CN113967265A - pH-responsive cyclodextrin nano-composite for mediating CRISPR system and construction method and application thereof - Google Patents

pH-responsive cyclodextrin nano-composite for mediating CRISPR system and construction method and application thereof Download PDF

Info

Publication number
CN113967265A
CN113967265A CN202111134414.XA CN202111134414A CN113967265A CN 113967265 A CN113967265 A CN 113967265A CN 202111134414 A CN202111134414 A CN 202111134414A CN 113967265 A CN113967265 A CN 113967265A
Authority
CN
China
Prior art keywords
responsive
cyclodextrin
nano
crispr
water
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202111134414.XA
Other languages
Chinese (zh)
Inventor
凌开建
梁志清
张建祥
窦寅
王延洲
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Third Military Medical University TMMU
Original Assignee
Third Military Medical University TMMU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Third Military Medical University TMMU filed Critical Third Military Medical University TMMU
Priority to CN202111134414.XA priority Critical patent/CN113967265A/en
Publication of CN113967265A publication Critical patent/CN113967265A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6949—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit inclusion complexes, e.g. clathrates, cavitates or fullerenes
    • A61K47/6951—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit inclusion complexes, e.g. clathrates, cavitates or fullerenes using cyclodextrin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6921—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
    • A61K47/6927—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores
    • A61K47/6929—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle
    • A61K47/6931—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle the material constituting the nanoparticle being a polymer
    • A61K47/6939—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle the material constituting the nanoparticle being a polymer the polymer being a polysaccharide, e.g. starch, chitosan, chitin, cellulose or pectin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/001—Preparation for luminescence or biological staining
    • A61K49/0013—Luminescence
    • A61K49/0017—Fluorescence in vivo
    • A61K49/0019—Fluorescence in vivo characterised by the fluorescent group, e.g. oligomeric, polymeric or dendritic molecules
    • A61K49/0021—Fluorescence in vivo characterised by the fluorescent group, e.g. oligomeric, polymeric or dendritic molecules the fluorescent group being a small organic molecule
    • A61K49/0032—Methine dyes, e.g. cyanine dyes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/001—Preparation for luminescence or biological staining
    • A61K49/0013—Luminescence
    • A61K49/0017—Fluorescence in vivo
    • A61K49/005—Fluorescence in vivo characterised by the carrier molecule carrying the fluorescent agent
    • A61K49/0054—Macromolecular compounds, i.e. oligomers, polymers, dendrimers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/001—Preparation for luminescence or biological staining
    • A61K49/0063—Preparation for luminescence or biological staining characterised by a special physical or galenical form, e.g. emulsions, microspheres
    • A61K49/0069—Preparation for luminescence or biological staining characterised by a special physical or galenical form, e.g. emulsions, microspheres the agent being in a particular physical galenical form
    • A61K49/0089—Particulate, powder, adsorbate, bead, sphere
    • A61K49/0091—Microparticle, microcapsule, microbubble, microsphere, microbead, i.e. having a size or diameter higher or equal to 1 micrometer
    • A61K49/0093—Nanoparticle, nanocapsule, nanobubble, nanosphere, nanobead, i.e. having a size or diameter smaller than 1 micrometer, e.g. polymeric nanoparticle
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y40/00—Manufacture or treatment of nanostructures
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00—Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery

Abstract

The invention relates to a pH responsive cyclodextrin nano-composite mediating a CRISPR system and a construction method and application thereof, belonging to the technical field of medicines. According to the invention, a strategy of delivering Cas9 and sgRNA simultaneously is adopted, a CRISPR/Cas9mRNA molecule transcribed in vitro is tried to be delivered by utilizing pH-responsive cyclodextrin nano-encapsulation, a CRISPR/Cas9 nano-delivery system with better transfection efficiency is successfully constructed, a new attempt is provided for research and development of non-viral vectors, and the pH value targeting property and the endogenous escape mechanism of the constructed pH-responsive cyclodextrin nano-complex are favorable for the constructed pH-responsive cyclodextrin nano-complex to release nano-particles locally in tumors, so that the biological property is exerted to the maximum efficiency.

Description

pH-responsive cyclodextrin nano-composite for mediating CRISPR system and construction method and application thereof
Technical Field
The invention belongs to the technical field of medicines, and particularly relates to a pH responsive cyclodextrin nano-composite for mediating a CRISPR system, and a construction method and application thereof.
Background
The gene editing technology is a leap of the biological science technology, and revolutionary changes are brought to the life science and clinical treatment. There are three major gene editing techniques, ZFNs, TALENs and CRISPR/Cas 9. The CRISPR/Cas9 is derived from an adaptive immune response system of prokaryotes, and the CRISPR/Cas9 system mainly comprises two parts: a Cas9 nuclease protein portion and a CRISPR-targeting guide sequence. The mechanism of CRISPR/Cas9 gene editing is through the binding of a single short-stranded guide rna (sgrna) targeting a specific DNA sequence to its complementary DNA sequence, directing the active Cas9 enzyme to the designated genetic location to cleave the target site DNA. The CRISPR system provides a multifunctional and efficient means of genetic engineering, and the technology has now been extended to the field of clinical research, showing its advantages, in particular, in immune cell editing, genetic diseases, and tumor therapy.
The interest in CRISPR system specificity, editing efficiency, off-target rate and delivery vectors makes the study of CRISPR/Cas9 delivery vector and system optimization important. Vectors fall into two broad categories, viral and non-viral. The transfection efficiency of the virus vector is stable and high, and the lentivirus, the adenovirus and the adeno-associated virus all show high transfection capacity. Currently, viral vectors used for Cas9 delivery in vivo are mainly adenovirus and adeno-associated virus (AAV) vectors, each of which shows superior delivery efficiency. However, the AAV-guided CRISPR/Cas9 delivery system still has risks in human clinical application, and the fusion of viral genes can destroy the expression of important genes. In view of the safety, immunogenicity and potential tumorigenic risks of viral vectors, clinical applications of non-viral vectors are urgently awaited. Currently, non-viral delivery methods and vector materials have shown some transfection efficacy, but the methods are under-study.
The cyclodextrin nanometer material also has the advantages of low cytotoxicity, good biocompatibility, easy degradation, no immunogenicity and the like. The medicament based on cyclodextrin nanometer and the gene delivery research are beneficial to the development, and have better clinical transformation prospect. The unique design of the pH-responsive multifunctional polymer beta-cyclodextrin nanoparticles provides multiple additional functions or co-delivery capability, and is particularly suitable for the field of tumor treatment. Because the tumor cells are in a hypoxic environment, anaerobic glycolysis can produce a large amount of lactic acid, and the pH value of the local environment is obviously lower than that of a normal tissue. The pH-responsive nano-particles can be localized in the tumor tissue for degradation and release by virtue of this difference. Targeted treatment of solid tumors can utilize this pH differential as a breakthrough. I successfully developed a pH responsive cyclodextrin nano material, and possessed a patent technology. Previous researches show that the nanoparticles show good sustained release and targeting effects in drug delivery in vivo experiments through optimized preparation, and have good histocompatibility. In view of the performance advantages of the pH-responsive cyclodextrin nanoparticles, the nanoparticles are applied as CRISPR system delivery vectors in groups, optimized and improved, and the characteristics of targeted degradation and release, transfection rate, stability, low toxicity and the like of the nanoparticles in tissues and cells with low oxygen and low pH value are researched.
Disclosure of Invention
In view of the above, an object of the present invention is to provide a method for constructing a non-viral vector for delivering a CRISPR system, and another object of the present invention is to provide a pH-responsive cyclodextrin nanocomplex for simultaneously delivering CRISPR system mRNA; the invention also provides application of the pH-responsive cyclodextrin nano-complex in targeted therapy of cervical cancer.
In order to achieve the purpose, the invention provides the following technical scheme:
1. a method for constructing pH-responsive cyclodextrin nano-complexes mediating a CRISPR system comprises the following steps:
A. designing and synthesizing an sgRNA sequence according to a disease target gene, transcribing Cas9mRNA and sgRNA in vitro, and carrying out chemical modification to improve stability;
B. mixing mRNA of Cas9 subjected to chemical modification with sgRNA to obtain an inner water phase, adding the inner water phase into an organic phase solution, and uniformly mixing to form water-in-oil colostrum, wherein the organic phase solution comprises branched polyethyleneimine and acetalized beta-cyclodextrin;
C. and adding a polyvinyl alcohol solution into the water-in-oil primary emulsion, mixing to obtain a water-in-oil-in-water composite emulsion, stirring to volatilize the organic solvent, and carrying out solidification, high-speed centrifugation and washing to obtain the pH-responsive cyclodextrin nano-composite.
As one of the preferable technical features, in step a, after Cas9mRNA and sgRNA are transcribed in vitro, chemical modification is performed to improve the stability thereof, so as to provide conditions for a simultaneous delivery strategy.
Using The MessageMAXTMThe T7 ARCA-bundled Message Transcription Kit transcribes Cas and sgRNA into mRNA in vitro. Use of T7 RNA polymerase and anti-inversion Cap analogue (ARCA) m27,3' -OG[5']ppp[5']Chemical modification is performed.
As one of the preferable technical characteristics, the operation process of the diethoxypropene, the pyridinium p-toluenesulfonate, the beta-cyclodextrin, the methoxypropene and the triethylamine keeps an RNase-free environment, and the standard is achieved through the materials for removing the RNase and a clean bench, and measures such as high-temperature disinfection, ultraviolet irradiation and the like.
As one of the preferable technical features, the step B specifically includes mixing mRNA of the chemically modified Cas9 and sgRNA to obtain an internal aqueous phase, and mixing acetalized β -cyclodextrin and branched polyethyleneimine to obtain an organic phase; slowly mixing the organic phase and the internal water phase, slowly dripping the organic phase into the internal water phase while magnetically stirring, and ultrasonically mixing to form water-in-oil colostrum, wherein the operation environment keeps the RNA enzyme-free environment.
As one of the preferable technical features, in the step B, the ratio of mRNA to sgRNA is 1: 1.
as one of the preferable technical characteristics, the step C specifically comprises adding a polyvinyl alcohol solution to the water-in-oil colostrum, performing ultrasonic mixing to obtain a water-in-oil-in-water composite emulsion, performing magnetic stirring, standing at room temperature until solidification, performing high-speed centrifugation, and washing with deionized water for 4-5 times to obtain the pH-responsive cyclodextrin nanocomposite.
As one of the preferable technical characteristics, when the labeled pH-responsive cyclodextrin nanocomposite is prepared, a CY5 fluorescent dye needs to be added in advance to react with ACD.
As one of the preferable technical features, in the step a, the disease target genes are HPV18 positive cervical cancer E6 and E7 genes.
2. The pH responsive cyclodextrin nano-complex for mediating CRISPR system prepared by the construction method.
3. The pH responsive cyclodextrin nano-composite is applied to targeted therapy of cervical cancer.
The invention has the beneficial effects that:
(1) according to the invention, a CRISPR/Cas9mRNA small molecule complex system is successfully constructed, Cas9mRNA small molecules can be directly translated into protein in cytoplasm to play a role, mRNA and guide RNA (sgRNA) are chemically modified, a Cas9mRNA and sgRNA simultaneous delivery strategy is adopted, a CRISPR/Cas9 nano delivery system with better transfection efficiency is successfully constructed, and a new attempt is provided for the research and development of a non-viral vector.
(2) Preparing self-assembled nanoparticles of Cas9mRNA and sgRNA composite small molecules, selecting Cas9 mRNA: sgRNA is a 1:1 transfection system, and innovative exploration of in vivo and in vitro transfection is performed.
(3) The pH value targeting property and the endogenous escape mechanism of the CRISPR/Cas9mRNA loaded pH responsive nanoparticles are beneficial to local release of the nanoparticles in the tumor, and the in vivo transportation effect is exerted to the maximum efficiency. The experiment shows that the nanoparticles are locally applied and the CY5 is used for tracing and marking, thereby showing good in vivo targeting.
Drawings
For the purposes of promoting a better understanding of the objects, aspects and advantages of the invention, reference will now be made to the following detailed description taken in conjunction with the accompanying drawings in which:
FIG. 1 is a schematic diagram of the chemical modification of in vitro transcribed mRNA.
FIG. 2 shows electrophoretic bands after in vitro transcription of mRNA, 103nt and 4521nt gRNA and Cas9mRNA electrophoretic bands.
Fig. 3 is a schematic diagram of the preparation of pH-responsive nanoparticles containing Cas9mRNA and E6 or E7 gRNA.
Fig. 4 is the results of preparation, characterization and in vitro evaluation of pH-responsive nanoparticles loaded with CRISPR/Cas9mRNA and gRNA. a. b is SEM image (left), TEM image (center) and particle size distribution plot (right), scale bar, 200nm of ACD NP comprising Cas9mRNA and E6/E7 gRNA. C is a fluorescence image result, and after 6h of incubation, HeLa cells take up cy 5-labeled ACD NP. d. e is the flow cytometry results (d) and quantitative data results (e) of the transfection efficiency of Cy5/ACD NP at different doses and different incubation times. f. g is fluorescence image (f) and quantitative result (g) of Cas9 expression in HeLa cells 6h after 0.5, 1, 2. mu.g/mL of Cas9mRNA acted on E6/ACD NP, scale bar, 20 μm.
FIG. 5: results of in vivo animal experiments targeting HPV 18E 7 gene. a is a tumor growth curve, and b is a tumor morphology graph; c is the tumor volume result; d is the tumor body weight result, salt: a physiological saline solution group; e-g is the result of immunohistochemical detection of tumor tissues of the nude mice (E is E7, f is pRB, and g is p 21).
FIG. 6: imaging of mouse with in vivo nanocomplex tracking.
FIG. 7: antitumor effect after in vivo gene editing and intratumoral injection (mouse transplanted tumors), a-c is immunofluorescence analysis of Cas9(a), E6(b) and p53(c) protein expression in tumors. d. E is an immunofluorescence (d) and immunohistochemistry (E) co-localization analysis, indicating that the expression of E6 and p53 proteins are in the same region. f is TUNEL in situ apoptosis assay. g is the change in tumor volume following intratumoral injection of E6/ACD NP 4. mu.g Cas9mRNA in mice. h is the result graph of the tumor after treatment. i is the tumor volume after 6 days of treatment.
Detailed Description
The invention will be further illustrated with reference to specific preferred embodiments. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not indicated in the examples, are generally carried out according to conventional conditions, such as those described in the molecular cloning protocols (third edition, sambrook et al), or according to the manufacturer's recommendations.
Example 1
CRISPR/Cas9 vector construction and mRNA in-vitro transcription
sgRNA was designed for the target gene sequence, and single-stranded oligo was synthesized by the American company cyagen. Vectors for in vitro transcription of mRNA were constructed for the sgRNA + CRISPR/Cas9 overexpression plasmid, and the corresponding sgRNA and P330X plasmid. Transfecting a HeLa cell with sgRNA + CRISPR/Cas9 overexpression plasmid, sequencing and verifying the gene cutting effect of the plasmid HPVE6/E7 by Sanger, and transcribing mRNA in vitro after verification. sgRNA was as follows:
E6:GAAGCTACCTGATCTGTGCA
E7:GGAGCAATTAAGCGACTCAG
chemical modification of in vitro transcribed mRNA is shown in FIG. 1 using The MessageMAXTMThe T7 ARCA-bundled Message Transcription Kit transcribes Cas and sgRNA into mRNA in vitro. Use of T7 RNA polymerase and anti-inversion Cap analogue (ARCA) m27,3' -OG[5']ppp[5']Chemical modification is performed.
As shown in FIG. 2, the mRNA was successfully transcribed and chemically modified in vitro, and was active.
Example 2
Construction and characterization of CRISPR/Cas9mRNA loaded pH responsive nano (pH-NPA) nano system
(1) Preparation of ACD (acetalized beta-cyclodextrin)
1g beta-CD was ultrasonically dissolved in 10mL anhydrous DMSO and magnetically stirred at 25 ℃ for 5 min. Then, 4.5mL of diethoxypropylene and 16.3mg of pyridinium p-toluenesulfonate (PTS) were added, and after the PTS was sufficiently dissolved by magnetic stirring at room temperature, 4mL of Methoxypropene (MP) was added, and the mixture was reacted at room temperature for 3 hours, and 0.2mL of triethylamine was added to terminate the reaction. Pouring 200mL of pure water into the obtained solution, precipitating by deionized water, separating out a reaction product, centrifugally washing for 5 times at 14000rpm until the solution becomes clear to obtain an ACD solution, and freeze-drying the obtained product in a vacuum freeze dryer for later use.
(2) Preparation of CRISPR small molecule compound system nano particle
The CRISPR-Cas9 and the sgRNA (E6)/sgRNA (E7) are prepared into a CRISPR-sgRNA-Cas9 small molecule compound solution according to the ratio of 1:1, and the solution is subjected to constant volume to 100 mu L of water to obtain an inner water phase.
Dissolving 1mL of dichloromethane in 15mg of ACD and 2.5mg of branched polyethyleneimine with a molecular weight of 1.8kDa to obtain an organic phase; slowly dripping the organic phase into the internal water phase at a speed of 1mL/min while magnetically stirring, slowly mixing, performing ultrasonic treatment, magnetically stirring at 65 ℃ for 30min, and fully mixing to emulsify the internal water phase into the organic phase to form water-in-oil colostrum.
Adding 6mL of polyvinyl alcohol (PVA) into PBS to obtain a PVA aqueous solution with the mass percentage concentration of 1% (molecular weight of 8.8kDa and hydrolysis degree of 88%), mixing the PVA aqueous solution into the water-in-oil primary emulsion, and performing ultrasonic treatment to obtain the water-in-oil-in-water composite emulsion. Magnetically stirring the obtained multiple emulsion at room temperature for 3 hours to volatilize and remove the organic solvent of the organic phase, standing and reacting for 2 hours at room temperature to obtain solidified nano particles, centrifuging at 26000rpm, and washing with deionized water for 4-5 times to obtain the nano compound.
When preparing CY5 labeled nano, ACD and 0.1mg CY5 are mixed together, so that CY5 is loaded on ACD, then 2mL acetonitrile is added, and ultrasonic emulsification and dissolution are carried out. The organic phase and the internal water phase were mixed according to the above procedure to prepare CY5 labeled nanocomplexes.
And (3) suspending the obtained nano-composite CRISPR/Cas9mRNA loaded pH responsive nano (abbreviated as pH-NPA) in pure water, uniformly mixing, uniformly coating a small amount of the mixture on a mica sheet and a copper net, naturally volatilizing and airing water, standing at room temperature, and detecting the particle size and the charge on a machine.
As shown in figure 3, pH-responsive nanoparticles (ACD NPs) were based on pH-responsive cyclodextrin materials, in which Cas9mRNA and E6 or E7 grnas were loaded by forming complexes of low molecular weight PEI (Mw,1800) resulting in genome editing nanotherapeutics E6/ACD NPs and E7/ACD NPs, respectively. Under low pH conditions, either E6/ACD NP or E7/ACD NP can release encapsulated complexes by responsive hydrolysis of ACD NP.
The pH-responsive acetalized beta-cyclodextrin is synthesized by acetalizing the beta-cyclodextrin and adding an acid-responsive group. And preparing the CRISPR small molecule complex into an internal water phase. Emulsifying the water phase into the organic phase to obtain the water-in-oil colostrum packaged CRISPR small molecule complex. And then obtaining water-in-oil-in-water double emulsion to finish the self-assembly of the host and the guest, wherein the CY5 marking step comprises the steps of mixing and packaging organic phase ACD and CY5 fluorescent dye complex nanoparticles with CRISPR small molecule compound.
The results of the transmission electron microscope and the Malvern particle size detection are shown in a-b in FIG. 4, the size of each group of nano particles is between 150-200nm, the nano particles are basically uniform in size, round, full and uniform in dispersion.
Example 3
In vitro evaluation of CRISPR/Cas9mRNA loaded pH responsive nanosystems
1. Nano penetration phagocytosis assay
(1) CLSM detection of living cell nano phagocytosis
1) Cell culture planking
About 110 HeLa cells4The cells are evenly paved on a confocal culture dish, cultured overnight, and nano-transfection is carried out when the confluency of the cells is about 80%. 1mL of fresh medium with 10% serum was replaced 4 hours after transfection.
2) CY 5-labeled pH-responsive cyclodextrin nano-transfection
CY 5-labeled pH-responsive cyclodextrin (undelivered mRNA complex) was prepared according to the method in example 2.
Adding 15mg CY 5-labeled pH-responsive cyclodextrin nano-particles into 5mL 10% FBS culture medium, fully and uniformly pumping, adding into each well according to the concentration of 300, 500 and 700 mu g/mL, adding streptomycin double antibody, supplementing the culture medium to 2mL, and repeating transfection for 3 times at each concentration.
3) The CLSM assay was performed at different time points, 6, 24, and 48 hours, and intracellular CY5 fluorescence expression was observed.
The results are shown in fig. 4 c, intracellular CY5 fluorescence peaks and stabilizes 1 hour after transfection, the transfection efficiency is above 90%, and CY5 nanoparticles are uniformly dispersed in cells. The results show that the nanometer has good cell penetrability, and the transfection rate of 90-100% can be achieved after 6 hours. CY5 fluorescence was still visible at 24-48 hours.
(2) Flow-type detection of CY 5-labeled nano phagocytosis condition
1) Cell culture planking
HeLa cells were plated in culture at about 1X 10 cell count4Uniformly spreading on six-well plate, culturing overnight, and collecting cellsRow nano transfection with approximately 80% degree of coverage. Fresh medium containing 10% serum was replaced with 1mL 4 hours after transfection.
2) Flow assay CY 5-labeled pH-responsive Cyclodextrin transfection
Adding 15mg CY 5-labeled pH-responsive cyclodextrin nano-particles into 5mL 10% FBS culture medium, fully and uniformly pumping, adding the mixture into each well according to the concentration of 300, 500 and 700 mu g/mL, adding the streptomycin double antibody, supplementing the culture medium to 2mL, repeating the transfection for 3 times at each concentration, and setting blank untransfected cells as a control.
3) Cells were collected at different time points for flow assays at 0.5, 1, 3, 4, 6 hours. Washing with PBS for 2 times, adding pancreatin for digestion, blowing, collecting cells, centrifuging at 1000rpm, resuspending the cells with 200-.
The detection results are shown as d and e in fig. 4, the cells have strong uptake capacity to the pH-responsive cyclodextrin nano-particles, and the saturation amount can be reached within 1 hour. After saturation is reached, the fluorescence intensity may decrease over time. The HeLa cells can be observed to fast phagocytose the empty nano-particles within 0.5 hour, and the stable transfection concentration is still obtained after 6 hours, which indicates that the cyclodextrin nano-material has better cell penetrability.
2 CRISPR/Cas9mRNA loaded pH responsive nano in vitro experiment for detecting cell transfection condition
The CRISPR small molecule complex system nanoparticle marked by CY5 is prepared according to the method in the example 2, whether the transfection of the CRISPR small molecule complex has efficacy needs to be detected, whether the Cas9mRNA can be translated into the Cas9 protein needs to be detected, and the expression of the Cas9 protein in cytoplasm is detected through cellular immunofluorescence in the experiment.
Preparing a sterilized cell slide, placing the cell slide at the bottom of a 24-pore plate in advance, adding a 10% serum culture medium, and preheating at 37 ℃. After HeLa cells are cultured, the cells are digested by pancreatin, centrifugally resuspended into cell suspension, counted by an automatic cell counter, evenly inoculated in a 24-well plate, and cultured overnight by a conventional method. After the cells are adhered to the slide and are full in shape, the cells are transfected by Cas9+ sgRNA nano (0.5 mu g, 1 mu g and 2 mu g/mL) with different concentrations, the culture medium is replaced after 4 hours of transfection, the cells are continuously cultured for 6 hours, then the cell immunofluorescence treatment is carried out, and images are collected under a laser scanning confocal microscope.
Results as shown in fig. 4 f, g, after pH-NPA transfection of cells, Cas9 protein expression in cells was detected, and the fluorescence expression intensity was in a dose-dependent increasing trend.
Example 4
In vivo animal experiments targeting HPV 18E 7 gene
Animal experiments have been approved and ethically reviewed by the animal ethics committee of the army medical university, and all animal experiments follow animal regulations and regulations established by the country.
(1) Mouse subcutaneous transplantation tumor construction
a) 4-week-old immunodeficient nude mice, females, were purchased and housed in the animal center on a PFS scale. The nude mice were prepared for subcutaneous injection after short-term adaptation. A total of 9 mice were used. And (4) dividing into 3 groups.
b) About 1x 107HeLa cells were digested, centrifuged, counted and resuspended in 100 μ L PBS and added 1:1 ratio of matrix gel. Injecting the scapular part of a nude mouse subcutaneously, wherein each injection is 0.2mL, and constructing a cervical cancer transplantation tumor model.
(2) Tumor injection in vivo transfection
a) When the tumor grows to the diameter of about 10mm, the injection administration in the tumor is prepared.
b) Animal grouping: each group comprises 3 cells, one group is a normal saline group, one group is a liposome 3000 transfection Cas9+ E7-sgRNA, the other group is a prepared CRISPR/Cas9mRNA load pH responsiveness nanometer, and the ratio of Cas9mRNA to E7-sgRNA of a co-preparation agent is fixed to be 1: 1. The dose was 2. mu.g/mouse.
Liposome 3000 transfecting Cas9+ sgRNA:
Figure BDA0003281735360000071
the culture medium is preheated to 37 ℃ in advance in a water bath kettle.
One tube is used first
Figure BDA0003281735360000072
The culture medium was diluted 125. mu.L with Lipofectamine 3000 reagent (30uL), gently mixed well;
another tube diluted Cas9mRNA and sgRNA at the same dose of Opti-MEM and mixed well. Then 2 tubes are added together and mixed gently and evenly, and the mixture is incubated for 15min at room temperature and then prepared for animal injection. Each liquid was injected into the tumor in a volume of about 200. mu.L in total.
② pH-responsive nano host-guest self-assembly CRISPR/Cas9 small molecule compound Cas9mRNA + E7 sgRNA. The nanoparticle preparation was not labelled with CY 5. The dosage of the nanoparticles is about Cas9mRNA + E7sgRNA 2 mug each (the dosage of the cyclodextrin nanometer is 1mg), and the nanoparticles are fully mixed by normal saline, and the total volume of the liquid is about 200uL and is injected into tumor bodies at multiple points.
③ the normal saline group is injected into the tumor body with 0.2 mL.
(3) And (5) observing that the nude mice are subjected to cage grouping after no obvious abnormality exists. The body weight and tumor size of the nude mice were measured at 3-day intervals. Nude mice were sacrificed 14 days after transfection (day 15). Food was taken off overnight and only water was provided.
(4) After the nude mouse is anesthetized by inhalation at the imaging center of the small animal, blood is taken from the orbit immediately and is sent to the eye conventionally, and the liver and kidney functions are detected. Immediately thereafter, the nude mice were sacrificed by cervical amputation. Dissect tumor and viscera, take pictures, and weigh. Immunohistochemistry detected the expression of E7, pRB and p 21.
Tumor results are shown as a-d in FIG. 5, and immunohistochemical detection results are shown as e-g in FIG. 5. The tumor sizes among the three groups are different, wherein the tumor size of a CRISPR/Cas9mRNA loaded pH-responsive nano delivery system (pH-NPA) is the smallest, and the difference has a significant meaning compared with a normal saline group, and P is less than 0.01. Compared with the three tumor body weights, the pH-NPA tumor body weight is less than that of other two groups, and compared with the normal saline group, the pH-NPA tumor body weight has statistical significance, and P is less than 0.05. In the saline group, the protein expression levels of pRB and p21 were low, while in the Lipo group, the E7 protein expression was decreased compared with that in the saline group, and the protein expression levels of pRB and p21, respectively, tended to increase. The expression of the E7 protein in the pH-NPA group is obviously reduced compared with that in the former two groups, and the expression of two proteins, namely pRB and p21, is obviously increased. It is believed that, when targeted HPV E7 gene therapy, E7 gene mutation inactivation results in up-regulation of protein expression levels of pRB and p21, thereby affecting cell proliferation and inhibiting tumor growth.
Example 5
In vivo research on inhibition of tumor growth by CRISPR/Cas9mRNA complex loaded pH-responsive tracer nano-targeted cervical cancer E6
Animal experiments have been approved and ethically reviewed by the animal ethics committee of the army medical university, and all animal experiments follow animal regulations and regulations established by the country.
(1) Mouse subcutaneous transplantation tumor construction
The method for constructing the cervical cancer transplantation tumor model is the same as the method. The mice were divided into 2 groups of 16 mice.
(2) Tumor injection in vivo transfection
When the tumor grows to the diameter of about 10mm, the injection administration in the tumor is prepared.
Animal grouping: the experimental group is that the prepared CRISPR/Cas9mRNA is loaded with pH responsive nano-particles and is provided with CY5 fluorescent labels. The control group was a negative control group, i.e., a saline group. A CRISPR/Cas9mRNA loaded pH-responsive nano-delivery system was prepared. It contains Cas9mRNA + sgRNA E6, the proportion is 1:1, total amount 4. mu.g each. The preparation of the nanometer particles is carried out with CY5 fluorescent labels (cyclodextrin nanometer dosage is 1mg), the nanometer particles are diluted to 200uL by normal saline, and the nanometer particles are injected into tumor bodies in multiple points and 8 nude mice are injected. The physiological saline group 8 was operated in the same manner and 0.2mL of physiological saline was injected into the tumor.
(3) Observation of
The nude mice are packaged into cages after no obvious abnormality. 4 nude mice were sacrificed after 6 hours of injection, 2 each of pH-responsive cyclodextrin nano-sized and physiological saline were used, and the IVIS assay was performed on the small animals 10 hours after injection to observe the local fluorescence aggregation of tumor bodies. The nude mice were sacrificed 4 more 12 hours after transfection, two for each group. Tumor bodies are frozen and embedded into sections, and Cas9 protein tissue immunofluorescence detection is carried out.
The tumor size, i.e., the general condition of the nude mice, including skin changes, body weight, mental state, etc., was monitored. Tumor volume measurement: measuring and recording the tumor size by using a vernier caliper, and adopting the formula: length by width 2/2. After 6 days of injection, animal IVIS test was performed again, and the nude mice were sacrificed by cervical dislocation. Part of fresh tissues are stored at low temperature and immediately sent to be frozen and buried into slices. And (5) fixing the rest tissues in 4% paraformaldehyde solution at room temperature for 24 h. And (5) dehydrating and embedding: the tissue block was taken out, washed twice with PBS, soaked in 75% alcohol for dehydration, and then taken out and washed twice with PBS. And (5) carrying out paraffin embedding of the dehydrator in an automatic embedding machine.
Second batch of experiment
The construction method of the subcutaneous transplantation tumor of the nude mice is the same as that of the subcutaneous transplantation tumor of the nude mice, the tumor body is slightly larger and 11-12mm in size when the tumor body is injected, 14 nude mice are subjected to 2 groups of experiments.
The experimental group is that the prepared CRISPR/Cas9mRNA is loaded with pH responsive nano-particles and is provided with CY5 fluorescent labels. It contains Cas9mRNA + sgRNA E6, the proportion is 1:1, dose 2 μ g each (cyclodextrin nanodose 1 mg). Control group saline. The preparation and injection methods are the same as those described above.
At day 3 after in vivo transfection, 6 nude mice were sacrificed at each site of experimental group and control group for in situ detection of apoptosis. The body weight and tumor size of the nude mice were measured every 3 days. Nude mice were sacrificed 14 days after transfection. Food was taken off overnight and only water was provided.
After the nude mouse is inhaled and anesthetized by the imaging center of the small animal, the orbit blood is taken to detect the indexes of the blood routine, the liver and kidney functions and the like. The nude mice are sacrificed by neck breaking, dissected, and taken out the tumor body and viscera, photographed and weighed. And (5) detecting pathological tissues. Taking a tumor tissue of a mouse for immunohistochemical detection; and immunofluorescence detection; and (3) detecting the apoptosis in situ.
Animal experiment results of in vivo transfection targeting cervical carcinoma HPV 18E 6 gene show that:
(1) CY5 visible in live animal imaging
In vivo imaging of small animals (IVIS) CY5 fluorescence was observed to aggregate within the tumor mass as shown in figure 6.
(2) Cas9 expression was seen in tissues after tumor injection of the nanocomplex, as shown in fig. 7 a.
(3) Immunofluorescence detection of tissue frozen sections
The CLSM result indicates that the expression of the E6 protein in a CY5 targeted treatment region is obviously reduced compared with that of a control group, and compared with the control group, in a CY5 tracing region, when the HPV 18E 6 gene is knocked out in a targeted mode, the expression of the p53 protein is obviously increased and is co-localized with CY5, as shown in b-c in figure 7.
Fluorescence co-localization and immunohistochemistry co-localization results showed a decrease in E6 expression in the region of increased p53 expression, as shown in FIGS. 7 d-E.
(4) Tumor tissue in situ apoptosis detection
The results are shown in figure 7, f, where tumor cells co-localized with CY5 in situ. In a CY5 tracing area, the tumor cell apoptosis phenomenon is obvious, and the targeted therapy can be considered to induce the tumor cell apoptosis and inhibit the tumor growth, thereby having the anti-tumor effect.
The size difference of tumor bodies of the in vivo targeted cervical carcinoma HPV E6 after 6 days of treatment is shown as g-i in figure 7, the tumor bodies are obviously smaller than the physiological saline control group 6 days after the CRISPR/Cas9mRNA load pH responsive nano (pH-NPA) in vivo targeted treatment, and the difference has statistical significance.

Claims (8)

1. A method for constructing pH-responsive cyclodextrin nano-complexes mediating CRISPR system is characterized by comprising the following steps:
A. designing and synthesizing an sgRNA sequence according to a disease target gene, transcribing Cas9mRNA and sgRNA in vitro, and carrying out chemical modification to improve stability;
B. mixing mRNA of Cas9 subjected to chemical modification with sgRNA to obtain an inner water phase, adding the inner water phase into an organic phase solution, and uniformly mixing to form water-in-oil colostrum, wherein the organic phase solution comprises branched polyethyleneimine and acetalized beta-cyclodextrin;
C. and adding a polyvinyl alcohol solution into the water-in-oil primary emulsion, mixing to obtain a water-in-oil-in-water composite emulsion, stirring to volatilize the organic solvent, and carrying out solidification, high-speed centrifugation and washing to obtain the pH-responsive cyclodextrin nano-composite.
2. The method of claim 1, wherein in step B, the mass ratio of mRNA of Cas9 and sgRNA is 1: 1.
3. The method of claim 1, wherein in step B, the organic phase is treated with rnase-free environment for the branched polyethyleneimine and the acetalized β -cyclodextrin.
4. The construction method according to claim 1, wherein the step C is specifically that a polyvinyl alcohol solution is added into the water-in-oil colostrum, an aqueous-in-oil-in-aqueous multiple emulsion is obtained after ultrasonic mixing, magnetic stirring is carried out, standing is carried out at room temperature until solidification is carried out, high-speed centrifugation is carried out, and deionized water is used for washing for 4-5 times, so as to obtain the pH-responsive cyclodextrin nano-composite.
5. When the nanometer tracer compound is prepared, firstly, mixing CY5 tracer and ACD (acetalized beta-cyclodextrin) for reaction, the steps are the same as the above steps, and finally, dehydrating and centrifuging to obtain the pH-responsive cyclodextrin nanometer compound with the tracer marks.
6. The method of constructing according to any one of claims 1 to 5, wherein in the step A, the disease target genes are E6 and E7 genes of HPV 18-infected cervical cancer.
7. The pH-responsive cyclodextrin nanocomposite for mediating CRISPR system prepared by the construction method of any one of claims 1-6.
8. The use of the pH-responsive cyclodextrin nanocomplexes of claim 6 for targeted therapy of cervical cancer.
CN202111134414.XA 2021-09-27 2021-09-27 pH-responsive cyclodextrin nano-composite for mediating CRISPR system and construction method and application thereof Pending CN113967265A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111134414.XA CN113967265A (en) 2021-09-27 2021-09-27 pH-responsive cyclodextrin nano-composite for mediating CRISPR system and construction method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111134414.XA CN113967265A (en) 2021-09-27 2021-09-27 pH-responsive cyclodextrin nano-composite for mediating CRISPR system and construction method and application thereof

Publications (1)

Publication Number Publication Date
CN113967265A true CN113967265A (en) 2022-01-25

Family

ID=79586869

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111134414.XA Pending CN113967265A (en) 2021-09-27 2021-09-27 pH-responsive cyclodextrin nano-composite for mediating CRISPR system and construction method and application thereof

Country Status (1)

Country Link
CN (1) CN113967265A (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016108926A1 (en) * 2014-12-30 2016-07-07 The Broad Institute Inc. Crispr mediated in vivo modeling and genetic screening of tumor growth and metastasis
WO2018112470A1 (en) * 2016-12-16 2018-06-21 The Brigham And Women's Hospital, Inc. Co-delivery of nucleic acids for simultaneous suppression and expression of target genes
WO2018230785A1 (en) * 2017-06-14 2018-12-20 한국과학기술원 Non-viral gene editing crispr nanocomplex and preparation method therefor
CN113181368A (en) * 2020-01-13 2021-07-30 上海中医药大学附属龙华医院 Preparation method and application of biodegradable PLGA-TK-PEG nano drug carrier

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016108926A1 (en) * 2014-12-30 2016-07-07 The Broad Institute Inc. Crispr mediated in vivo modeling and genetic screening of tumor growth and metastasis
WO2018112470A1 (en) * 2016-12-16 2018-06-21 The Brigham And Women's Hospital, Inc. Co-delivery of nucleic acids for simultaneous suppression and expression of target genes
WO2018230785A1 (en) * 2017-06-14 2018-12-20 한국과학기술원 Non-viral gene editing crispr nanocomplex and preparation method therefor
CN113181368A (en) * 2020-01-13 2021-07-30 上海中医药大学附属龙华医院 Preparation method and application of biodegradable PLGA-TK-PEG nano drug carrier

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
凌开建: ""CRISPR/Cas9 mRNA 负载pH 响应性纳米递送系统构建及靶向宫颈 癌的抗肿瘤作用"", 《万方学位论文数据库》, pages 12 - 49 *
潘秀华;吴正红;祁小乐;: "CRISPR/Cas9递送系统的研究现状及应用进展", 中国药科大学学报, no. 01 *

Similar Documents

Publication Publication Date Title
Liu et al. Virus-like nanoparticle as a co-delivery system to enhance efficacy of CRISPR/Cas9-based cancer immunotherapy
Ye et al. Synergistic effects of cell-penetrating peptide Tat and fusogenic peptide HA2-enhanced cellular internalization and gene transduction of organosilica nanoparticles
Li et al. Low-weight polyethylenimine cross-linked 2-hydroxypopyl-β-cyclodextrin and folic acid as an efficient and nontoxic siRNA carrier for gene silencing and tumor inhibition by VEGF siRNA
Huang et al. Magnetic virus-like nanoparticles in N. benthamiana plants: a new paradigm for environmental and agronomic biotechnological research
Yang et al. Theranostic niosomes for efficient siRNA/MicroRNA delivery and activatable near-infrared fluorescent tracking of stem cells
Cheang et al. Promising plasmid DNA vector based on APTES-modified silica nanoparticles
Wang et al. Gadolinium embedded iron oxide nanoclusters as T 1–T 2 dual-modal MRI-visible vectors for safe and efficient siRNA delivery
CN103705465B (en) Cancer target administration nano-drug administration system that a kind of micro-acid environment target polypeptide is modified and preparation method thereof
CN106692984A (en) Tumor-targeted delivery carrier based on cell-derived micro-vacuoles, preparation method and application
Bhattarai et al. Hydrophobically modified chitosan/gold nanoparticles for DNA delivery
Liu et al. Paclitaxel/chitosan nanosupensions provide enhanced intravesical bladder cancer therapy with sustained and prolonged delivery of paclitaxel
CN111116904A (en) Phenylboronic acid modified fluorine-containing high polymer material and application thereof in intracellular delivery of protein
CN108904468A (en) A method of building targets extracellular vesica
CN111544598B (en) Ferritin nanoparticle loaded with Survivin double inhibitors as well as preparation method and application thereof
CN112142972A (en) Modified polyethyleneimine derivative and synthesis method and application thereof
Bakhtiar et al. PH-responsive strontium nanoparticles for targeted gene therapy against mammary carcinoma cells
CN109111575A (en) A kind of preparation method and application of metal-organic framework nano particle
CN101337076A (en) Functional dendritic polymer gene vector system of targeted malignant cerebroma
Bharti et al. Nanotechnology in stem cell research and therapy
CN104974343A (en) Modified polyethyleneimine and application thereof in the preparation of gene transfection vector reagent
CN116425973B (en) PH-responsive liver-targeted drug delivery carrier and preparation method and application thereof
Zeng et al. Biodegradable nano-organosilica gene carrier for high-efficiency gene transfection
CN107837400B (en) Novel nano gene vector and preparation method thereof
CN104606134B (en) A kind of double targeting composite nanoparticles for loading the HCPT of 7 ethyl 10 and its preparation method and application
CN113967265A (en) pH-responsive cyclodextrin nano-composite for mediating CRISPR system and construction method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination