CN113956327A

CN113956327A - Polypeptide of targeting human APC protein and application thereof in preparing medicine

Info

Publication number: CN113956327A
Application number: CN202111181312.3A
Authority: CN
Inventors: 王凤伟; 谢丹; 凌晗; 曹静桦; 林晋隆; 蔡木炎; 项志成
Original assignee: Institute Of Oncology Sun Yat Sen University; Sun Yat Sen University Cancer Center
Current assignee: Institute Of Oncology Sun Yat Sen University; Sun Yat Sen University Cancer Center
Priority date: 2021-10-11
Filing date: 2021-10-11
Publication date: 2022-01-21
Anticipated expiration: 2041-10-11
Also published as: CN113956327B

Abstract

The invention relates to the field of biomedicine, in particular to a polypeptide targeting human APC protein and application thereof in preparing a medicament for treating colorectal cancer. The polypeptide fragment of the human APC protein can target and inhibit the enucleation of the truncated APC protein, so that the polypeptide can inhibit the tumorigenicity and the proliferative capacity of colorectal cancer cells, and can be used for preparing and developing medicaments for treating colorectal cancer and/or familial adenomatous polyposis.

Description

Polypeptide of targeting human APC protein and application thereof in preparing medicine

Technical Field

The invention relates to the field of biomedicine, in particular to a polypeptide targeting human APC protein and application thereof in preparing a medicament for treating colorectal cancer and familial adenomatous polyposis.

Background

Colorectal cancer (CRC) is a common malignant tumor in human beings, and is one of the most common malignant tumors in China, and the death rate of the CRC is in the front. According to the latest data published by the national cancer center, the number of new colorectal cancer cases in China reaches 38.76 ten thousand in 2015, and accounts for about 9.87 percent of the incidence of all malignant tumors; and the death cases caused by colorectal cancer reach 18.71 thousands of people, which account for about 8 percent of all malignant tumor deaths, and cause serious social burden.

Colorectal cancer is mainly divided into sporadic colorectal cancer and familial colorectal cancer, and the vast majority of colorectal cancers are sporadic colorectal cancers. Familial Adenomatous Polyposis (FAP) accounts for approximately 1% of all colorectal cancers. The incidence of FAP is probably 1 out of every 30,000 people. The typical main clinical manifestations of FAP are: adenomatous polyps and microadenomas, which number over 100 in the colon and rectum. Polyps are visible in about 90% of FAP patients before the age of 30 years, and as the volume and number of polyps increase, most patients develop symptoms such as bloody stools, altered bowel habits, abdominal pain, and emaciation. If the surgical intervention is not performed in time, the probability of FAP to develop into colorectal cancer is 100%, and the average age of canceration is 40 years.

Because colorectal cancer is hidden and difficult to diagnose early, lymphatic metastasis or distant organ metastasis of most colorectal cancer patients already appear at the initial diagnosis, which is one of the leading causes of death. For non-surgically resectable advanced and recurrent colorectal cancer, fluorouracil + platinum-based chemotherapy remains the primary palliative treatment with low efficacy. In recent years, although targeted drugs and immunotherapy such as cetuximab, bevacizumab, trastuzumab, apatinib and the like improve survival prognosis of colorectal cancer patients to some extent, only a small number of patients benefit. Therefore, there is a great need to explore new therapeutic strategies and targets to allow for greater patient benefit.

It is well known that the occurrence and development of colorectal cancer is a complex process of multiple molecular abnormality and multiple stages of progression. It is now recognized that: mutation of the gene of APC (adenomatous polyposis coli) to cause dysfunction of its protein or abnormal expression is a key trigger step in malignant progression of colorectal cancer "adenoma-adenocarcinoma". Wherein germline mutation of the APC gene results in FAP; the somatic mutation is closely related to the occurrence and prognosis of more than 80% of sporadic colorectal adenomas and colorectal cancers. And the mouse animal model discovered in the early stage of APC gene research also confirms the driving role of APC gene mutation in the onset and progression of FAP and colorectal cancer.

The APC gene is located in the q21-22 segment of chromosome 5, and the encoded protein contains 2843 amino acids, has a molecular weight of 311.8KD and contains a plurality of structural domains. The canonical role of APC proteins is a key negative regulator in the Wnt signaling pathway. It binds to a composite of Axin (Axin), GSK3 beta and the like and inhibits the stability of beta-catenin (beta-catenin). Mutation of 95% of APCs is a nonsense mutation that results in premature termination of their translation, expressing a truncated APC protein. This truncated protein lacks the binding site for β -catenin and axin and the phosphorylation site of GSK3, resulting in elevated intracellular β -catenin levels and promotion of tumor formation. In addition, the APC protein can directly regulate and control the movement and adhesion capability of cells by combining with actin and cell adhesion molecule related proteins, namely alpha-catenin, beta-catenin and the like, so as to regulate the growth, differentiation and chromosome stability of the cells.

Multiple researches show that the APC gene mutation can cause the weakening of the adhesion capability of cells and promote the colorectal cancer cell metastasis; over-expression of the truncated APC protein can promote the migratory capacity of colorectal cancer cells, while inhibition of the truncated APC protein or its binding to interacting proteins such as Asef can significantly reduce the migratory transfer capacity of colorectal cancer cells. This suggests that the truncated APC protein is not only a loss-of-function (loss-of-function) protein that causes loss of binding ability with proteins such as β -catenin and actin, but also a protein that is likely to acquire a new function (gain-of-function) and exert an important cancer regulation promoting effect. Thus, targeting truncated APC proteins is likely to be a new strategy and an important target for colorectal cancer treatment. However, at present, no strong research on the molecular function of the truncated APC protein blocked systemically and no reports on low-toxicity drugs exist.

In recent years, in the aspect of antitumor drugs, targeted polypeptides have the characteristics of high affinity, strong specificity, few toxic and side effects, easiness in synthesis and the like, and are always research hotspots in the field of tumor treatment. Polypeptides are small, simple in structure, but generally have biological functions similar to native proteins/antibodies. Compared with antibody recognition, strong penetrability of the target polypeptide, low immunogenicity, easy chemical synthesis and modification and high batch repeatability. At present, no polypeptide research report of the truncated APC protein can be targeted.

Therefore, there is a great need in the art for a drug targeting truncated APC protein with low toxic side effects and strong specificity for the treatment of colorectal cancer and familial adenomatous polyposis.

Disclosure of Invention

In view of the above, the present invention provides a polypeptide of a targeted truncated APC protein with low toxic and side effects and high specificity, so as to effectively inhibit the tumorigenicity and proliferative capacity of colorectal cancer cells.

The system review search of the inventor summarizes the report of the truncated APC protein, and the truncated APC protein is found to be a nucleoplasmic shuttle protein. Because normal localization is an important precondition for the protein to exert the biological function, the inventor designs a plurality of polypeptides which can specifically disturb the process of enucleation or normal localization of truncated APC protein according to the amino acid sites influencing the localization of APC protein, thereby inhibiting the tumorigenicity and the proliferative capacity of colorectal cancer cells.

Accordingly, in a first aspect, the present invention provides a polypeptide targeting a human APC protein, said polypeptide comprising SEQ ID NO:1 (SEQ ID NO:7) and the remaining amino acids, when present, perfectly match the amino acid sequence of the human APC protein, said polypeptide consisting of 7-25 amino acids, preferably 10-25 amino acids, more preferably 12-23 amino acids.

In a second aspect, the present invention provides a fusion polypeptide comprising a polypeptide targeting a human APC protein according to the first aspect of the invention, and a transmembrane peptide.

In a third aspect, the present invention provides a pharmaceutical composition comprising: (1) a polypeptide targeting a human APC protein according to the first aspect of the invention, or a fusion polypeptide according to the second aspect of the invention, and (2) a pharmaceutically acceptable carrier.

In a fourth aspect, the present invention provides a use of the polypeptide targeting human APC protein according to the first aspect of the present invention, or the fusion polypeptide according to the second aspect of the present invention, for the preparation of a medicament for the treatment of colorectal cancer, colorectal cancer metastasis and/or familial adenomatous polyposis, wherein APC gene mutation is present in the colorectal cancer, colorectal cancer metastasis and/or familial adenomatous polyposis.

The invention has the beneficial effects that: the invention provides a polypeptide targeting human APC protein, which can disturb the process of enucleation or normal localization of truncated APC protein, thereby inhibiting the tumorigenicity and proliferative capacity of colorectal cancer cells. The polypeptide of the invention has small toxic and side effects and strong specificity, so that the polypeptide can be used for preparing the medicines for treating the morbidity and the metastasis of rectal cancer and/or familial adenomatous polyposis.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art that other embodiments can be obtained according to the drawings without inventive labor.

FIG. 1 shows that the knockout of endogenous mutated APC gene can significantly inhibit the tumorigenicity and proliferative capacity of colon cancer cells in nude mice. Wherein, FIG. 1A is a schematic diagram of knocking out APC genes in tumor cells SW480 and DLD-1 cell strains by a CRISPR/Cas9 method; FIG. 1B is a graph showing the results of APC protein expression of different clones detected by Western blotting; FIG. 1C shows size and HE stained sections of subcutaneous tumors formed by SW480 cell line in nude mice; FIG. 1D shows the size and HE stained sections of subcutaneous tumors formed by DLD-1 cell lines in nude mice. NC: negative control; KO: knocking out; c1, C2, C3 and C4 represent different strains of cells subjected to APC gene knockout, respectively.

FIG. 2 shows the results of immunofluorescence experiments with a plurality of human APC protein targeting polypeptides (Trun APC-NEIP1, Trun APC-NEIP2, Trun APC-NEIP3, Trun APC-NEIP4, Trun APC-NEIP5, Trun APC-NEIP6) and Trun APC-NEIP1 mut (where leucine of Trun APC-NEIP1 is mutated to alanine) designed by the inventors. NC: and (5) negative control. The experimental results show that TrunAPC-NEIP1 can cause the truncated APC protein to be not uniformly distributed in cytoplasm but to be gathered around nucleus. However, mutation of leucine to alanine in TrunaPC-NEIP1 (TrunaPC-NEIP1 mut) significantly reduced the nuclear-arrest function of TrunaPC-NEIP 1. Shortening of the TrunAPC-NEIP1 amino acid sequence from both ends (sequence TrunAPC-NEIP3 to TrunAPC-NEIP5) resulted in a reduced blocking effect compared to TrunAPC-NEIP1, while increasing the amino acid length of TrunAPC-NEIP1 ends (sequence TrunAPC-NEIP6, amino acids 58-80 of APC protein) did not improve the blocking effect.

FIG. 3 shows the effect of tail vein injection of TrunaPC-NEIP1 polypeptide on the proliferation ability of colon cancer cells in nude mice and the effect of the polypeptide on the important organs of nude mice. Wherein, fig. 3A shows the size of a subcutaneous tumor in a nude mouse model of colorectal cancer cells; FIG. 3B is a photograph of HE stained sections of subcutaneous tumors in a nude mouse model of colorectal cancer cells; NC: and (5) negative control. FIG. 3C is a graph showing the results of HE-stained sections of mouse cells of important organs (lung, liver, kidney and spleen). The experimental result shows that the tail vein injection of the TrunaPC-NEIP1 polypeptide has no obvious damage to the important organs of the mouse.

Detailed Description

The present invention will now be described more fully hereinafter with reference to the accompanying drawings, in which embodiments of the invention are shown. It is to be understood that the described embodiments are merely a subset of the present invention and not all embodiments. All other embodiments that can be derived by one of ordinary skill in the art from the embodiments disclosed herein are within the scope of the present invention.

As described above, the present invention aims to provide a polypeptide targeting truncated APC protein with low toxicity, low side effect and high specificity, which can effectively inhibit the tumorigenicity and proliferative capacity of colorectal cancer cells, and thus can be used for preparing a medicament for treating the onset and metastasis of rectal cancer and/or familial adenomatous polyposis.

As described in the background section, by "familial adenomatous polyposis" is meant an autosomal dominant genetic disorder whose clinical condition is manifested primarily as a full colorectal (large intestine) spread with adenomas of varying size. Patients have no colorectal polyps at birth, most of the patients have the colorectal polyps before and after 15 years of age, and the number of the patients is small at the beginning and increases with the age. Symptoms such as abdominal discomfort, abdominal pain, bloody stool or mucus, and increased stool frequency can occur. The large intestine polyp of FAP patient is adenomatous polyp, belongs to precancerous lesion, and if not treated in time, 100% of the precancerous lesion is generated in the end.

Precancerous lesions of the colon and rectum develop into tumors by genetic alterations of the proto-oncogenes or of the tumor suppressor genes, a process known as "adenoma-adenocarcinoma". The APC gene is a colorectal cancer suppressor gene, but mutation of the APC gene, which causes abnormal function of the protein or abnormal expression of the APC gene, is a key step for initiating malignant progression of colorectal cancer adenoma-adenocarcinoma. Among them, germline mutations in the APC gene can lead to FAP, while somatic mutations drive the development and malignant progression of most sporadic colorectal adenomas and carcinomas.

Research reports that the truncated APC protein generated by APC gene mutation is a nucleoplasmic shuttle protein, and the treatment with a nuclear blocking agent of Leptomycin B (LMB) can obviously inhibit the nuclear generation of the truncated APC protein. Since normal localization is an important precondition for the protein to exert its biological function, the inventors wanted to block the biological function by blocking the nuclear export of truncated APC protein. However, when the inventor treats cells with LMB, the inhibitor has high cytotoxicity and low specificity, and is not beneficial to developing animal in-vivo experiments and clinical transformation. Therefore, the inventors have designed a plurality of polypeptides that specifically perturb the process of enucleation or normal localization of truncated APC proteins, based on amino acid sites that affect the localization of APC proteins.

Thus, in a first aspect, the present invention provides a polypeptide targeting a human APC protein, said polypeptide comprising an amino acid sequence of positions 68-74 of the human APC protein (SEQ ID NO:7) that is a perfect match to the amino acid sequence of the human APC protein, said polypeptide consisting of 7-25 amino acids.

In a preferred embodiment, the polypeptide consists of 10-25 amino acids. In a more preferred embodiment, the polypeptide consists of 12-23 amino acids.

The term "targeting polypeptide" as used herein refers to a peptide molecule having a specific affinity for a particular biological target. The polypeptide is formed by connecting a plurality of to dozens of amino acids with different structures, properties and functions through amido bonds according to a certain sequence.

The inventors selected a plurality of polypeptide fragments comprising a partial amino acid sequence of human APC protein for immunofluorescence experiments, the polypeptide fragments comprising the following sequences:

the amino acid sequence (SEQ ID NO:2) of the 67 th to 78 th positions (TrunaPC-NEIP1) of the human APC protein (SEQ ID NO: 1);

the amino acid sequence (SEQ ID NO:4) at position 164-175 (TrunaPC-NEIP2) of the human APC protein (SEQ ID NO: 1);

the amino acid sequence (SEQ ID NO:6) of the 68 th to 77 th positions (TrunaPC-NEIP3) of the human APC protein (SEQ ID NO: 1);

the amino acid sequence (SEQ ID NO:8) of the 70 th to 77 th positions (TrunaPC-NEIP4) of the human APC protein (SEQ ID NO: 1);

the amino acid sequence (SEQ ID NO:7) of positions 68-74 (TrunaPC-NEIP5) of the human APC protein (SEQ ID NO: 1); and

the amino acid sequence (SEQ ID NO:9) at positions 58-80 (TrunaPC-NEIP6) of the human APC protein (SEQ ID NO: 1).

The inventors found that Trun APC-NEIP1, Trun APC-NEIP3, Trun APC-NEIP4, Trun APC-NEIP5 and Trun APC-NEIP6 all can cause the truncated APC protein to be not uniformly distributed in cytoplasm but to be aggregated in the periphery of nucleus, wherein the effects of Trun APC-NEIP1 and Trun APC-NEIP6 are the best. In addition, TrunaPC-NEIP1 can remarkably inhibit the proliferation of human colorectal cancer cells and the formation of intestinal adenomas of mice in two animal models. Through multiple experiments, the inventors found and considered that the most critical of them was leucine at positions 68, 69, 72, 75 and 77 of the human APC protein. And the remaining amino acids in the polypeptide must be perfectly matched to the amino acid sequence of the human APC protein in the presence of the polypeptide, since the polypeptide is a blocking type polypeptide, with the aim of blocking the effect of this fragment of the human APC protein on the binding molecule, which is sequence dependent, and if the sequences do not match, the blocking effect will be affected.

The inventors found that the size of the polypeptide fragment is most preferably 12 amino acids (i.e., TrunaPC-NEIP1), because shortening the TrunaAPC-NEIP 1 amino acid sequence from both ends reduces the nuclear blocking effect, while increasing the length of TrunaPC-NEIP1 does not increase the effect but increases the production cost. In addition, if the polypeptide fragment is too long, the production time and production difficulty are increased, and a new secondary mechanism may be generated to interfere with the action of the core peptide fragment.

Thus, in one embodiment, the polypeptide consists of SEQ ID NO:2, and (b) the amino acid sequence shown in the figure.

The term "transmembrane peptide" as used herein refers to a type of polypeptide having a function of transporting across a cell membrane. The combination of a therapeutic polypeptide with a transmembrane peptide is an effective method for enhancing the passage of the therapeutic polypeptide through the cell membrane.

In a particular embodiment, the transmembrane peptide may be SEQ ID NO: 3.

The polypeptide of the invention, including the fusion polypeptide, can be artificially synthesized, or can be obtained by synthesizing the coding gene and then carrying out biological expression.

In a fourth aspect, the present invention provides a use of the polypeptide targeting human APC protein according to the first aspect of the present invention, or the fusion polypeptide according to the second aspect of the present invention, for the preparation of a medicament for the treatment of colorectal cancer, colorectal cancer metastasis and/or familial adenomatous polyposis, wherein APC gene mutation is present in the colorectal cancer and/or familial adenomatous polyposis.

In one embodiment, the medicament is an injectable formulation.

In conclusion, the present invention provides a polypeptide targeting human APC protein, which can disturb the process of enucleation or normal localization of truncated APC protein, thereby inhibiting the tumorigenicity and proliferative capacity of colorectal cancer cells. The polypeptide of the invention has small toxic and side effects and strong specificity, so that the polypeptide can be used for preparing the medicines for treating the morbidity and the metastasis of rectal cancer and/or familial adenomatous polyposis.

Examples

The inventor selects two common CRC cell lines SW480 and DLD-1 with APC gene mutation and generating truncated APC, knocks off the endogenous mutated APC gene of the colorectal cancer cell lines SW480 and DLD-1 by a CRISPR/Cas9 method, establishes stable cell lines, and then performs a nude mouse subcutaneous tumor experiment to determine the functions of the mutated APC gene and the truncated APC protein generated by the mutated APC gene.

Example 1 function of mutant APC Gene and truncated APC protein produced by the same

1) Cell: the human colon cancer cell lines SW480 and DLD-1 used in this experiment were purchased from American Type Culture Collection (ATCC) using RPMI1640 medium containing 10% fetal bovine serum in 5% CO₂And culturing in a constant temperature incubator at 37 ℃. SW480 and DLD-1 cells both had endogenous APC gene mutations (mutations at amino acids 1338 and 1427, respectively) and produced truncated APC proteins.

2) Knocking out APC gene by a CRISPR/Cas9 method: single guide RNAs (single-guide RNAs, sgRNAs) are designed on line by using http:// criprp. mit. edu/, wherein the sequence of sgRNA-1 is as follows: CCGGCTTCCATAAGAACGGA, sgRNA-2 has the sequence CGTTCTTATGGAAGCCGGGA. The sgRNA sequence was cloned into lentiCRISPR v2 plasmid (52961, purchased from addge) by enzyme digestion and ligation, thereby constructing a knock-out vector for knocking out the APC gene in cells. Fig. 1A shows the action sites of sgRNA-1 and sgRNA-2 on the APC gene. Then, the APC knock-out vector and control empty vector were transfected into SW480 and DLD-1 cells using Lipofectamine 2000(Invitrogen), and the cells were treated with puromycin at a final concentration of 2. mu.g/ml for two weeks. Thereafter, the cells were transferred to a 96-well plate and single-cell cultured, and after 3 weeks, the single-cell cultured cells were extracted and the expression of APC protein was detected by Western blotting.

FIG. 1B shows the result of detection by Western blotting. As can be seen from the figure, the negative control group (NC) normally expressed the APC protein regardless of SW480 cells or DLD-1 cells, whereas no expression of the APC protein or a significant reduction in the expression of the APC protein was seen in the four gene-knocked-out cell clones. And selecting the clone with the APC gene successfully knocked out for continuous expansion culture for subsequent experiments.

3) Nude mice subcutaneous tumor experiment: nude mice purchased from BeijingWitonglihua company, week age 3-4 weeks, sex is not limited, each group of experiment 6. The cells of interest, i.e., the cells of the unloaded SW480 and DLD-1 cells and the monoclonal strains stably knocked out the APC gene, were expanded, and the cells in the logarithmic growth phase were digested with 0.25% trypsin and washed twice with PBS to remove the serum-containing medium. The resulting cells were counted and resuspended to 4X 10 cell concentration in serum-free medium⁶Cells/0.1 ml, then injected subcutaneously on the dorsal aspect of the hind limb of nude mice. Observations were made 2-3 times per week. After three weeks or if the tumor length is close to 2cm in the experimental process, the mice are dislocated and killed, subcutaneous tumors are taken out and photographed, and then 10% formalin fixation, paraffin embedding and slicing are carried out.

FIG. 1C is a photograph of a tumor formed by injection of tumor cells SW480 in a nude mouse, and a corresponding photograph of an HE-stained section, and FIG. 1D is a photograph of a tumor formed by injection of tumor cells DLD-1 in a nude mouse, and a corresponding photograph of an HE-stained section. As can be seen from these figures, in the NC group, i.e., in nude mice injected with cells without knocking out the APC gene, relatively large-sized tumors were formed; in the case where the APC gene was knocked out, the formed tumor volume was greatly reduced, and even the tumor disappeared (in the case of the DLD-1 cell-treated group in which the APC gene was knocked out). In HE stained sections, the NC group exhibited cells that proliferated in large amounts, whereas in the knockout SW480 cell-treated group, cell proliferation was seen to be greatly affected.

The experimental results show that the knockout of the mutant APC gene can obviously inhibit the tumorigenicity and the proliferative capacity of the colorectal cancer cells in nude mice.

Example 2 Synthesis of polypeptide targeting human APC protein

It can be understood from the results of example 1 that the truncated APC protein causes colorectal cancer. Therefore, in order to find a method for blocking the function of the truncated APC protein, the inventors thought to influence the biological function of the protein by inhibiting the enucleation of the APC protein, based on the property that the truncated APC protein is a nucleoplasmic shuttle protein.

To this end, the inventors designed a number of polypeptides that might specifically perturb the process of enucleation or normal localization of truncated APC proteins, based on amino acid sites that affect the localization of APC proteins.

The sequence of the polypeptide targeting the human APC protein is as follows:

TruneAPC-NEIP 1: amino acids 67 to 78 of the human APC protein, the sequence is DLLERLKELNLD;

TruneAPC-NEIP 2: amino acid 164-175 of human APC protein, sequence NLTKRIDSLPLT;

TruneAPC-NEIP 1 Mut: all the leucines in Trun APC-NEIP1 were mutated to alanines, sequence DAAERAKEANAD.

TruneAPC-NEIP 3: amino acids 68-77 of human APC protein, with sequence LLERLKELNL;

TruneAPC-NEIP 4: amino acids 70-77 of human APC protein, whose sequence is ERLKENLL;

TruneAPC-NEIP 5: amino acids 68-74 of human APC protein, with sequence LLERLKE;

TruneAPC-NEIP 6: the 58 th to 80 th amino acids of the human APC protein have the sequence of EAMASSGQIDLLERLKELNLDSS

In order to promote the polypeptides to enter into cells and interact with APC protein, a transmembrane peptide sequence CRGDKGPDC is added at the C terminal of each of the polypeptides, and the transmembrane peptide sequence itself is used as a control polypeptide (NC: negative control).

The polypeptide is synthesized by the national Kinsrui Biotechnology GmbH, and the solubility is measured, and the synthetic purity is more than 95%. When the utility model is used for the first time: the polypeptide powder was dissolved in DMSO to a maximum concentration, and then diluted with physiological saline to a desired concentration. The medicine is prevented from repeated freeze thawing, and is stored in a refrigerator at-80 deg.C.

Example 3 Effect of the Polypeptides of the invention on the localization of truncated APC proteins

In this example, the effect of the polypeptide on the localization of truncated APC proteins was observed by immunofluorescence.

DLD-1 cells with good logarithmic growth phase state are taken, the cells are plated in a confocal glass cuvette after conventional pancreatin digestion, and the number of the cells to be plated is calculated according to the area ratio of a cell culture dish to the confocal glass cuvette, so that the cell density of the cuvette after packaging and plating is less than 50%, and the observation of the cell morphology is facilitated. After the cells attached to the wall and recovered to normal morphology, the polypeptide was added to the conventional medium at a final concentration of 5. mu.g/0.2 ml. The medium was discarded after 24 hours, the solution was washed with PBS and fixed with 4% paraformaldehyde at room temperature for 15 minutes, the fixative was discarded and 0.5% Triton X-100 was added, and the membranes were broken at 4 ℃ for 10 minutes. And then, sealing, incubating primary antibody and secondary antibody, staining nuclei by DAPI, eluting, and adding a proper amount of 50% glycerol to prevent fluorescence quenching according to the conventional immunofluorescence steps. APC antibodies were purchased from abcam (ab16794) at a dilution ratio of 1: 100. after completion, the film was observed under a confocal laser microscope and photographed.

Fig. 2 shows the experimental results. From this figure it can be found that: trun APC-NEIP2 (amino acids 164-175) has little influence on the positioning of the truncated APC protein, the distribution of the truncated APC protein is very similar to that of a control group (NC), both are widely distributed in cytoplasm, and Trun APC-NEIP1 (amino acids 67-78) causes the truncated APC protein to agglutinate at the perinuclear and not widely distributed in cytoplasm, which shows that the polypeptide can effectively prevent the truncated APC protein from enucleating; TrunaPC-NEIP1 Mut with leucine mutated to alanine lost the above-described nuclear exclusion function. Shortening of the TrunAPC-NEIP1 amino acid sequence from both ends (sequence TrunAPC-NEIP3 to TrunAPC-NEIP5) resulted in a reduced blocking effect compared to TrunAPC-NEIP1, while increasing the amino acid length of both ends of TrunAPC-NEIP1 (sequence TrunAPC-NEIP6, amino acids 58-80 of APC protein) did not improve the blocking effect. Therefore, the inventors considered that TrunAPC-NEIP1 has a significant effect on the positioning of truncated APC proteins, and leucine therein may play an important role.

Example 4 cancer suppressing action of the polypeptide of the present invention

Furthermore, the cancer inhibition effect of the polypeptide of the invention is detected by a nude mouse subcutaneous tumor experiment of DLD-1 cells.

Nude mice purchased from Beijing Witonglihua company with age of 3-4 weeks were used, and 6 mice were used for each experiment. Serum-free medium resuspended DLD-1 cells (concentration 4X 10)⁶Individual cells/0.1 ml), injected subcutaneously on the dorsal aspect of the hind limb of nude mice. After subcutaneous tumor grows out visually, TrunaPC-NEIP1 added with transmembrane peptide at C end is injected into tail vein according to the weight of 5mg/kg or used as negative controlThe transmembrane peptide of (1) at a concentration of 75. mu.g/200. mu.l was injected twice a week for three consecutive weeks. The length and length of the tumor were measured before each injection. If the long diameter of the tumor is more than 2cm during the experiment, the experiment is stopped by dislocating and killing the mice. After the mice were sacrificed, subcutaneous tumors and important organs including heart, liver, lung, and kidney were removed, and after gross tissue photographing was performed, 10% formalin fixation, paraffin embedding, and sectioning were performed in time. HE staining of subcutaneous tumors and vital organs was observed to see whether or not there was any damage to the vital organs.

FIG. 3A is a photograph of a tumor after injection of a TrunAPC-NEIP1 polypeptide into nude mice with subcutaneous tumors, and FIG. 3B is a photograph of a corresponding HE-stained section. In the NC group, i.e., nude mice injected with transmembrane peptide only, relatively large-sized tumors formed; whereas, in the case of injection of the trun apc-NEIP1 polypeptide, the volume of the tumor formed was significantly reduced. In HE stained sections, the NC group exhibited a large number of proliferating cells, whereas in the experimental group injected with trun apc-NEIP1 polypeptide, it was seen that cell proliferation was greatly affected.

The experimental results show that the Trun APC-NEIP1 can obviously inhibit the subcutaneous proliferation capacity of the colorectal cancer cells of nude mice, and the biological toxicity of the polypeptide is low. Therefore, the polypeptide of the invention has good clinical transformation prospect in preparing the medicine for treating the occurrence and the metastasis of colorectal cancer and familial adenomatous polyposis.

TABLE 1 sequence listing

Sequence listing

<110> center for preventing and treating tumors of Zhongshan university

Subsidiary tumor hospital of Zhongshan university

Zhongshan university institute for tumor

<120> polypeptide targeting human APC protein and application thereof in preparing medicine

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2843

<212> PRT

<213> human (Homo sapiens)

<400> 1

Met Ala Ala Ala Ser Tyr Asp Gln Leu Leu Lys Gln Val Glu Ala Leu

1 5 10 15

Lys Met Glu Asn Ser Asn Leu Arg Gln Glu Leu Glu Asp Asn Ser Asn

20 25 30

His Leu Thr Lys Leu Glu Thr Glu Ala Ser Asn Met Lys Glu Val Leu

35 40 45

Lys Gln Leu Gln Gly Ser Ile Glu Asp Glu Ala Met Ala Ser Ser Gly

50 55 60

Gln Ile Asp Leu Leu Glu Arg Leu Lys Glu Leu Asn Leu Asp Ser Ser

65 70 75 80

Asn Phe Pro Gly Val Lys Leu Arg Ser Lys Met Ser Leu Arg Ser Tyr

85 90 95

Gly Ser Arg Glu Gly Ser Val Ser Ser Arg Ser Gly Glu Cys Ser Pro

100 105 110

Val Pro Met Gly Ser Phe Pro Arg Arg Gly Phe Val Asn Gly Ser Arg

115 120 125

Glu Ser Thr Gly Tyr Leu Glu Glu Leu Glu Lys Glu Arg Ser Leu Leu

130 135 140

Leu Ala Asp Leu Asp Lys Glu Glu Lys Glu Lys Asp Trp Tyr Tyr Ala

145 150 155 160

Gln Leu Gln Asn Leu Thr Lys Arg Ile Asp Ser Leu Pro Leu Thr Glu

165 170 175

Asn Phe Ser Leu Gln Thr Asp Met Thr Arg Arg Gln Leu Glu Tyr Glu

180 185 190

Ala Arg Gln Ile Arg Val Ala Met Glu Glu Gln Leu Gly Thr Cys Gln

195 200 205

Asp Met Glu Lys Arg Ala Gln Arg Arg Ile Ala Arg Ile Gln Gln Ile

210 215 220

Glu Lys Asp Ile Leu Arg Ile Arg Gln Leu Leu Gln Ser Gln Ala Thr

225 230 235 240

Glu Ala Glu Arg Ser Ser Gln Asn Lys His Glu Thr Gly Ser His Asp

245 250 255

Ala Glu Arg Gln Asn Glu Gly Gln Gly Val Gly Glu Ile Asn Met Ala

260 265 270

Thr Ser Gly Asn Gly Gln Gly Ser Thr Thr Arg Met Asp His Glu Thr

275 280 285

Ala Ser Val Leu Ser Ser Ser Ser Thr His Ser Ala Pro Arg Arg Leu

290 295 300

Thr Ser His Leu Gly Thr Lys Val Glu Met Val Tyr Ser Leu Leu Ser

305 310 315 320

Met Leu Gly Thr His Asp Lys Asp Asp Met Ser Arg Thr Leu Leu Ala

325 330 335

Met Ser Ser Ser Gln Asp Ser Cys Ile Ser Met Arg Gln Ser Gly Cys

340 345 350

Leu Pro Leu Leu Ile Gln Leu Leu His Gly Asn Asp Lys Asp Ser Val

355 360 365

Leu Leu Gly Asn Ser Arg Gly Ser Lys Glu Ala Arg Ala Arg Ala Ser

370 375 380

Ala Ala Leu His Asn Ile Ile His Ser Gln Pro Asp Asp Lys Arg Gly

385 390 395 400

Arg Arg Glu Ile Arg Val Leu His Leu Leu Glu Gln Ile Arg Ala Tyr

405 410 415

Cys Glu Thr Cys Trp Glu Trp Gln Glu Ala His Glu Pro Gly Met Asp

420 425 430

Gln Asp Lys Asn Pro Met Pro Ala Pro Val Glu His Gln Ile Cys Pro

435 440 445

Ala Val Cys Val Leu Met Lys Leu Ser Phe Asp Glu Glu His Arg His

450 455 460

Ala Met Asn Glu Leu Gly Gly Leu Gln Ala Ile Ala Glu Leu Leu Gln

465 470 475 480

Val Asp Cys Glu Met Tyr Gly Leu Thr Asn Asp His Tyr Ser Ile Thr

485 490 495

Leu Arg Arg Tyr Ala Gly Met Ala Leu Thr Asn Leu Thr Phe Gly Asp

500 505 510

Val Ala Asn Lys Ala Thr Leu Cys Ser Met Lys Gly Cys Met Arg Ala

515 520 525

Leu Val Ala Gln Leu Lys Ser Glu Ser Glu Asp Leu Gln Gln Val Ile

530 535 540

Ala Ser Val Leu Arg Asn Leu Ser Trp Arg Ala Asp Val Asn Ser Lys

545 550 555 560

Lys Thr Leu Arg Glu Val Gly Ser Val Lys Ala Leu Met Glu Cys Ala

565 570 575

Leu Glu Val Lys Lys Glu Ser Thr Leu Lys Ser Val Leu Ser Ala Leu

580 585 590

Trp Asn Leu Ser Ala His Cys Thr Glu Asn Lys Ala Asp Ile Cys Ala

595 600 605

Val Asp Gly Ala Leu Ala Phe Leu Val Gly Thr Leu Thr Tyr Arg Ser

610 615 620

Gln Thr Asn Thr Leu Ala Ile Ile Glu Ser Gly Gly Gly Ile Leu Arg

625 630 635 640

Asn Val Ser Ser Leu Ile Ala Thr Asn Glu Asp His Arg Gln Ile Leu

645 650 655

Arg Glu Asn Asn Cys Leu Gln Thr Leu Leu Gln His Leu Lys Ser His

660 665 670

Ser Leu Thr Ile Val Ser Asn Ala Cys Gly Thr Leu Trp Asn Leu Ser

675 680 685

Ala Arg Asn Pro Lys Asp Gln Glu Ala Leu Trp Asp Met Gly Ala Val

690 695 700

Ser Met Leu Lys Asn Leu Ile His Ser Lys His Lys Met Ile Ala Met

705 710 715 720

Gly Ser Ala Ala Ala Leu Arg Asn Leu Met Ala Asn Arg Pro Ala Lys

725 730 735

Tyr Lys Asp Ala Asn Ile Met Ser Pro Gly Ser Ser Leu Pro Ser Leu

740 745 750

His Val Arg Lys Gln Lys Ala Leu Glu Ala Glu Leu Asp Ala Gln His

755 760 765

Leu Ser Glu Thr Phe Asp Asn Ile Asp Asn Leu Ser Pro Lys Ala Ser

770 775 780

His Arg Ser Lys Gln Arg His Lys Gln Ser Leu Tyr Gly Asp Tyr Val

785 790 795 800

Phe Asp Thr Asn Arg His Asp Asp Asn Arg Ser Asp Asn Phe Asn Thr

805 810 815

Gly Asn Met Thr Val Leu Ser Pro Tyr Leu Asn Thr Thr Val Leu Pro

820 825 830

Ser Ser Ser Ser Ser Arg Gly Ser Leu Asp Ser Ser Arg Ser Glu Lys

835 840 845

Asp Arg Ser Leu Glu Arg Glu Arg Gly Ile Gly Leu Gly Asn Tyr His

850 855 860

Pro Ala Thr Glu Asn Pro Gly Thr Ser Ser Lys Arg Gly Leu Gln Ile

865 870 875 880

Ser Thr Thr Ala Ala Gln Ile Ala Lys Val Met Glu Glu Val Ser Ala

885 890 895

Ile His Thr Ser Gln Glu Asp Arg Ser Ser Gly Ser Thr Thr Glu Leu

900 905 910

His Cys Val Thr Asp Glu Arg Asn Ala Leu Arg Arg Ser Ser Ala Ala

915 920 925

His Thr His Ser Asn Thr Tyr Asn Phe Thr Lys Ser Glu Asn Ser Asn

930 935 940

Arg Thr Cys Ser Met Pro Tyr Ala Lys Leu Glu Tyr Lys Arg Ser Ser

945 950 955 960

Asn Asp Ser Leu Asn Ser Val Ser Ser Ser Asp Gly Tyr Gly Lys Arg

965 970 975

Gly Gln Met Lys Pro Ser Ile Glu Ser Tyr Ser Glu Asp Asp Glu Ser

980 985 990

Lys Phe Cys Ser Tyr Gly Gln Tyr Pro Ala Asp Leu Ala His Lys Ile

995 1000 1005

His Ser Ala Asn His Met Asp Asp Asn Asp Gly Glu Leu Asp Thr Pro

1010 1015 1020

Ile Asn Tyr Ser Leu Lys Tyr Ser Asp Glu Gln Leu Asn Ser Gly Arg

1025 1030 1035 1040

Gln Ser Pro Ser Gln Asn Glu Arg Trp Ala Arg Pro Lys His Ile Ile

1045 1050 1055

Glu Asp Glu Ile Lys Gln Ser Glu Gln Arg Gln Ser Arg Asn Gln Ser

1060 1065 1070

Thr Thr Tyr Pro Val Tyr Thr Glu Ser Thr Asp Asp Lys His Leu Lys

1075 1080 1085

Phe Gln Pro His Phe Gly Gln Gln Glu Cys Val Ser Pro Tyr Arg Ser

1090 1095 1100

Arg Gly Ala Asn Gly Ser Glu Thr Asn Arg Val Gly Ser Asn His Gly

1105 1110 1115 1120

Ile Asn Gln Asn Val Ser Gln Ser Leu Cys Gln Glu Asp Asp Tyr Glu

1125 1130 1135

Asp Asp Lys Pro Thr Asn Tyr Ser Glu Arg Tyr Ser Glu Glu Glu Gln

1140 1145 1150

His Glu Glu Glu Glu Arg Pro Thr Asn Tyr Ser Ile Lys Tyr Asn Glu

1155 1160 1165

Glu Lys Arg His Val Asp Gln Pro Ile Asp Tyr Ser Leu Lys Tyr Ala

1170 1175 1180

Thr Asp Ile Pro Ser Ser Gln Lys Gln Ser Phe Ser Phe Ser Lys Ser

1185 1190 1195 1200

Ser Ser Gly Gln Ser Ser Lys Thr Glu His Met Ser Ser Ser Ser Glu

1205 1210 1215

Asn Thr Ser Thr Pro Ser Ser Asn Ala Lys Arg Gln Asn Gln Leu His

1220 1225 1230

Pro Ser Ser Ala Gln Ser Arg Ser Gly Gln Pro Gln Lys Ala Ala Thr

1235 1240 1245

Cys Lys Val Ser Ser Ile Asn Gln Glu Thr Ile Gln Thr Tyr Cys Val

1250 1255 1260

Glu Asp Thr Pro Ile Cys Phe Ser Arg Cys Ser Ser Leu Ser Ser Leu

1265 1270 1275 1280

Ser Ser Ala Glu Asp Glu Ile Gly Cys Asn Gln Thr Thr Gln Glu Ala

1285 1290 1295

Asp Ser Ala Asn Thr Leu Gln Ile Ala Glu Ile Lys Glu Lys Ile Gly

1300 1305 1310

Thr Arg Ser Ala Glu Asp Pro Val Ser Glu Val Pro Ala Val Ser Gln

1315 1320 1325

His Pro Arg Thr Lys Ser Ser Arg Leu Gln Gly Ser Ser Leu Ser Ser

1330 1335 1340

Glu Ser Ala Arg His Lys Ala Val Glu Phe Ser Ser Gly Ala Lys Ser

1345 1350 1355 1360

Pro Ser Lys Ser Gly Ala Gln Thr Pro Lys Ser Pro Pro Glu His Tyr

1365 1370 1375

Val Gln Glu Thr Pro Leu Met Phe Ser Arg Cys Thr Ser Val Ser Ser

1380 1385 1390

Leu Asp Ser Phe Glu Ser Arg Ser Ile Ala Ser Ser Val Gln Ser Glu

1395 1400 1405

Pro Cys Ser Gly Met Val Ser Gly Ile Ile Ser Pro Ser Asp Leu Pro

1410 1415 1420

Asp Ser Pro Gly Gln Thr Met Pro Pro Ser Arg Ser Lys Thr Pro Pro

1425 1430 1435 1440

Pro Pro Pro Gln Thr Ala Gln Thr Lys Arg Glu Val Pro Lys Asn Lys

1445 1450 1455

Ala Pro Thr Ala Glu Lys Arg Glu Ser Gly Pro Lys Gln Ala Ala Val

1460 1465 1470

Asn Ala Ala Val Gln Arg Val Gln Val Leu Pro Asp Ala Asp Thr Leu

1475 1480 1485

Leu His Phe Ala Thr Glu Ser Thr Pro Asp Gly Phe Ser Cys Ser Ser

1490 1495 1500

Ser Leu Ser Ala Leu Ser Leu Asp Glu Pro Phe Ile Gln Lys Asp Val

1505 1510 1515 1520

Glu Leu Arg Ile Met Pro Pro Val Gln Glu Asn Asp Asn Gly Asn Glu

1525 1530 1535

Thr Glu Ser Glu Gln Pro Lys Glu Ser Asn Glu Asn Gln Glu Lys Glu

1540 1545 1550

Ala Glu Lys Thr Ile Asp Ser Glu Lys Asp Leu Leu Asp Asp Ser Asp

1555 1560 1565

Asp Asp Asp Ile Glu Ile Leu Glu Glu Cys Ile Ile Ser Ala Met Pro

1570 1575 1580

Thr Lys Ser Ser Arg Lys Ala Lys Lys Pro Ala Gln Thr Ala Ser Lys

1585 1590 1595 1600

Leu Pro Pro Pro Val Ala Arg Lys Pro Ser Gln Leu Pro Val Tyr Lys

1605 1610 1615

Leu Leu Pro Ser Gln Asn Arg Leu Gln Pro Gln Lys His Val Ser Phe

1620 1625 1630

Thr Pro Gly Asp Asp Met Pro Arg Val Tyr Cys Val Glu Gly Thr Pro

1635 1640 1645

Ile Asn Phe Ser Thr Ala Thr Ser Leu Ser Asp Leu Thr Ile Glu Ser

1650 1655 1660

Pro Pro Asn Glu Leu Ala Ala Gly Glu Gly Val Arg Gly Gly Ala Gln

1665 1670 1675 1680

Ser Gly Glu Phe Glu Lys Arg Asp Thr Ile Pro Thr Glu Gly Arg Ser

1685 1690 1695

Thr Asp Glu Ala Gln Gly Gly Lys Thr Ser Ser Val Thr Ile Pro Glu

1700 1705 1710

Leu Asp Asp Asn Lys Ala Glu Glu Gly Asp Ile Leu Ala Glu Cys Ile

1715 1720 1725

Asn Ser Ala Met Pro Lys Gly Lys Ser His Lys Pro Phe Arg Val Lys

1730 1735 1740

Lys Ile Met Asp Gln Val Gln Gln Ala Ser Ala Ser Ser Ser Ala Pro

1745 1750 1755 1760

Asn Lys Asn Gln Leu Asp Gly Lys Lys Lys Lys Pro Thr Ser Pro Val

1765 1770 1775

Lys Pro Ile Pro Gln Asn Thr Glu Tyr Arg Thr Arg Val Arg Lys Asn

1780 1785 1790

Ala Asp Ser Lys Asn Asn Leu Asn Ala Glu Arg Val Phe Ser Asp Asn

1795 1800 1805

Lys Asp Ser Lys Lys Gln Asn Leu Lys Asn Asn Ser Lys Val Phe Asn

1810 1815 1820

Asp Lys Leu Pro Asn Asn Glu Asp Arg Val Arg Gly Ser Phe Ala Phe

1825 1830 1835 1840

Asp Ser Pro His His Tyr Thr Pro Ile Glu Gly Thr Pro Tyr Cys Phe

1845 1850 1855

Ser Arg Asn Asp Ser Leu Ser Ser Leu Asp Phe Asp Asp Asp Asp Val

1860 1865 1870

Asp Leu Ser Arg Glu Lys Ala Glu Leu Arg Lys Ala Lys Glu Asn Lys

1875 1880 1885

Glu Ser Glu Ala Lys Val Thr Ser His Thr Glu Leu Thr Ser Asn Gln

1890 1895 1900

Gln Ser Ala Asn Lys Thr Gln Ala Ile Ala Lys Gln Pro Ile Asn Arg

1905 1910 1915 1920

Gly Gln Pro Lys Pro Ile Leu Gln Lys Gln Ser Thr Phe Pro Gln Ser

1925 1930 1935

Ser Lys Asp Ile Pro Asp Arg Gly Ala Ala Thr Asp Glu Lys Leu Gln

1940 1945 1950

Asn Phe Ala Ile Glu Asn Thr Pro Val Cys Phe Ser His Asn Ser Ser

1955 1960 1965

Leu Ser Ser Leu Ser Asp Ile Asp Gln Glu Asn Asn Asn Lys Glu Asn

1970 1975 1980

Glu Pro Ile Lys Glu Thr Glu Pro Pro Asp Ser Gln Gly Glu Pro Ser

1985 1990 1995 2000

Lys Pro Gln Ala Ser Gly Tyr Ala Pro Lys Ser Phe His Val Glu Asp

2005 2010 2015

Thr Pro Val Cys Phe Ser Arg Asn Ser Ser Leu Ser Ser Leu Ser Ile

2020 2025 2030

Asp Ser Glu Asp Asp Leu Leu Gln Glu Cys Ile Ser Ser Ala Met Pro

2035 2040 2045

Lys Lys Lys Lys Pro Ser Arg Leu Lys Gly Asp Asn Glu Lys His Ser

2050 2055 2060

Pro Arg Asn Met Gly Gly Ile Leu Gly Glu Asp Leu Thr Leu Asp Leu

2065 2070 2075 2080

Lys Asp Ile Gln Arg Pro Asp Ser Glu His Gly Leu Ser Pro Asp Ser

2085 2090 2095

Glu Asn Phe Asp Trp Lys Ala Ile Gln Glu Gly Ala Asn Ser Ile Val

2100 2105 2110

Ser Ser Leu His Gln Ala Ala Ala Ala Ala Cys Leu Ser Arg Gln Ala

2115 2120 2125

Ser Ser Asp Ser Asp Ser Ile Leu Ser Leu Lys Ser Gly Ile Ser Leu

2130 2135 2140

Gly Ser Pro Phe His Leu Thr Pro Asp Gln Glu Glu Lys Pro Phe Thr

2145 2150 2155 2160

Ser Asn Lys Gly Pro Arg Ile Leu Lys Pro Gly Glu Lys Ser Thr Leu

2165 2170 2175

Glu Thr Lys Lys Ile Glu Ser Glu Ser Lys Gly Ile Lys Gly Gly Lys

2180 2185 2190

Lys Val Tyr Lys Ser Leu Ile Thr Gly Lys Val Arg Ser Asn Ser Glu

2195 2200 2205

Ile Ser Gly Gln Met Lys Gln Pro Leu Gln Ala Asn Met Pro Ser Ile

2210 2215 2220

Ser Arg Gly Arg Thr Met Ile His Ile Pro Gly Val Arg Asn Ser Ser

2225 2230 2235 2240

Ser Ser Thr Ser Pro Val Ser Lys Lys Gly Pro Pro Leu Lys Thr Pro

2245 2250 2255

Ala Ser Lys Ser Pro Ser Glu Gly Gln Thr Ala Thr Thr Ser Pro Arg

2260 2265 2270

Gly Ala Lys Pro Ser Val Lys Ser Glu Leu Ser Pro Val Ala Arg Gln

2275 2280 2285

Thr Ser Gln Ile Gly Gly Ser Ser Lys Ala Pro Ser Arg Ser Gly Ser

2290 2295 2300

Arg Asp Ser Thr Pro Ser Arg Pro Ala Gln Gln Pro Leu Ser Arg Pro

2305 2310 2315 2320

Ile Gln Ser Pro Gly Arg Asn Ser Ile Ser Pro Gly Arg Asn Gly Ile

2325 2330 2335

Ser Pro Pro Asn Lys Leu Ser Gln Leu Pro Arg Thr Ser Ser Pro Ser

2340 2345 2350

Thr Ala Ser Thr Lys Ser Ser Gly Ser Gly Lys Met Ser Tyr Thr Ser

2355 2360 2365

Pro Gly Arg Gln Met Ser Gln Gln Asn Leu Thr Lys Gln Thr Gly Leu

2370 2375 2380

Ser Lys Asn Ala Ser Ser Ile Pro Arg Ser Glu Ser Ala Ser Lys Gly

2385 2390 2395 2400

Leu Asn Gln Met Asn Asn Gly Asn Gly Ala Asn Lys Lys Val Glu Leu

2405 2410 2415

Ser Arg Met Ser Ser Thr Lys Ser Ser Gly Ser Glu Ser Asp Arg Ser

2420 2425 2430

Glu Arg Pro Val Leu Val Arg Gln Ser Thr Phe Ile Lys Glu Ala Pro

2435 2440 2445

Ser Pro Thr Leu Arg Arg Lys Leu Glu Glu Ser Ala Ser Phe Glu Ser

2450 2455 2460

Leu Ser Pro Ser Ser Arg Pro Ala Ser Pro Thr Arg Ser Gln Ala Gln

2465 2470 2475 2480

Thr Pro Val Leu Ser Pro Ser Leu Pro Asp Met Ser Leu Ser Thr His

2485 2490 2495

Ser Ser Val Gln Ala Gly Gly Trp Arg Lys Leu Pro Pro Asn Leu Ser

2500 2505 2510

Pro Thr Ile Glu Tyr Asn Asp Gly Arg Pro Ala Lys Arg His Asp Ile

2515 2520 2525

Ala Arg Ser His Ser Glu Ser Pro Ser Arg Leu Pro Ile Asn Arg Ser

2530 2535 2540

Gly Thr Trp Lys Arg Glu His Ser Lys His Ser Ser Ser Leu Pro Arg

2545 2550 2555 2560

Val Ser Thr Trp Arg Arg Thr Gly Ser Ser Ser Ser Ile Leu Ser Ala

2565 2570 2575

Ser Ser Glu Ser Ser Glu Lys Ala Lys Ser Glu Asp Glu Lys His Val

2580 2585 2590

Asn Ser Ile Ser Gly Thr Lys Gln Ser Lys Glu Asn Gln Val Ser Ala

2595 2600 2605

Lys Gly Thr Trp Arg Lys Ile Lys Glu Asn Glu Phe Ser Pro Thr Asn

2610 2615 2620

Ser Thr Ser Gln Thr Val Ser Ser Gly Ala Thr Asn Gly Ala Glu Ser

2625 2630 2635 2640

Lys Thr Leu Ile Tyr Gln Met Ala Pro Ala Val Ser Lys Thr Glu Asp

2645 2650 2655

Val Trp Val Arg Ile Glu Asp Cys Pro Ile Asn Asn Pro Arg Ser Gly

2660 2665 2670

Arg Ser Pro Thr Gly Asn Thr Pro Pro Val Ile Asp Ser Val Ser Glu

2675 2680 2685

Lys Ala Asn Pro Asn Ile Lys Asp Ser Lys Asp Asn Gln Ala Lys Gln

2690 2695 2700

Asn Val Gly Asn Gly Ser Val Pro Met Arg Thr Val Gly Leu Glu Asn

2705 2710 2715 2720

Arg Leu Asn Ser Phe Ile Gln Val Asp Ala Pro Asp Gln Lys Gly Thr

2725 2730 2735

Glu Ile Lys Pro Gly Gln Asn Asn Pro Val Pro Val Ser Glu Thr Asn

2740 2745 2750

Glu Ser Ser Ile Val Glu Arg Thr Pro Phe Ser Ser Ser Ser Ser Ser

2755 2760 2765

Lys His Ser Ser Pro Ser Gly Thr Val Ala Ala Arg Val Thr Pro Phe

2770 2775 2780

Asn Tyr Asn Pro Ser Pro Arg Lys Ser Ser Ala Asp Ser Thr Ser Ala

2785 2790 2795 2800

Arg Pro Ser Gln Ile Pro Thr Pro Val Asn Asn Asn Thr Lys Lys Arg

2805 2810 2815

Asp Ser Lys Thr Asp Ser Thr Glu Ser Ser Gly Thr Gln Ser Pro Lys

2820 2825 2830

Arg His Ser Gly Ser Tyr Leu Val Thr Ser Val

2835 2840

<210> 2

<211> 12

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Asp Leu Leu Glu Arg Leu Lys Glu Leu Asn Leu Asp

1 5 10

<210> 3

<211> 9

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Cys Arg Gly Asp Lys Gly Pro Asp Cys

1 5

<210> 4

<211> 12

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Asn Leu Thr Lys Arg Ile Asp Ser Leu Pro Leu Thr

1 5 10

<210> 5

<211> 12

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Asp Ala Ala Glu Arg Ala Lys Glu Ala Asn Ala Asp

1 5 10

<210> 6

<211> 10

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Leu Leu Glu Arg Leu Lys Glu Leu Asn Leu

1 5 10

<210> 7

<211> 7

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Leu Leu Glu Arg Leu Lys Glu

1 5

<210> 8

<211> 8

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 8

Glu Arg Leu Lys Glu Leu Asn Leu

1 5

<210> 9

<211> 23

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 9

Glu Ala Met Ala Ser Ser Gly Gln Ile Asp Leu Leu Glu Arg Leu Lys

1 5 10 15

Glu Leu Asn Leu Asp Ser Ser

20

<210> 11

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ccggcttcca taagaacgga 20

<210> 11

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cgttcttatg gaagccggga 20

Claims

1. A polypeptide targeting a human APC protein, said polypeptide comprising SEQ ID NO:1 (SEQ ID NO:7) and the remaining amino acids, when present, perfectly match the amino acid sequence of the human APC protein, said polypeptide consisting of 7-25 amino acids, preferably 10-25 amino acids, more preferably 12-23 amino acids.

2. The polypeptide targeting human APC protein of claim 1 consisting of SEQ ID NO:2, and (b) the amino acid sequence shown in the figure.

3. A fusion polypeptide comprising a polypeptide targeting a human APC protein according to claim 1 or 2, and a transmembrane peptide, such as SEQ ID NO: 3.

4. A pharmaceutical composition comprising:

(1) the polypeptide targeting human APC protein according to claim 1 or 2, or the fusion polypeptide according to claim 3, and

(2) a pharmaceutically acceptable carrier.

5. Use of the polypeptide targeting human APC protein of claim 1 or 2, or the fusion polypeptide of claim 3, for the manufacture of a medicament for the treatment of colorectal cancer, colorectal cancer metastasis and/or familial adenomatous polyposis, wherein APC gene mutations are present in the colorectal cancer, colorectal cancer metastasis and/or familial adenomatous polyposis.

6. The use according to claim 5, wherein the medicament is an injectable formulation.