cord functional recovery after injury via inhibiting oxidative stress and promoting the survival and function of endothelia cells | |
| US11904057B2 (en) | Nanoparticle-hydrogel composite for nucleic acid molecule delivery | |
| US20200392296A1 (en) | Nano coordination polymer and preparation method and application thereof | |
| Chu et al. | Hydrogen sulfide-modified extracellular vesicles from mesenchymal stem cells for treatment of hypoxic-ischemic brain injury | |
| CN113355290B (en) | Anti-tumor engineered exosome, preparation method and application | |
| Yuan et al. | Effect of exosomes derived from mir-126-modified mesenchymal stem cells on the repair process of spinal cord injury in rats. | |
| US20230330136A1 (en) | Blood-brain barrier-penetrating nanotheranostics for acute and chronic neurodegenerative diseases and the like | |
| Sela et al. | Brain‐Targeted Liposomes Loaded with Monoclonal Antibodies Reduce Alpha‐Synuclein Aggregation and Improve Behavioral Symptoms in Parkinson's Disease | |
| Liu et al. | Systemic delivery of microRNA for treatment of brain ischemia | |
| CN117083066A (en) | Composition for preventing or treating dementia containing peptide nucleic acid complex as active ingredient | |
| CN113398135B (en) | Nano system for HILI in-situ detection and drug release | |
| CN109771667A (en) | The purposes of Spy1 gene and its expression albumen in treatment amyotrophic lateral sclerosis | |
| CN114588174A (en) | MiRNAs composition for treating sepsis and application thereof | |
| Su et al. | MicroRNA-195 liposomes for therapy of Alzheimer's disease | |
| KR20180095093A (en) | Use of compounds in the manufacture of medicaments for the treatment of cranial gliomas | |
| CN111686124A (en) | Application of miR-486-3p in preparation of product for treating neuroinflammation caused by SAH (neuroinflammation) | |
| CN113214353B (en) | Amphiphilic oligopeptide structural substance | |
| Wang et al. | Blood brain barrier-targeted delivery of double selenium nanospheres ameliorates neural ferroptosis in Alzheimer's disease | |
| CN113304167B (en) | Application of ENSRNOT00000084277 in preparation of medicine for preventing and treating depression mood related to chronic pain | |
| CN108245667A (en) | Tumor necrosis factor α inducible protein 3 is preparing the application in treating diabetic cardiomyopathy drug |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |