CN113943360B - Aquatic biological protein molecule for improving mechanical properties of silk and application method thereof - Google Patents

Aquatic biological protein molecule for improving mechanical properties of silk and application method thereof Download PDF

Info

Publication number
CN113943360B
CN113943360B CN202111202154.5A CN202111202154A CN113943360B CN 113943360 B CN113943360 B CN 113943360B CN 202111202154 A CN202111202154 A CN 202111202154A CN 113943360 B CN113943360 B CN 113943360B
Authority
CN
China
Prior art keywords
silk
gene
protein
leu
mechanical properties
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111202154.5A
Other languages
Chinese (zh)
Other versions
CN113943360A (en
Inventor
钟伯雄
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang University ZJU
Original Assignee
Zhejiang University ZJU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University ZJU filed Critical Zhejiang University ZJU
Priority to CN202111202154.5A priority Critical patent/CN113943360B/en
Publication of CN113943360A publication Critical patent/CN113943360A/en
Application granted granted Critical
Publication of CN113943360B publication Critical patent/CN113943360B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43509—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from crustaceans
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/033—Rearing or breeding invertebrates; New breeds of invertebrates
    • A01K67/0333—Genetically modified invertebrates, e.g. transgenic, polyploid
    • A01K67/0337—Genetically modified Arthropods
    • A01K67/0339—Genetically modified insects, e.g. Drosophila melanogaster, medfly
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
    • C07K14/43586—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects from silkworms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/70—Invertebrates
    • A01K2227/706—Insects, e.g. Drosophila melanogaster, medfly
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/01—Animal expressing industrially exogenous proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/103—Plasmid DNA for invertebrates
    • C12N2800/105—Plasmid DNA for invertebrates for insects
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Toxicology (AREA)
  • Insects & Arthropods (AREA)
  • Environmental Sciences (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Mycology (AREA)
  • Animal Husbandry (AREA)
  • Cell Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention discloses an aquatic organism protein molecule for improving mechanical properties of silk and an application method thereof. The method adopts single or a plurality of barnacle adhesive protein genes to construct exogenous gene vectors, integrates the barnacle adhesive protein sequences into a silkworm genome by utilizing a molecular biology technology, finally obtains a novel silkworm variety with excellent compound silk performance, and utilizes the novel silkworm variety to produce compound silk. The invention discloses application of an aquatic organism protein molecule in improving silk performance, and develops a novel high-performance composite silk.

Description

Aquatic biological protein molecule for improving mechanical properties of silk and application method thereof
Technical Field
The invention relates to a construction method and application method of a functional protein molecule, in particular to a method for manufacturing a high-performance composite yarn by utilizing an aquatic organism barnacle adhesive protein molecule and a protein molecule formed by connecting a plurality of genes of the aquatic organism barnacle adhesive protein molecule in series.
Background
The traditional silk fiber is mainly applied to textile industry, and along with the improvement of processing technology and the development of interdisciplinary disciplines, a plurality of functional silk fibers have been developed at present, and the application fields such as wound healing, biosensors, energy collection and the like are expanded.
Disclosure of Invention
In order to solve the problems in the background art, the invention aims to develop a protein molecule artificial design method formed by serially connecting barnacle adhesive protein molecules and a plurality of genes thereof, a synthetic single-or multi-polymer protein molecular structure and a method for developing a novel high-performance composite yarn by utilizing the artificial protein molecules.
Specifically, the invention designs a barnacle adhesive protein molecule and a protein molecule formed by connecting a plurality of genes of the barnacle adhesive protein molecule in series, and obtains a silkworm variety which can produce a composite silk containing single or multiple protein molecule components and fibroin components and has excellent performance by using a molecular biology technology.
The invention greatly improves the economic value of silk, opens up a new situation for producing mulberry, and has great economic benefit and wide application prospect.
In order to achieve the above purpose, the technical scheme adopted by the invention comprises the following steps:
1. An aquatic biological protein molecule for improving the mechanical property of silk:
the aquatic organism protein molecule refers to a protein sequence formed by connecting single barnacle adhesive protein genes or a plurality of barnacle adhesive protein genes in series.
The protein sequence formed by connecting a plurality of barnacle adhesive protein genes in series is formed by repeatedly connecting the protein sequences of the barnacle adhesive protein genes.
The protein sequence formed by connecting a plurality of barnacle adhesive protein genes in series is formed by repeated connection for 2-32 times.
The protein sequence of the single barnacle adhesive protein gene is SEQ ID NO.2, and the DNA base sequence is SEQ ID NO. 1.
2. The application of the aquatic organism protein molecule in gene editing and transgenic silkworms.
In particular to the application of the composite silk for improving the mechanical properties in gene editing and transgenic silkworm production.
3. The method for producing the composite silk for improving the mechanical and mechanical properties comprises the steps of firstly biosynthesizing a target gene sequence by a genetic engineering method, then constructing an exogenous gene vector by adopting a molecular biological technology, introducing the exogenous gene vector into silkworm eggs by microinjection and integrating the exogenous gene vector into silkworm genomes, carrying out multi-generation cultivation on silkworm, screening by a fluorescence microscope to obtain G1 generation positive individuals, carrying out selfing on the G1 generation positive individuals and wild type mating or positive individuals to obtain G2 generation positive individuals, screening positive individuals after the G3 generation positive individuals, adopting the positive individuals to carry out selfing seed reserving until the G8 generation positive individuals are bred into stable genetic varieties; the method is characterized in that the G8-generation silkworms are utilized to produce and secrete silk to serve as compound silk, so that the compound silk with improved mechanical properties is obtained, the target gene sequence is a gene base sequence corresponding to a protein sequence formed by connecting single barnacle adhesive protein genes or a plurality of barnacle adhesive protein genes in series according to claim 1, and finally, a novel silkworm variety with excellent compound silk performance and capable of being inherited stably is obtained.
The positive individuals refer to individuals showing fluorescence.
The wild type refers to an individual cultivated in a silkworm egg without a foreign gene vector introduced.
The exogenous gene vector corresponding to the polyprotein molecule adopts a transgenic vector taking piggyBac as a framework or a homologous recombination vector applied to gene editing.
The exogenous gene vector comprises an exogenous gene expression frame and a fluorescence screening marker gene expression frame; the exogenous gene expression frame comprises exogenous genes and promoters of the expression frame, wherein the exogenous genes are gene base sequences corresponding to protein sequences formed by connecting single barnacle adhesive protein genes or a plurality of genes in series according to claim 1, and the promoters of the exogenous gene expression frame adopt promoters of genes such as silk fibroin heavy chain, silk fibroin light chain, silk fibroin P25 or sericin;
The fluorescent screening marker gene expression frame comprises a fluorescent screening marker gene and a promoter of the expression frame, wherein the fluorescent screening marker gene adopts a green fluorescent protein Gene (GFP) or a red fluorescent protein gene (DsRed), and the promoter of the fluorescent screening marker gene expression frame adopts an IE-1, A3 or 3xP3 promoter.
The composition of the composite silk comprises protein molecule components and fibroin components, wherein the protein molecule components and the fibroin components are formed by connecting single barnacle mucin or a plurality of genes of the single barnacle mucin in series. The designed and constructed single-fold polyprotein molecule is expressed in the composite yarn, and the mechanical and mechanical properties of the composite yarn are enhanced.
Marine barnacles (Barnacle) are a class of crustaceans, and barnacle mucins are a class of secreted proteins that function outside the body and are therefore defined in the classification as "in vitro mucins". The barnacle adhesive protein consists of 5 different proteins, which are sequentially divided into: mucin (cp) 100, cp68, cp52, cp20, cp19. These proteins are located at the natural adhesion junction between the barnacle calcareous substrate and the external matrix, and all five proteins are unique among the underwater adhesion proteins, and no homologous proteins are found in the existing databases. The 5 barnacle adhesive proteins have low main structural similarity, different molecular weights and different amino acid composition favorability. The barnacle mucins are classified into 3 classes based on this: hydrophobins Mrcp k and Mrcp k; hydrophilic protein Mrcp k, which is rich in charged amino acids, and hydrophilic proteins Mrcp k and Mrcp k, which are rich in Ser, thr, gly, ala, val and Lys residues. Mrcp100k and Mrcp k are mucins involved in the self-assembly and curing process, their complexes forming the primary adhesion zone of the barnacle to the external matrix, the primary component of the barnacle mucins.
The research of the invention discovers that the stress performance, particularly the strain performance, of the recombinant silk formed by the barnacle adhesive protein Mrcp k is obviously improved, and the novel composite silk can be developed, thereby expanding the novel application of silk.
The invention creatively constructs the barnacle adhesive protein molecules to obtain the protein sequence capable of improving the mechanical properties of the silkworm composite silk.
The invention discovers a method for constructing a molecular structure of single or multiple protein and new application thereof, and develops a plurality of novel high-performance composite filaments.
The invention has the beneficial effects that:
The invention develops an artificial design and synthesis functional gene and a method for improving the mechanical property of silkworm composite silk, and obtains a plurality of functional genes, and the mechanical property of the composite silk is obviously enhanced by utilizing the genes.
Detailed Description
The invention is further illustrated below with reference to examples.
Embodiments of the invention are as follows:
Example 1
The single sequence of the barnacle mucin molecule Mrcp-100k is optimized according to the codon preference of the silkworm, the base and protein sequence of the barnacle mucin molecule Mrcp-100k established after optimization are shown as SEQ ID NO.1 and SEQ ID NO.2, the target gene sequence is biosynthesized by a genetic engineering method, a silkworm fibroin light chain promoter is used as an expression frame promoter, a red fluorescent protein marker gene expression frame with an IE-1 promoter is further used together, a transgenic vector is constructed by adopting a molecular biological technology, and the transgenic vector is introduced into silkworm eggs through microinjection and integrated into silkworm genome.
Screening G1 positive individuals through a fluorescence microscope, mating the positive individuals with wild type to obtain G2 generation, and after G3 generation, adopting the positive individuals to carry out selfing seed reserving until the G8 generation is bred into a stable inheritance variety. The G2 generation material is adopted, and the PCR experiment proves that the exogenous gene is successfully introduced into the silkworm genome. Fluorescent quantitative PCR detection shows that the expression of spider silk gene in silkworm variety is obvious. A Western blot method is adopted to prove that the silkworm composite silk contains bands of gamboge adhesive protein molecules Mrcp-100k protein with expected sizes.
The mechanical properties of the composite silk from the silkworm cocoons are tested, and the stress and strain mechanical properties of the composite silk are obviously higher than those of the wild silk.
Results of comparison and analysis of mechanical properties of single-sequence composite filaments of gamboge mucin molecules Mrcp-100k
Example 2
The method comprises the steps of adopting a 32-fold repeated tandem sequence (the gene base and the protein sequence of a single sequence are shown as SEQ ID NO.1 and SEQ ID NO. 2) of a gamboge mucin molecule Mrcp-100k sequence, optimizing according to the codon preference of silkworms, biologically synthesizing a target sequence by a genetic engineering method, adopting a silk fibroin heavy chain promoter as an expression frame promoter, further constructing a homologous recombination vector together with a green fluorescent protein marker gene expression frame adopting an A3 promoter by adopting a molecular biological technology, introducing the homologous recombination vector into silkworms by microinjection, and integrating the homologous recombination vector into the genome of the silkworms.
Screening G1 generation positive individuals through a fluorescence microscope, and carrying out selfing on the positive individuals to obtain G2 generation, wherein after the G3 generation, the positive individuals are adopted for selfing and seed reserving, and the G8 generation is bred into a stable inheritance variety. The G2 generation material is adopted, and the PCR experiment proves that the exogenous gene is successfully introduced into the silkworm genome. Fluorescent quantitative PCR detection shows that the expression of barnacle mucin molecular genes in silkworm varieties is obvious. The Western blot method is adopted to prove that the silkworm composite silk contains the strip of the repeated tandem protein with the expected size.
The mechanical properties of the silk cocoon composite silk are tested, and the stress and strain mechanical properties are obviously higher than those of the wild silk cocoon composite silk.
Mechanical property comparison analysis result of 32-fold polytandem repeat sequence composite filaments of gamboge mucin molecules Mrcp-100k
Example 3
The 4-fold repeated tandem sequence of the gamboge mucin molecule Mrcp-100k sequence is adopted, optimization is carried out according to the codon preference of the silkworm, a target sequence is biosynthesized by a genetic engineering method, a silkworm silk fibroin P25 protein promoter is adopted as an expression frame promoter, a transgenic vector is further constructed by adopting a molecular biology technology together with a green fluorescent protein marker gene expression frame adopting an IE-1 promoter, and the transgenic vector is introduced into silkworm eggs through microinjection and integrated into silkworm genome.
Screening G1 positive individuals through a fluorescence microscope, and carrying out selfing on the positive individuals to obtain G2 generation, wherein after the G3 generation, the positive individuals are adopted for selfing and seed reserving, and the stable inheritance variety is bred from the G8 generation. The G2 generation material is adopted, and the PCR experiment proves that the exogenous gene is successfully introduced into the silkworm genome. Fluorescent quantitative PCR detection shows that the expression of barnacle adhesive protein genes in silkworm varieties is obvious. A Western blot method is adopted to prove that the silkworm composite silk contains bands of repeated tandem proteins of barnacle adhesive protein molecules with expected sizes.
The mechanical properties of the silk cocoon composite silk are tested, and the stress and strain mechanical properties are obviously higher than those of the wild silk cocoon composite silk.
Mechanical property comparison analysis result of 4-fold multimeric tandem repeat sequence composite filaments of gamboge mucin molecules Mrcp-100k
The embodiment can show that the method can be used for manually designing the functional genes for improving the comprehensive mechanical properties of the silk, and the method for improving the silk properties has the advantages of strong stability, high efficiency and low cost, and can improve the economic benefit.
The foregoing detailed description is provided to illustrate the present invention and not to limit the invention, and any modifications and changes made to the present invention within the spirit of the present invention and the scope of the appended claims fall within the scope of the present invention.
The sequence related to the invention is as follows:
SEQ ID NO.1：
Name: DNA base sequence of barnacle mucin gene
The source is as follows: artificial sequence (ARTIFICIAL SEQUENCE)
CATCGGCCGTCATTTGAGCGCCGATGCTGCGGTTGTCTTAGAAGTCCAGTAGCAGCAGACTTAGATGACGATGAAATCGGGATGCTACGAGAGTATGTAAAAAAGCAAGGTGTAATGCATTATGAGTCATTATCTGATATATCGTTAAAGGCTATCTTTCGAAACAAGTTATTAAATAATTTCCCAGAGGAGGTGCCAGCAACCCGAGATGGGGTACTACAAGTGATAACAGAGTCCTTGGGTTCATTAACGGACTCAGTAGTGCCAAGTGTGTCACAGTGTGGTCAGATCGCAGGGTACCTACAGAAGTCAGTGCCAGCTTTAGCACAAGGTGGTTTTAACGTAGACCTAAAGTCACTCGTGTCATCAGCATCAGTATTACTACATCAACGAGGGGTAACGGTGAATACTGACGAGCTAAATATATTTTTAAAATATGGTCTAATCAATTACTTAAAGTCAACTGTATATCAATCATCATACAGCATGCTTAGGCAACTAATTGTAACTCTAGACTATCTTGACCATGAGCTACCAGTAATTCTAGACTACGAGGAGCTTATAGCAGTACGACTTGCACTAAAGAAGAAGTTTGATACTTCAGTAGACATCTTTAAAAATAGATACCAATTAGCTATACAATCTTACAAGGCAAATAGAAATCTATTACTAGATAGTTTTCGAACGATGGCATACCGAGGGCCAAAGTACGAGATGTATCTACAAGAGGCAATCAGGGAGACAATAAATATCTTTCCAAGTATATCACCATCAACTGTGCGCATAGTATTTAACAATCTACAATTATCAAATACTGGTAGTGGGATGGTATCACCATTAGATCTTCTAGCAATGGTAACTACTCCGGTACTAGACGATGATTTGAAGTCAATCACTAAGGTATACGCAGAGAGACTTTACAATAAAATGCCAGGTTGCTACATGGGTCAAGAGGTAGAGATTCAGGAAATGTATTTTTTATTCTTAGTAGGTATTTTGTCACAGGGTATTCAGCCACTTAATCAAATGGCTATTTACGAGTTGTTTATATATCATTCAACTATCTACTTTAGGTCTTCATGTGCATACACGGTAGACGATTACTTTTTGTTTATTAGTCGAGTAGTAAGACCAAACATTCCATTAGGTTCAAAACATTTTAAGATAATTTCATTTGACCATTCAGTAGTAATCGAGAATATATTGGTGCCAGAGCCGTGGAGATCAAATTACGAGAAGAGTCGAGATACTATAATAAAGCGACTCGTAGGTCTACAAGGGTCATCAGACCAAATTACCAAGCGATTAATCGAGGGTGGTGGTGAGAAGGGTTACATAAAGAACATTGTAAATTTGAAGCCAGCAATAACTCCACGACCACAACCAACGTATGACGCATTTGAGTACCAAAATGTACTATTGTCATCACAACATATGCAAAGGGTAGCATTTGAATTGGCAAAGAGATTTGAGGGGCTAAAGGAGCCATCTTTTCGGCTACCACTACTTAAAATTCTTGTACGCGCAAACTTAGTAACTGACACTGGGGACAAGGCTGCAGCAGCATTTCTTCGACTTTTTCAAGGTCTTCCAGTGTTTTCACGACCATCAAGTCTATCATTTATAGTGGAGCAACTAAGGGAGTATCGACTGCAAACGACAAAGGCTCAGATTAAGGCAGCTTTAGATCAATTTTTCGTAGCAACGAAGTGCCTAGGGTATGTAATCCCGCAGCAGAAGATACCATCAATCTTTTTGGCAACGGTCGGTCGATATTTGTCAACGCTGCCAACTATTCCAAAGCAACCATTTGACTATAACTTTCTGGAGTATCTGCGATATTCACTAGCAAGTATAATCGAGCATCTGCCAGCTGTAGGGTCACAATCAGTGATAGACGATTATGCAATGTATAAAATCTTTTCAATTTTTGGGCATACTAAGTTAAGTATATATGCAAAGCGAATCATAATCAAGTATATTAATGAGTATAAGTTACTACCAAAGGCAGCGCAAAACGTCCCACTGTTAGTGCAATATCAACAACTGATGGAGTCAATGGTGTCTAAGTGTTCAGTATCTTCATTTATACTATCAAAGAAACAACTTACTACGATTCAATCTGATCTGTATAAGTCAAGACGCATCAGGATTGAGTTGTCATTGTTGGTCGATATAAATTATATGGCTTATTTTGCGGTATGCCAATCTGGTGCATATACAGCGGTGATGAACAGATATGTGTATCAATCAATTATTTCATATACGCAAACGGTCCGAAAACCAAATTATTATTCTGCAGAGTTTTTCCGAATCTTGGTAGAATCATCAAAGGGGTCAAAGCTGCCAGTGTCACGACCGCCATTAGTCCAATATCGGCGAACGCCAAAGCGATTGTGCTATATAGTTCCAGGTATCGTATTATATAGGGAGCAATTAAGACAACTGGTAACTTTAATAAGGCCACGATTTACGTTTGTGTCTATGCGCAACATCCGATCAATTGTAGCGCATACTATTCTTATACTGCGAGCAAGATATTCAATTACTCAGAATAATTGCTATGGGCATCTGACTAAGTATTATAATGGGATACCAATAAATGCATTAGGAGCTTTTGACGCATATAATCTTCTGCAAACGTTAAGAGTGCAACCAAAGCGGGCAGCAATCTCAAGTGTTGGGATACAATCAGCGATGGCAGAGTTATATATGCATATGCGACATCTACAAATGCCATTTCCAAGCGATAACGACGTACGAATAACCGTATTAAGAAATTGCTTATCTGCGTATTCATCTAAGGGAATGTATCGAAATGTTCCATTTGGTCGACGATTTTTCGCATTTCTGAATACGTATCTGCCGATGAGGCGAACTGCACCAAACAAGCGATGCATGCGATATAAGAAGTCATTTAGATGC
SEQ ID NO.2：
Name: protein sequence of barnacle mucin gene
The source is as follows: artificial sequence (ARTIFICIAL SEQUENCE)
HRPSFERRCCGCLRSPVAADLDDDEIGMLREYVKKQGVMHYESLSDISLKAIFRNKLLNNFPEEVPATRDGVLQVITESLGSLTDSVVPSVSQCGQIAGYLQKSVPALAQGGFNVDLKSLVSSASVLLHQRGVTVNTDELNIFLKYGLINYLKSTVYQSSYSMLRQLIVTLDYLDHELPVILDYEELIAVRLALKKKFDTSVDIFKNRYQLAIQSYKANRNLLLDSFRTMAYRGPKYEMYLQEAIRETINIFPSISPSTVRIVFNNLQLSNTGSGMVSPLDLLAMVTTPVLDDDLKSITKVYAERLYNKMPGCYMGQEVEIQEMYFLFLVGILSQGIQPLNQMAIYELFIYHSTIYFRSSCAYTVDDYFLFISRVVRPNIPLGSKHFKIISFDHSVVIENILVPEPWRSNYEKSRDTIIKRLVGLQGSSDQITKRLIEGGGEKGYIKNIVNLKPAITPRPQPTYDAFEYQNVLLSSQHMQRVAFELAKRFEGLKEPSFRLPLLKILVRANLVTDTGDKAAAAFLRLFQGLPVFSRPSSLSFIVEQLREYRLQTTKAQIKAALDQFFVATKCLGYVIPQQKIPSIFLATVGRYLSTLPTIPKQPFDYNFLEYLRYSLASIIEHLPAVGSQSVIDDYAMYKIFSIFGHTKLSIYAKRIIIKYINEYKLLPKAAQNVPLLVQYQQLMESMVSKCSVSSFILSKKQLTTIQSDLYKSRRIRIELSLLVDINYMAYFAVCQSGAYTAVMNRYVYQSIISYTQTVRKPNYYSAEFFRILVESSKGSKLPVSRPPLVQYRRTPKRLCYIVPGIVLYREQLRQLVTLIRPRFTFVSMRNIRSIVAHTILILRARYSITQNNCYGHLTKYYNGIPINALGAFDAYNLLQTLRVQPKRAAISSVGIQSAMAELYMHMRHLQMPFPSDNDVRITVLRNCLSAYSSKGMYRNVPFGRRFFAFLNTYLPMRRTAPNKRCMRYKKSFRC.
Sequence listing
<110> University of Zhejiang
<120> Aquatic bioprotein molecules for improving mechanical properties of silk and application method thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 2
<211> 2925
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 2
catcggccgt catttgagcg ccgatgctgc ggttgtctta gaagtccagt agcagcagac 60
ttagatgacg atgaaatcgg gatgctacga gagtatgtaa aaaagcaagg tgtaatgcat 120
tatgagtcat tatctgatat atcgttaaag gctatctttc gaaacaagtt attaaataat 180
ttcccagagg aggtgccagc aacccgagat ggggtactac aagtgataac agagtccttg 240
ggttcattaa cggactcagt agtgccaagt gtgtcacagt gtggtcagat cgcagggtac 300
ctacagaagt cagtgccagc tttagcacaa ggtggtttta acgtagacct aaagtcactc 360
gtgtcatcag catcagtatt actacatcaa cgaggggtaa cggtgaatac tgacgagcta 420
aatatatttt taaaatatgg tctaatcaat tacttaaagt caactgtata tcaatcatca 480
tacagcatgc ttaggcaact aattgtaact ctagactatc ttgaccatga gctaccagta 540
attctagact acgaggagct tatagcagta cgacttgcac taaagaagaa gtttgatact 600
tcagtagaca tctttaaaaa tagataccaa ttagctatac aatcttacaa ggcaaataga 660
aatctattac tagatagttt tcgaacgatg gcataccgag ggccaaagta cgagatgtat 720
ctacaagagg caatcaggga gacaataaat atctttccaa gtatatcacc atcaactgtg 780
cgcatagtat ttaacaatct acaattatca aatactggta gtgggatggt atcaccatta 840
gatcttctag caatggtaac tactccggta ctagacgatg atttgaagtc aatcactaag 900
gtatacgcag agagacttta caataaaatg ccaggttgct acatgggtca agaggtagag 960
attcaggaaa tgtatttttt attcttagta ggtattttgt cacagggtat tcagccactt 1020
aatcaaatgg ctatttacga gttgtttata tatcattcaa ctatctactt taggtcttca 1080
tgtgcataca cggtagacga ttactttttg tttattagtc gagtagtaag accaaacatt 1140
ccattaggtt caaaacattt taagataatt tcatttgacc attcagtagt aatcgagaat 1200
atattggtgc cagagccgtg gagatcaaat tacgagaaga gtcgagatac tataataaag 1260
cgactcgtag gtctacaagg gtcatcagac caaattacca agcgattaat cgagggtggt 1320
ggtgagaagg gttacataaa gaacattgta aatttgaagc cagcaataac tccacgacca 1380
caaccaacgt atgacgcatt tgagtaccaa aatgtactat tgtcatcaca acatatgcaa 1440
agggtagcat ttgaattggc aaagagattt gaggggctaa aggagccatc ttttcggcta 1500
ccactactta aaattcttgt acgcgcaaac ttagtaactg acactgggga caaggctgca 1560
gcagcatttc ttcgactttt tcaaggtctt ccagtgtttt cacgaccatc aagtctatca 1620
tttatagtgg agcaactaag ggagtatcga ctgcaaacga caaaggctca gattaaggca 1680
gctttagatc aatttttcgt agcaacgaag tgcctagggt atgtaatccc gcagcagaag 1740
ataccatcaa tctttttggc aacggtcggt cgatatttgt caacgctgcc aactattcca 1800
aagcaaccat ttgactataa ctttctggag tatctgcgat attcactagc aagtataatc 1860
gagcatctgc cagctgtagg gtcacaatca gtgatagacg attatgcaat gtataaaatc 1920
ttttcaattt ttgggcatac taagttaagt atatatgcaa agcgaatcat aatcaagtat 1980
attaatgagt ataagttact accaaaggca gcgcaaaacg tcccactgtt agtgcaatat 2040
caacaactga tggagtcaat ggtgtctaag tgttcagtat cttcatttat actatcaaag 2100
aaacaactta ctacgattca atctgatctg tataagtcaa gacgcatcag gattgagttg 2160
tcattgttgg tcgatataaa ttatatggct tattttgcgg tatgccaatc tggtgcatat 2220
acagcggtga tgaacagata tgtgtatcaa tcaattattt catatacgca aacggtccga 2280
aaaccaaatt attattctgc agagtttttc cgaatcttgg tagaatcatc aaaggggtca 2340
aagctgccag tgtcacgacc gccattagtc caatatcggc gaacgccaaa gcgattgtgc 2400
tatatagttc caggtatcgt attatatagg gagcaattaa gacaactggt aactttaata 2460
aggccacgat ttacgtttgt gtctatgcgc aacatccgat caattgtagc gcatactatt 2520
cttatactgc gagcaagata ttcaattact cagaataatt gctatgggca tctgactaag 2580
tattataatg ggataccaat aaatgcatta ggagcttttg acgcatataa tcttctgcaa 2640
acgttaagag tgcaaccaaa gcgggcagca atctcaagtg ttgggataca atcagcgatg 2700
gcagagttat atatgcatat gcgacatcta caaatgccat ttccaagcga taacgacgta 2760
cgaataaccg tattaagaaa ttgcttatct gcgtattcat ctaagggaat gtatcgaaat 2820
gttccatttg gtcgacgatt tttcgcattt ctgaatacgt atctgccgat gaggcgaact 2880
gcaccaaaca agcgatgcat gcgatataag aagtcattta gatgc 2925
<210> 1
<211> 975
<212> PRT
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 1
His Arg Pro Ser Phe Glu Arg Arg Cys Cys Gly Cys Leu Arg Ser Pro
1 5 10 15
Val Ala Ala Asp Leu Asp Asp Asp Glu Ile Gly Met Leu Arg Glu Tyr
20 25 30
Val Lys Lys Gln Gly Val Met His Tyr Glu Ser Leu Ser Asp Ile Ser
35 40 45
Leu Lys Ala Ile Phe Arg Asn Lys Leu Leu Asn Asn Phe Pro Glu Glu
50 55 60
Val Pro Ala Thr Arg Asp Gly Val Leu Gln Val Ile Thr Glu Ser Leu
65 70 75 80
Gly Ser Leu Thr Asp Ser Val Val Pro Ser Val Ser Gln Cys Gly Gln
85 90 95
Ile Ala Gly Tyr Leu Gln Lys Ser Val Pro Ala Leu Ala Gln Gly Gly
100 105 110
Phe Asn Val Asp Leu Lys Ser Leu Val Ser Ser Ala Ser Val Leu Leu
115 120 125
His Gln Arg Gly Val Thr Val Asn Thr Asp Glu Leu Asn Ile Phe Leu
130 135 140
Lys Tyr Gly Leu Ile Asn Tyr Leu Lys Ser Thr Val Tyr Gln Ser Ser
145 150 155 160
Tyr Ser Met Leu Arg Gln Leu Ile Val Thr Leu Asp Tyr Leu Asp His
165 170 175
Glu Leu Pro Val Ile Leu Asp Tyr Glu Glu Leu Ile Ala Val Arg Leu
180 185 190
Ala Leu Lys Lys Lys Phe Asp Thr Ser Val Asp Ile Phe Lys Asn Arg
195 200 205
Tyr Gln Leu Ala Ile Gln Ser Tyr Lys Ala Asn Arg Asn Leu Leu Leu
210 215 220
Asp Ser Phe Arg Thr Met Ala Tyr Arg Gly Pro Lys Tyr Glu Met Tyr
225 230 235 240
Leu Gln Glu Ala Ile Arg Glu Thr Ile Asn Ile Phe Pro Ser Ile Ser
245 250 255
Pro Ser Thr Val Arg Ile Val Phe Asn Asn Leu Gln Leu Ser Asn Thr
260 265 270
Gly Ser Gly Met Val Ser Pro Leu Asp Leu Leu Ala Met Val Thr Thr
275 280 285
Pro Val Leu Asp Asp Asp Leu Lys Ser Ile Thr Lys Val Tyr Ala Glu
290 295 300
Arg Leu Tyr Asn Lys Met Pro Gly Cys Tyr Met Gly Gln Glu Val Glu
305 310 315 320
Ile Gln Glu Met Tyr Phe Leu Phe Leu Val Gly Ile Leu Ser Gln Gly
325 330 335
Ile Gln Pro Leu Asn Gln Met Ala Ile Tyr Glu Leu Phe Ile Tyr His
340 345 350
Ser Thr Ile Tyr Phe Arg Ser Ser Cys Ala Tyr Thr Val Asp Asp Tyr
355 360 365
Phe Leu Phe Ile Ser Arg Val Val Arg Pro Asn Ile Pro Leu Gly Ser
370 375 380
Lys His Phe Lys Ile Ile Ser Phe Asp His Ser Val Val Ile Glu Asn
385 390 395 400
Ile Leu Val Pro Glu Pro Trp Arg Ser Asn Tyr Glu Lys Ser Arg Asp
405 410 415
Thr Ile Ile Lys Arg Leu Val Gly Leu Gln Gly Ser Ser Asp Gln Ile
420 425 430
Thr Lys Arg Leu Ile Glu Gly Gly Gly Glu Lys Gly Tyr Ile Lys Asn
435 440 445
Ile Val Asn Leu Lys Pro Ala Ile Thr Pro Arg Pro Gln Pro Thr Tyr
450 455 460
Asp Ala Phe Glu Tyr Gln Asn Val Leu Leu Ser Ser Gln His Met Gln
465 470 475 480
Arg Val Ala Phe Glu Leu Ala Lys Arg Phe Glu Gly Leu Lys Glu Pro
485 490 495
Ser Phe Arg Leu Pro Leu Leu Lys Ile Leu Val Arg Ala Asn Leu Val
500 505 510
Thr Asp Thr Gly Asp Lys Ala Ala Ala Ala Phe Leu Arg Leu Phe Gln
515 520 525
Gly Leu Pro Val Phe Ser Arg Pro Ser Ser Leu Ser Phe Ile Val Glu
530 535 540
Gln Leu Arg Glu Tyr Arg Leu Gln Thr Thr Lys Ala Gln Ile Lys Ala
545 550 555 560
Ala Leu Asp Gln Phe Phe Val Ala Thr Lys Cys Leu Gly Tyr Val Ile
565 570 575
Pro Gln Gln Lys Ile Pro Ser Ile Phe Leu Ala Thr Val Gly Arg Tyr
580 585 590
Leu Ser Thr Leu Pro Thr Ile Pro Lys Gln Pro Phe Asp Tyr Asn Phe
595 600 605
Leu Glu Tyr Leu Arg Tyr Ser Leu Ala Ser Ile Ile Glu His Leu Pro
610 615 620
Ala Val Gly Ser Gln Ser Val Ile Asp Asp Tyr Ala Met Tyr Lys Ile
625 630 635 640
Phe Ser Ile Phe Gly His Thr Lys Leu Ser Ile Tyr Ala Lys Arg Ile
645 650 655
Ile Ile Lys Tyr Ile Asn Glu Tyr Lys Leu Leu Pro Lys Ala Ala Gln
660 665 670
Asn Val Pro Leu Leu Val Gln Tyr Gln Gln Leu Met Glu Ser Met Val
675 680 685
Ser Lys Cys Ser Val Ser Ser Phe Ile Leu Ser Lys Lys Gln Leu Thr
690 695 700
Thr Ile Gln Ser Asp Leu Tyr Lys Ser Arg Arg Ile Arg Ile Glu Leu
705 710 715 720
Ser Leu Leu Val Asp Ile Asn Tyr Met Ala Tyr Phe Ala Val Cys Gln
725 730 735
Ser Gly Ala Tyr Thr Ala Val Met Asn Arg Tyr Val Tyr Gln Ser Ile
740 745 750
Ile Ser Tyr Thr Gln Thr Val Arg Lys Pro Asn Tyr Tyr Ser Ala Glu
755 760 765
Phe Phe Arg Ile Leu Val Glu Ser Ser Lys Gly Ser Lys Leu Pro Val
770 775 780
Ser Arg Pro Pro Leu Val Gln Tyr Arg Arg Thr Pro Lys Arg Leu Cys
785 790 795 800
Tyr Ile Val Pro Gly Ile Val Leu Tyr Arg Glu Gln Leu Arg Gln Leu
805 810 815
Val Thr Leu Ile Arg Pro Arg Phe Thr Phe Val Ser Met Arg Asn Ile
820 825 830
Arg Ser Ile Val Ala His Thr Ile Leu Ile Leu Arg Ala Arg Tyr Ser
835 840 845
Ile Thr Gln Asn Asn Cys Tyr Gly His Leu Thr Lys Tyr Tyr Asn Gly
850 855 860
Ile Pro Ile Asn Ala Leu Gly Ala Phe Asp Ala Tyr Asn Leu Leu Gln
865 870 875 880
Thr Leu Arg Val Gln Pro Lys Arg Ala Ala Ile Ser Ser Val Gly Ile
885 890 895
Gln Ser Ala Met Ala Glu Leu Tyr Met His Met Arg His Leu Gln Met
900 905 910
Pro Phe Pro Ser Asp Asn Asp Val Arg Ile Thr Val Leu Arg Asn Cys
915 920 925
Leu Ser Ala Tyr Ser Ser Lys Gly Met Tyr Arg Asn Val Pro Phe Gly
930 935 940
Arg Arg Phe Phe Ala Phe Leu Asn Thr Tyr Leu Pro Met Arg Arg Thr
945 950 955 960
Ala Pro Asn Lys Arg Cys Met Arg Tyr Lys Lys Ser Phe Arg Cys
965 970 975

Claims (6)

1. An application of an aquatic organism protein molecule for improving mechanical properties of silk is characterized in that: the application in gene editing and transgenic silkworms, in particular to the preparation of composite wires for improving mechanical properties by gene editing and transgenic silkworms production;
The aquatic organism protein molecule is protein formed by connecting a plurality of barnacle adhesive protein genes in series; the protein sequence of the single barnacle adhesive protein gene is SEQ ID NO.2.
2. The use of an aquatic bioprotein molecule of claim 1 for enhancing mechanical properties, wherein: the protein sequence formed by connecting a plurality of barnacle adhesive protein genes in series is formed by repeated connection for 2-32 times.
3. An application of an aquatic organism protein molecule for improving mechanical properties of silk is characterized in that: the application in gene editing and transgenic silkworms, in particular to the preparation of composite wires for improving mechanical properties by gene editing and transgenic silkworms production;
The aquatic organism protein molecule refers to a protein sequence formed by single barnacle adhesive protein genes;
The protein sequence of the single barnacle adhesive protein gene is SEQ ID NO.2.
4. The method for producing the composite silk for improving the mechanical property comprises the steps of firstly biosynthesizing a target gene sequence by a genetic engineering method, then constructing an exogenous gene vector by adopting a molecular biological technology, introducing the exogenous gene vector into silkworm eggs by microinjection and integrating the exogenous gene vector into silkworm genomes, carrying out multi-generation cultivation on silkworms, screening by a fluorescence microscope to obtain G1 generation positive individuals, carrying out selfing on the G1 generation positive individuals and wild type mating or positive individuals to obtain G2 generation positive individuals, screening positive individuals after the G3 generation positive individuals, adopting the positive individuals to carry out selfing seed reserving until the G8 generation positive individuals are bred into stable inherited varieties, and producing secreted silk by utilizing the silkworms of the G8 generation, and is characterized in that: the target gene sequence is a gene base sequence corresponding to the aquatic organism protein molecule according to claim 1 or claim 3, so that a silkworm variety with excellent composite silk performance capable of being inherited stably is finally obtained, and the silkworm variety of the G8 generation is utilized for producing secretory silk to be used as the composite silk, so that the composite silk with improved mechanical properties is obtained;
the composition of the composite silk comprises protein molecule components and fibroin components, wherein the protein molecule components and the fibroin components are formed by connecting single barnacle mucin or a plurality of genes of the single barnacle mucin in series.
5. The method for producing the composite yarn with improved mechanical properties according to claim 4, wherein the method comprises the following steps: the exogenous gene vector is a transgenic vector taking piggyBac as a framework or a homologous recombination vector applied to gene editing.
6. The method for producing the composite yarn with improved mechanical properties according to claim 4 or 5, wherein: the exogenous gene vector comprises an exogenous gene expression frame and a fluorescence screening marker gene expression frame; the exogenous gene expression frame comprises exogenous genes and promoters of the expression frame, wherein the exogenous genes are gene base sequences corresponding to the aquatic organism protein molecules in claim 1 or claim 3, and the promoters of the exogenous gene expression frame adopt promoters of silk fibroin heavy chains, silk fibroin light chains, silk fibroin P25 or sericin genes;
the fluorescent screening marker gene expression frame comprises a fluorescent screening marker gene and a promoter of the expression frame, wherein the fluorescent screening marker gene adopts a green fluorescent protein Gene (GFP) or a red fluorescent protein gene (DsRed), and the promoter of the fluorescent screening marker gene expression frame adopts an IE-1, A3 or 3xP3 promoter.
CN202111202154.5A 2021-10-15 2021-10-15 Aquatic biological protein molecule for improving mechanical properties of silk and application method thereof Active CN113943360B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111202154.5A CN113943360B (en) 2021-10-15 2021-10-15 Aquatic biological protein molecule for improving mechanical properties of silk and application method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111202154.5A CN113943360B (en) 2021-10-15 2021-10-15 Aquatic biological protein molecule for improving mechanical properties of silk and application method thereof

Publications (2)

Publication Number Publication Date
CN113943360A CN113943360A (en) 2022-01-18
CN113943360B true CN113943360B (en) 2024-05-14

Family

ID=79330141

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111202154.5A Active CN113943360B (en) 2021-10-15 2021-10-15 Aquatic biological protein molecule for improving mechanical properties of silk and application method thereof

Country Status (1)

Country Link
CN (1) CN113943360B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114605516B (en) * 2022-03-25 2023-11-07 中国人民解放军国防科技大学 Barnacle mucin 20K derivative polypeptide with self-assembly characteristic and biomineralization function, and preparation method and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105647937A (en) * 2016-02-29 2016-06-08 中国海洋大学 In-vitro expression method and application of scallop byssus protein
CN111500591A (en) * 2020-05-11 2020-08-07 浙江大学 Application of spider poly-adenoid fibroin gene sequence and method for improving properties of silkworm silk
CN111518832A (en) * 2020-05-11 2020-08-11 浙江大学 Application of spider piriform gland silk protein gene sequence and method for improving performance of silkworm silk
CN113088533A (en) * 2021-04-15 2021-07-09 华中科技大学 Yeast engineering bacterium for efficiently expressing barnacle viscose protein and preparation method thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105647937A (en) * 2016-02-29 2016-06-08 中国海洋大学 In-vitro expression method and application of scallop byssus protein
CN111500591A (en) * 2020-05-11 2020-08-07 浙江大学 Application of spider poly-adenoid fibroin gene sequence and method for improving properties of silkworm silk
CN111518832A (en) * 2020-05-11 2020-08-11 浙江大学 Application of spider piriform gland silk protein gene sequence and method for improving performance of silkworm silk
CN113088533A (en) * 2021-04-15 2021-07-09 华中科技大学 Yeast engineering bacterium for efficiently expressing barnacle viscose protein and preparation method thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
cement protein-100k [Megabalanus rosa]，GenBank: BAB12269.1.GenBank数据库.2020,LOCUS、DEFINITION、VERSION 、SOURCE、FEATURES和ORIGIN部分. *
蜘蛛丝的结构性能及表达策略研究进展;郑青亮等;《蚕业科学》;第35卷(第3期);685-691 *

Also Published As

Publication number Publication date
CN113943360A (en) 2022-01-18

Similar Documents

Publication Publication Date Title
CN102358902B (en) Silkworm fibroin heavy-chain gene mutation sequence and mutation method and application
CN102844326B (en) The separation of insoluble target protein
CN105400815B (en) The method for synthesizing secretion latrodectus mactans traction silk-fibroin 1 using domestic natural silk gland bioreactor
CN113943360B (en) Aquatic biological protein molecule for improving mechanical properties of silk and application method thereof
CN1200145A (en) Cloning methods for high strength spider silk proteins
CN111518832B (en) Application of spider piriform gland silk protein gene sequence and method for improving performance of silkworm silk
CN111500591B (en) Application of spider poly-adenoid fibroin gene sequence and method for improving properties of silkworm silk
GB2162190A (en) Improvements in or relating to production of silk
CN109844112A (en) Genetic recombination bagworm silk
CN108642059B (en) Modified gene with cell proliferation promoting factor suitable for silkworm expression and expression vector and application thereof
CN111518831A (en) Application of spider botryoid gland silk protein gene sequence and method for improving performance of silkworm silk
CN110551190B (en) Method for producing spider silk by using silkworm
CN113563446A (en) Single polyprotein molecule for improving mechanical properties and application method thereof
CN110066323A (en) Microalgae catches photoprotein NoHLR1 gene and its application
CN113136202A (en) Preparation method of fluorescent silk material
JP5098039B2 (en) Silk thread with improved compound binding efficiency
CN105400817B (en) Utilize the method for the silkworm simultaneously synthesizing traction of secretion latrodectus mactans silk-fibroin 1 and albumen 2
CN102191249B (en) Silkworm Bmlp3 gene promoter and use thereof
WO2014052975A1 (en) Expression systems and methods of producing spider silk proteins
CN105018521B (en) Cultivate the method and its relevant biological material of the genetically modified plants of fluorescin mCherry label tubulin
CN105463022B (en) The method for synthesizing secretion latrodectus mactans traction silk-fibroin 2 using domestic natural silk gland bioreactor
CN106191088B (en) A set of method that escherichia coli chromosome is arrived into the optimized recombination of plasmid expression system
CN105907786B (en) Double-promoter universal plasmid for expressing T4ligase of bombyx mori middle silk gland bioreactor and application and method thereof
CN101492678A (en) Domestic silkworm silk glandulae specificity expressive HLH transcription regulate and control factor BmHLH2
US10023619B1 (en) Production of spider silk protein in corn

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant