CN113930494B - Detection method for genotyping of 152 gene loci related to allergy of children - Google Patents
Detection method for genotyping of 152 gene loci related to allergy of children Download PDFInfo
- Publication number
- CN113930494B CN113930494B CN202111113119.6A CN202111113119A CN113930494B CN 113930494 B CN113930494 B CN 113930494B CN 202111113119 A CN202111113119 A CN 202111113119A CN 113930494 B CN113930494 B CN 113930494B
- Authority
- CN
- China
- Prior art keywords
- dna
- artificial
- children
- gene loci
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B40/00—Libraries per se, e.g. arrays, mixtures
- C40B40/04—Libraries containing only organic compounds
- C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application discloses a detection method for genotyping 152 gene loci related to children allergy, which comprises the steps of collecting saliva or oral swab of a detection object, and extracting DNA; carrying out PCR (polymerase chain reaction) amplification on 152 gene loci by taking the obtained DNA as a template, and carrying out magnetic bead purification on amplified products; connecting index sequences of the purified products, and purifying the purified products by magnetic beads again to obtain a PCR library; carrying out gene sequencing on the PCR library, and obtaining genotyping results of 152 gene loci related to the child allergy according to the sequencing results; the 152 gene loci in the detection method can comprehensively evaluate the allergic genetic condition of children from the biological point of view, help parents to know the allergic risk of children, guide science, effectively reduce the serious allergic occurrence of children, and provide early detection, early intervention and early treatment for the allergen of children; in addition, the detection method is simple to operate, short in time and high in efficiency.
Description
Technical Field
The application relates to the technical field of genotyping, in particular to a detection method for genotyping 152 gene loci related to children allergy.
Background
An allergen is a foreign protein or hapten that is capable of inducing the production of specific IgE antibodies and eliciting an allergic response. Most allergen proteins can be recognized by sensitive individuals and elicit allergic reactions. Not all proteins in allergens are allergenic, which is related to the genetic susceptibility of individuals, the complexity of the allergen, and the interaction of the allergen and IgE is the basis for the pathogenesis of allergic diseases. Most allergens are composed of proteins, which have the same properties as common antigens, i.e. stimulate the body to produce immunoglobulins. At the same time, the allergens generate an overstimulated immune response, namely an allergic response, for sensitive individuals due to the special biochemical and physicochemical properties. A number of exogenous factors allow the immune system to recognize these proteins by altering host defense mechanisms. These factors include: genetic factors, industrial contaminants, smoking, viral infections, and the like.
Classification of allergens: 1. gas-borne allergens: pollen, fungi, dust mites, animal allergens; 2. oral allergen: foods and pharmaceuticals; 3. injectable allergens: most of them are caused by insect stings and also by injectable drugs.
Childhood allergy refers to a series of clinical manifestations of a child with idiosyncratic constitution, after exposure to allergens, the most severe of which is anaphylactic shock. The onset, manifestation and course of childhood allergy are different, and are related to genetic information, allergen intensity, health status of the child, etc. The gene factor directly determines whether the crowd has anaphylactic atopy, and environmental factors and life style can influence anaphylactic reaction and even the occurrence of anaphylactic diseases, the intensity of symptoms and the like. At present, allergic reactions of children in China are common, and the prevalence rate of allergic diseases tends to rise year by year. Numerous epidemiological studies have demonstrated that certain allergic symptoms in early childhood or infants are often predictive of the occurrence of other allergic diseases in the future: first, it shows symptoms of infantile eczema or food allergy, and then it develops allergic rhinitis and asthma. Clinically, most of common allergen detection is skin test, and part of allergens can be used for detecting the content of blood IgE. However, these tests are often performed after the patient has exhibited severe allergic reactions, which severely affect the life health of the child. Especially for infants with difficult to express their symptoms clearly, the effects of allergic reactions are more disastrous. Thus, predicting and preventing the occurrence of allergic diseases as early as possible is an effective way to mitigate the effects of allergic reactions on the life health of children.
Disclosure of Invention
The application aims to provide a detection method for genotyping 152 gene loci related to children allergy, which can realize simultaneous amplification of 152 gene loci related to children allergy in the same system, further can realize detection of 152 gene loci related to allergy, and is beneficial to early prediction and prevention of allergic diseases.
In order to achieve the above object of the present application, the following technical solutions are specifically adopted:
the first aspect of the application provides a method for detecting genotyping of 152 gene loci related to allergy of children, comprising the following steps:
(a) Collecting saliva or oral swab of a detected subject, and extracting DNA;
(b) Carrying out PCR (polymerase chain reaction) amplification on 152 gene loci by taking the obtained DNA as a template, and carrying out magnetic bead purification on amplified products, wherein the 152 gene loci are respectively subjected to PCR amplification in two groups, and the first group is 85 gene loci: rs, rs rs, rs rs, rs7192, rs rs, rs rs, rs;
the second group is 67 gene loci: rs, rs rs, rs rs, rs2070874, rs rs, rs rs, rs;
the upstream amplification primer sequences sequentially corresponding to the first group of gene loci are shown as SEQ ID NO: 1-85, and the sequence of the downstream amplification primer is shown as SEQ ID NO: 86-170;
the sequence of the upstream amplification primer corresponding to the second group of gene loci in sequence is shown as SEQ ID NO: 171-237, the downstream amplification primer sequence is shown as SEQ ID NO: 238-304;
(c) Connecting index sequences of the purified products, and purifying the purified products by magnetic beads again to obtain a PCR library;
(d) And (3) carrying out gene sequencing on the PCR library, and obtaining genotyping results of 152 gene loci related to the child allergy according to the sequencing results.
Preferably, the working concentration of the amplification primers corresponding to 152 gene loci in the PCR amplification system is 0.05-0.40 mu M respectively.
Preferably, the PCR amplification system further comprises a DNA polymerase premix and a PCR enhancer.
Preferably, the PCR amplification procedure of the first set of gene loci is as follows:
Heat lid 150℃，95℃for 3min 30s，(98℃for 20s，58℃for 4min)× 18cycles，72℃for 5min。
preferably, the PCR amplification procedure of the second set of gene loci is as follows:
Heat lid 150℃，95℃for 3min 30s，(98℃for 20s，60℃for 4min)× 18cycles，72℃for 5min。
preferably, the magnetic beads used for purifying the magnetic beads are AMPure XP magnetic beads.
Preferably, the index sequence includes IGT-15index and IGT-17index.
Compared with the prior art, the application has the beneficial effects that at least:
the detection method can amplify 152 gene loci of the same individual in the same system, so that the detection of 152 gene loci related to allergy can be realized, and the detection method is favorable for predicting and preventing allergic diseases as early as possible; the 152 gene loci cover three major types of allergens including air transmission, oral administration and injection and common allergic diseases, so that the allergic genetic condition of children can be comprehensively estimated from the biological perspective, parents are helped to know the allergic risk of the children, the serious allergic occurrence of the children is scientifically and effectively reduced, and the allergen is discovered, intervened and treated early in advance for the children; in addition, the detection method is simple in operation, short in time and high in efficiency.
The detection method of the application adopts two rounds of PCR reaction to construct the library, and has the advantages of short library construction period, high comparison rate, high capture rate, good uniformity, good repeatability, simple operation and the like.
Drawings
In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below. Like elements or portions are generally identified by like reference numerals throughout the several figures. In the drawings, elements or portions thereof are not necessarily drawn to scale.
FIG. 1 is a graph showing the distribution of the base ratio obtained by sequencing in the examples of the present application;
FIG. 2 is a distribution diagram of insert sizes obtained by sequencing in the examples of the present application;
FIG. 3 is a plot of depth accumulation profile obtained by sequencing in an embodiment of the present application;
FIG. 4 is a depth profile obtained by sequencing in an embodiment of the present application;
FIG. 5 is a plot of the depth profile of a single region obtained by sequencing in an embodiment of the present application.
Detailed Description
Embodiments of the technical scheme of the present application will be described in detail below with reference to the embodiments. The following examples are only for more clearly illustrating the technical aspects of the present application, and thus are merely examples, and are not intended to limit the scope of the present application.
It is noted that unless otherwise indicated, technical or scientific terms used herein should be given the ordinary meaning as understood by one of ordinary skill in the art to which this application belongs.
The embodiment of the application provides a detection method for genotyping 152 gene loci related to children allergy, which comprises the following steps:
(a) Collecting saliva or oral swab of a detected subject, and extracting DNA;
(b) Carrying out PCR (polymerase chain reaction) amplification on 152 gene loci by taking the obtained DNA as a template, and carrying out magnetic bead purification on amplified products, wherein the 152 gene loci are respectively subjected to PCR amplification in two groups, and the first group is 85 gene loci: rs, rs rs, rs rs, rs7192, rs rs, rs rs, rs;
the second group is 67 gene loci: rs, rs rs, rs rs, rs2070874, rs rs, rs rs, rs;
the upstream amplification primer sequences sequentially corresponding to the first group of gene loci are shown as SEQ ID NO: 1-85, and the sequence of the downstream amplification primer is shown as SEQ ID NO: 86-170;
the sequence of the upstream amplification primer corresponding to the second group of gene loci is shown as SEQ ID NO: 171-237, the downstream amplification primer sequence is shown as SEQ ID NO: 238-304;
specifically, the primer sequences corresponding to the respective gene loci are shown in the following table;
(c) Connecting index sequences of the purified products, and purifying the purified products by magnetic beads again to obtain a PCR library;
(d) And (3) carrying out gene sequencing on the PCR library, and obtaining genotyping results of 152 gene loci related to the child allergy according to the sequencing results.
In one embodiment, the working concentrations of the amplification primers corresponding to the 152 loci are respectively 0.05-0.40 mu M; for example, it may be specifically 0.05. Mu.M, 0.10. Mu.M, 0.20. Mu.M or 0.40. Mu.M.
Further, a DNA polymerase premix and a PCR enhancer are also included in the PCR amplification system.
In one embodiment, the PCR amplification procedure for the first set of gene loci is as follows:
Heat lid 150℃，95℃for 3min 30s，(98℃for 20s，58℃for 4min)× 18cycles，72℃for 5min。
the PCR amplification procedure for the second set of gene loci was as follows:
Heat lid 150℃，95℃for 3min 30s，(98℃for 20s，60℃for 4min)× 18cycles，72℃for 5min。
further, the magnetic beads adopted in the magnetic bead purification are AMPure XP magnetic beads; the index sequences included IGT-15index (general sequence AATG ATACGGCG ACCACCGAGATCT, SEQ ID NO: 305) and IGT-17index (general sequence CAAGCAGAAGACGGCATACGAGAT, SEQ ID NO: 306).
The technical scheme of the application is further described in detail through specific examples.
Examples
The embodiment is a detection method for genotyping 152 gene loci related to allergy of children, which comprises the following steps:
(a) Saliva of the test subjects is collected, and DNA is extracted:
collecting saliva of a detection object, adding an extraction buffer solution into a saliva sample, repeatedly blowing and mixing the extraction buffer solution, centrifuging at 8000 Xg for 5min, discarding the supernatant, and repeating the step once; adding lysate and proteinase K into the obtained precipitate, thoroughly suspending the precipitate, fully mixing, standing at room temperature for 30min, and reversing the centrifuge tube for several times; adding 10uL of aqueous solution of RNase with concentration of 10mg/mL into the obtained mixed solution, and standing at 37 ℃ for 10min; adding an equal volume of phenol-chloroform mixed solution into the obtained supernatant, fully and uniformly mixing the mixed solution, wherein the volume ratio of phenol to chloroform is 1.0, centrifuging the mixed solution at 4 ℃ for 5min at 12000 Xg, and transferring the supernatant into a clean centrifuge tube; adding an equal volume of benzene atmosphere-chloroform-isoamyl alcohol mixed solution, wherein the volume ratio of phenol to chloroform to isoamyl alcohol is 25:24:1, fully and uniformly mixing, centrifuging at 4 ℃ and 12000 Xg for 5min, and transferring the supernatant into a clean centrifuge tube; adding an equal volume of chloroform-isoamyl alcohol mixed solution, fully and uniformly mixing, centrifuging at 3-5 ℃ for 5min at 12000 Xg, and transferring the supernatant into a clean centrifuge tube; adding 0.6 times volume of ice bath isopropanol solution and 0.10 times volume of 3.0mol/L sodium acetate solution, standing at-20deg.C for 60min, centrifuging at 12000 Xg for 10min, and discarding supernatant; adding 0.5mL of 70% ethanol into the obtained precipitate, cleaning the precipitate, centrifuging at 4deg.C and 12000 Xg for 5min, discarding supernatant, and repeating the steps once; naturally air drying the obtained precipitate, adding 20 μl of sterile ultrapure water, dissolving back, and preserving at-20deg.C;
(b) Carrying out PCR amplification on the obtained DNA, and carrying out magnetic bead purification on the amplified product:
the PCR reaction is divided into 2 reaction tubes, and the used multiplex primers are respectively Primer pool T1 (namely amplification primers corresponding to the first group of gene loci) and Primer pool T2 (namely amplification primers corresponding to the second group of gene loci); the other reagents in the 2 reaction tubes were identical and the liquids were prepared as shown in table 1 below:
TABLE 1
gDNA is the DNA extracted in the step (a);
the PCR conditions were as follows:
the T1 tube runs the PCR instrument program:
Heat lid 150℃，95℃for 3min 30s，(98℃for 20s，58℃for 4min)×18cycles， 72℃for 5min；
the T2 tube runs the PCR instrument program:
Heat lid 150℃，95℃for 3min 30s，(98℃for 20s，60℃for 4min)×18cycles， 72℃for 5min；
combining the PCR reaction products of the T1 pipe and the T2 pipe;
the above combined product was purified by magnetic beads, specifically as follows:
1) Adding 27 μl of AMPure XP magnetic beads after room temperature equilibration into 30 μl of the PCR pooled product, gently pipetting and beating with a pipette for 20 times;
2) After 5min incubation at room temperature, the PCR tube is placed on a DynaMag-96Side magnetic rack for 3min;
3) Thoroughly removing the supernatant, taking the PCR tube off the magnetic rack, adding 50 μl of YF buffer B into the tube, and gently sucking and beating with a pipette for 20 times;
4) After 5min incubation at room temperature, the PCR tube is placed on a DynaMag-96Side magnetic rack for 3min;
5) Removing the supernatant, placing the PCR tube on a magnetic rack, adding 180 μl of 80% ethanol solution into the tube, and standing for 30s;
6) The supernatant was removed, the PCR tube was placed on a magnetic rack, 180. Mu.l of 80% ethanol solution was added to the tube, and after standing for 30s, the supernatant was thoroughly removed (10. Mu.l of a pipette was recommended to remove the bottom residual ethanol solution);
7) Standing at room temperature for 3min to volatilize residual ethanol thoroughly;
8) Taking the PCR tube off the magnetic frame, adding 24 μl of nucleic-free water, gently sucking and beating the re-suspended magnetic beads by a pipettor, avoiding generating bubbles, and standing at room temperature for 2min;
9) The PCR tube is placed on a magnetic rack again, and is kept stand for 3min;
10 18. Mu.l of the supernatant was pipetted into a new 200. Mu.l PCR tube, the tube supernatant being the pooled multiplex PCR product;
(c) Connecting index sequences of the magnetic bead purification products, and purifying the magnetic beads again to obtain a PCR library;
the reaction system for the ligation of the index sequences for the magnetic bead purification products is shown in Table 2:
TABLE 2
| Reagent | Volume(μl) |
| PCR product mixture [1] | 18 |
| IGT-15 Index(10μM) | 1 |
| IGT-17 Index(10μM) | 1 |
| IGT-EM808 polymerase mixture | 10 |
Note that: [1] PCR product mixture the multiple PCR products after the previous purification
The reaction conditions were as follows:
running a PCR instrument program:
round 2 magnetic bead purification:
steps 1) to 9) are the same as the magnetic bead purification method in step (b) above;
10 20. Mu.l of the supernatant was pipetted into a new PCR tube, the supernatant in the tube being the prepared multiplex PCR library; quantitative and quality detection of the library;
(d) Using an Illumina second generation sequencer to perform gene sequencing on the PCR library according to the sequencing routine steps, and obtaining the genotyping results of 152 gene loci related to the child allergy according to the sequencing results;
the sequenced base ratio profile is shown in FIG. 1, the insert size profile is shown in FIG. 2, the depth accumulation profile is shown in FIG. 3, the depth profile is shown in FIG. 4, and the single interval depth profile is shown in FIG. 5;
FIG. 1 shows that in the multiplex PCR technique, the four kinds of bases are unevenly distributed due to the technical characteristics.
The size distribution of the insert reaction library of FIG. 2, typically peaks between 150-250 bp;
FIG. 3 cumulative ratio of different sequencing depths (homogenization treatment, average depth of 1) for the target region, e.g., 90 at 0.2, representing 90% of the target region sequencing depth being greater than or equal to 20% of the average depth;
FIG. 4 is a graph of the ratio of different sequencing depths (homogenization treatment, average depth of 1) for a target region, such as 0.5 on the ordinate for depth 1, representing 0.5% of the target region sequencing depth equal to the sample average depth, the graph generally being in a Poisson distribution around the average depth;
in fig. 5, each section is numbered on the abscissa, and the depth of the section is indicated on the ordinate (the average depth value is 0 after the sorting and the homogenization treatment). After the average depth of each continuous section is uniformized, the uniformity can be observed from another angle.
The above results indicate that the uniformity of the sequencing results is good.
Carrying out quality assessment on sequencing data, counting indexes such as contrast ratio, coverage rate, capture rate and the like, assessing whether library building sequencing reaches a standard or not, and carrying out subsequent analysis if the library building sequencing meets the standard; wherein, the evaluation result is that the comparison rate is 99.10%, the coverage rate is 99.21%, and the capture rate is 98.94%.
The application can predict allergic diseases according to gene loci:
for example, atopic dermatitis is a chronic, recurrent, inflammatory skin disease that manifests mainly as severe itching, obvious eczematoid changes and dry skin. In addition to the common skin manifestations, about 30% of patients are associated with asthma, and about 35% of patients are associated with allergic rhinitis. At present, immune abnormalities, particularly Th1/Th2 imbalance, are mostly considered to be causative of atopic dermatitis. Environmental factors also play an important role in the onset of atopic dermatitis. Weather and environmental dryness can affect the onset of atopic dermatitis; various allergic reaction precursors attack the human body, cause sensitization of the human body, cause allergic inflammatory reactions of the skin, and cause the onset of atopic dermatitis.
When the locus rs2897442 of the KIF3A gene is T/T or C/T, the risk of atopic dermatitis is not increased, and the mutant genotype is not found;
when the locus rs2897442 of the KIF3A gene is C/C, the risk of atopic dermatitis is increased, and the genotype is low risk.
Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present application, and not for limiting the same; although the application has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some or all of the technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit of the application, and are intended to be included within the scope of the appended claims and description.
SEQUENCE LISTING
<110> Feikeyi (Guangzhou) Gene technology Co., ltd
<120> a method for detecting genotyping of 152 loci associated with allergy in children
<130> 202107
<160> 306
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> DNA
<213> Artificial
<400> 1
agtgagagct tgacagtttg g 21
<210> 2
<211> 21
<212> DNA
<213> Artificial
<400> 2
gagtcagtgc ttttcttcgg a 21
<210> 3
<211> 22
<212> DNA
<213> Artificial
<400> 3
gctcccagaa ggaagtttaa ca 22
<210> 4
<211> 21
<212> DNA
<213> Artificial
<400> 4
agcccaccaa catacattga g 21
<210> 5
<211> 22
<212> DNA
<213> Artificial
<400> 5
aaagctggaa tatggcttcc aa 22
<210> 6
<211> 22
<212> DNA
<213> Artificial
<400> 6
gcagaatgag aaagaccaca gt 22
<210> 7
<211> 20
<212> DNA
<213> Artificial
<400> 7
caccattctc cagcaatccc 20
<210> 8
<211> 25
<212> DNA
<213> Artificial
<400> 8
gtctgtataa tctcaaagtg ccaga 25
<210> 9
<211> 20
<212> DNA
<213> Artificial
<400> 9
tgccacaggc taggagaaat 20
<210> 10
<211> 22
<212> DNA
<213> Artificial
<400> 10
ggatgcattt gcaagagtgt tc 22
<210> 11
<211> 20
<212> DNA
<213> Artificial
<400> 11
gttgaaatca cttcggggca 20
<210> 12
<211> 20
<212> DNA
<213> Artificial
<400> 12
caaccctaca gctccaaagc 20
<210> 13
<211> 22
<212> DNA
<213> Artificial
<400> 13
tgatgggcag cttcttcatt tt 22
<210> 14
<211> 21
<212> DNA
<213> Artificial
<400> 14
caagctttct gggatgagca a 21
<210> 15
<211> 21
<212> DNA
<213> Artificial
<400> 15
tttcagtgga acaggagtcc a 21
<210> 16
<211> 20
<212> DNA
<213> Artificial
<400> 16
cattggaggc tggaacttcg 20
<210> 17
<211> 22
<212> DNA
<213> Artificial
<400> 17
atcaccagca aatgacagag tg 22
<210> 18
<211> 21
<212> DNA
<213> Artificial
<400> 18
agcccaatca gttttgcctt t 21
<210> 19
<211> 24
<212> DNA
<213> Artificial
<400> 19
ctaacataag catttgaaaa ctgt 24
<210> 20
<211> 20
<212> DNA
<213> Artificial
<400> 20
tgatgtgcct gacactggat 20
<210> 21
<211> 21
<212> DNA
<213> Artificial
<400> 21
tgatacctgg cacttcacag t 21
<210> 22
<211> 20
<212> DNA
<213> Artificial
<400> 22
gagtggacaa gaggagctgt 20
<210> 23
<211> 20
<212> DNA
<213> Artificial
<400> 23
tccaggtaag agccgaactg 20
<210> 24
<211> 20
<212> DNA
<213> Artificial
<400> 24
gccaagctgc tccagaaaat 20
<210> 25
<211> 20
<212> DNA
<213> Artificial
<400> 25
acttgggaat ggctgtgagt 20
<210> 26
<211> 22
<212> DNA
<213> Artificial
<400> 26
tcatcatctt cctctgaccc ac 22
<210> 27
<211> 24
<212> DNA
<213> Artificial
<400> 27
gcctattagg aatacttgcc actg 24
<210> 28
<211> 20
<212> DNA
<213> Artificial
<400> 28
tgacactggg gtctcaactg 20
<210> 29
<211> 20
<212> DNA
<213> Artificial
<400> 29
cttaatctgg cagtgcggtg 20
<210> 30
<211> 22
<212> DNA
<213> Artificial
<400> 30
tcactctctt ctttgccttc ca 22
<210> 31
<211> 20
<212> DNA
<213> Artificial
<400> 31
tgtgggcatc actcatccaa 20
<210> 32
<211> 21
<212> DNA
<213> Artificial
<400> 32
gatgctgatg aggagcaggt a 21
<210> 33
<211> 20
<212> DNA
<213> Artificial
<400> 33
gcctcccagt gttggttttc 20
<210> 34
<211> 24
<212> DNA
<213> Artificial
<400> 34
tactggctat cagtctcttc agtg 24
<210> 35
<211> 20
<212> DNA
<213> Artificial
<400> 35
ttagggcatc tgtgaacccc 20
<210> 36
<211> 20
<212> DNA
<213> Artificial
<400> 36
gtggactctg ctgctaaggt 20
<210> 37
<211> 20
<212> DNA
<213> Artificial
<400> 37
ctgcttgttc atcgcaacca 20
<210> 38
<211> 21
<212> DNA
<213> Artificial
<400> 38
ttcttcagag gccagatcac c 21
<210> 39
<211> 21
<212> DNA
<213> Artificial
<400> 39
cattaccctc ccagctcttg t 21
<210> 40
<211> 21
<212> DNA
<213> Artificial
<400> 40
gagtggattg caccagtcct a 21
<210> 41
<211> 20
<212> DNA
<213> Artificial
<400> 41
cagctaaggg gcaggaatca 20
<210> 42
<211> 21
<212> DNA
<213> Artificial
<400> 42
tgctgttggc cttttatcag c 21
<210> 43
<211> 20
<212> DNA
<213> Artificial
<400> 43
gcctccaaac tcaatggctg 20
<210> 44
<211> 22
<212> DNA
<213> Artificial
<400> 44
atggattgga atcccatggt ca 22
<210> 45
<211> 22
<212> DNA
<213> Artificial
<400> 45
gacatctggt ttggaagact gc 22
<210> 46
<211> 20
<212> DNA
<213> Artificial
<400> 46
gtttccagtc tggttgggga 20
<210> 47
<211> 21
<212> DNA
<213> Artificial
<400> 47
cagagtttga tgctccaagc c 21
<210> 48
<211> 20
<212> DNA
<213> Artificial
<400> 48
atagggtgca ttcggagtgg 20
<210> 49
<211> 20
<212> DNA
<213> Artificial
<400> 49
tacagagcat gtacagcggg 20
<210> 50
<211> 20
<212> DNA
<213> Artificial
<400> 50
ccagctttct cttgtgggga 20
<210> 51
<211> 20
<212> DNA
<213> Artificial
<400> 51
cacagcacca agttcaaccc 20
<210> 52
<211> 21
<212> DNA
<213> Artificial
<400> 52
gagcatattg gcagaaggtg c 21
<210> 53
<211> 21
<212> DNA
<213> Artificial
<400> 53
gtgatgctaa tgcacgacca g 21
<210> 54
<211> 21
<212> DNA
<213> Artificial
<400> 54
tatgaatgcc ctcagcccaa a 21
<210> 55
<211> 21
<212> DNA
<213> Artificial
<400> 55
taggggaagc gttcagagtt g 21
<210> 56
<211> 20
<212> DNA
<213> Artificial
<400> 56
cccttcagag aagctggcat 20
<210> 57
<211> 20
<212> DNA
<213> Artificial
<400> 57
tgtccgtccc tgttttgtgt 20
<210> 58
<211> 20
<212> DNA
<213> Artificial
<400> 58
tggttgtgag tatgagcccg 20
<210> 59
<211> 22
<212> DNA
<213> Artificial
<400> 59
agaggctgaa atgatcaagg ct 22
<210> 60
<211> 21
<212> DNA
<213> Artificial
<400> 60
tagaatttca gggtggcctc g 21
<210> 61
<211> 20
<212> DNA
<213> Artificial
<400> 61
ccccgtacag tcttgctacc 20
<210> 62
<211> 20
<212> DNA
<213> Artificial
<400> 62
ggcatagggg actcaaggtg 20
<210> 63
<211> 22
<212> DNA
<213> Artificial
<400> 63
tgcagagctc agtatgctca at 22
<210> 64
<211> 24
<212> DNA
<213> Artificial
<400> 64
gccatagcga caagacttaa acaa 24
<210> 65
<211> 20
<212> DNA
<213> Artificial
<400> 65
tgccctctca gaccttacca 20
<210> 66
<211> 20
<212> DNA
<213> Artificial
<400> 66
cctccccgca gagaattacc 20
<210> 67
<211> 20
<212> DNA
<213> Artificial
<400> 67
aggagatgct gtgggcaaaa 20
<210> 68
<211> 20
<212> DNA
<213> Artificial
<400> 68
aaactcagaa gggaagcgca 20
<210> 69
<211> 20
<212> DNA
<213> Artificial
<400> 69
ccttgtcagg gtcagtgctt 20
<210> 70
<211> 22
<212> DNA
<213> Artificial
<400> 70
cgcctgctca aagagaaatg ag 22
<210> 71
<211> 20
<212> DNA
<213> Artificial
<400> 71
gtgcttccaa cgcacaactt 20
<210> 72
<211> 20
<212> DNA
<213> Artificial
<400> 72
cacgatctac tcgctgcctt 20
<210> 73
<211> 21
<212> DNA
<213> Artificial
<400> 73
ccacccaata cactgtccca a 21
<210> 74
<211> 21
<212> DNA
<213> Artificial
<400> 74
tccaacccga aaacaatgca c 21
<210> 75
<211> 22
<212> DNA
<213> Artificial
<400> 75
gctgggaaac aaggtaggag aa 22
<210> 76
<211> 20
<212> DNA
<213> Artificial
<400> 76
tggaaggctt gtgctgtagg 20
<210> 77
<211> 20
<212> DNA
<213> Artificial
<400> 77
aggggccatc cagaaacttg 20
<210> 78
<211> 22
<212> DNA
<213> Artificial
<400> 78
ccccaacctc agtacattcc aa 22
<210> 79
<211> 20
<212> DNA
<213> Artificial
<400> 79
ccttcccctc caaaagtccc 20
<210> 80
<211> 20
<212> DNA
<213> Artificial
<400> 80
accagaagag aggctgggat 20
<210> 81
<211> 22
<212> DNA
<213> Artificial
<400> 81
atcaacaccc aacaggcaaa tg 22
<210> 82
<211> 22
<212> DNA
<213> Artificial
<400> 82
tcttccttgg gctgcaatac tt 22
<210> 83
<211> 20
<212> DNA
<213> Artificial
<400> 83
gctgtttgtc tctccgtcca 20
<210> 84
<211> 21
<212> DNA
<213> Artificial
<400> 84
tccagggctc cttcctgatt a 21
<210> 85
<211> 21
<212> DNA
<213> Artificial
<400> 85
tctaggctct tgcctgtctc t 21
<210> 86
<211> 21
<212> DNA
<213> Artificial
<400> 86
tgtgtggcaa acgtgtagta a 21
<210> 87
<211> 20
<212> DNA
<213> Artificial
<400> 87
accctggctt tgtcccttac 20
<210> 88
<211> 22
<212> DNA
<213> Artificial
<400> 88
gggagtggga atgctgtatc ta 22
<210> 89
<211> 23
<212> DNA
<213> Artificial
<400> 89
cccccacata aaataacctt ccc 23
<210> 90
<211> 20
<212> DNA
<213> Artificial
<400> 90
taggtggtgg gggttagctt 20
<210> 91
<211> 20
<212> DNA
<213> Artificial
<400> 91
tttccaaaca ctgcccaacg 20
<210> 92
<211> 22
<212> DNA
<213> Artificial
<400> 92
agcacagggt tctgattagg ag 22
<210> 93
<211> 22
<212> DNA
<213> Artificial
<400> 93
aggctttaaa gacccatttg ct 22
<210> 94
<211> 22
<212> DNA
<213> Artificial
<400> 94
atggcacact ttcatcactt cc 22
<210> 95
<211> 20
<212> DNA
<213> Artificial
<400> 95
agtcagcagg agggacaatg 20
<210> 96
<211> 21
<212> DNA
<213> Artificial
<400> 96
atgcagagag tgagcacatg g 21
<210> 97
<211> 25
<212> DNA
<213> Artificial
<400> 97
ctgattagtg tgttgaagac ttcct 25
<210> 98
<211> 23
<212> DNA
<213> Artificial
<400> 98
actgtctccc acatagaaag act 23
<210> 99
<211> 21
<212> DNA
<213> Artificial
<400> 99
aacagcctgg tagaaaggag a 21
<210> 100
<211> 21
<212> DNA
<213> Artificial
<400> 100
atccctctcc ccaagcttac t 21
<210> 101
<211> 20
<212> DNA
<213> Artificial
<400> 101
tgtggatagg gcccccaaat 20
<210> 102
<211> 25
<212> DNA
<213> Artificial
<400> 102
tacttttcca aacaggcaat ctctg 25
<210> 103
<211> 22
<212> DNA
<213> Artificial
<400> 103
ccttcctagc tgttgttccc at 22
<210> 104
<211> 21
<212> DNA
<213> Artificial
<400> 104
gtagttaacc ctgttgagat c 21
<210> 105
<211> 20
<212> DNA
<213> Artificial
<400> 105
tagaggtgca tcctggctac 20
<210> 106
<211> 20
<212> DNA
<213> Artificial
<400> 106
cctctggcct acacagaaga 20
<210> 107
<211> 20
<212> DNA
<213> Artificial
<400> 107
ttcctgagcc tactcctgcg 20
<210> 108
<211> 21
<212> DNA
<213> Artificial
<400> 108
tttccccaaa gacactgacc a 21
<210> 109
<211> 22
<212> DNA
<213> Artificial
<400> 109
aggtgtcaga ttttccctca ga 22
<210> 110
<211> 24
<212> DNA
<213> Artificial
<400> 110
agacaggtta gagacttcct ttcc 24
<210> 111
<211> 23
<212> DNA
<213> Artificial
<400> 111
ctcatctgtg tctgagattg gca 23
<210> 112
<211> 20
<212> DNA
<213> Artificial
<400> 112
aacccagcct gcacaaagat 20
<210> 113
<211> 20
<212> DNA
<213> Artificial
<400> 113
ggcccagact agaaagggat 20
<210> 114
<211> 25
<212> DNA
<213> Artificial
<400> 114
tctctcatga attctggaag tggaa 25
<210> 115
<211> 21
<212> DNA
<213> Artificial
<400> 115
aaacaattcc ccatcccctg a 21
<210> 116
<211> 20
<212> DNA
<213> Artificial
<400> 116
ataaaagggc tggtttgccg 20
<210> 117
<211> 20
<212> DNA
<213> Artificial
<400> 117
ggagcacagc atcaatcctt 20
<210> 118
<211> 20
<212> DNA
<213> Artificial
<400> 118
acgctccttc cactgacatt 20
<210> 119
<211> 20
<212> DNA
<213> Artificial
<400> 119
ttggcttttg agggaagtgc 20
<210> 120
<211> 21
<212> DNA
<213> Artificial
<400> 120
ctgcatcact gggttgttac g 21
<210> 121
<211> 22
<212> DNA
<213> Artificial
<400> 121
aaggcaacta gacactacca ca 22
<210> 122
<211> 20
<212> DNA
<213> Artificial
<400> 122
agctgagtcc agccaaagtt 20
<210> 123
<211> 21
<212> DNA
<213> Artificial
<400> 123
catgtccagc cttctctgtt c 21
<210> 124
<211> 21
<212> DNA
<213> Artificial
<400> 124
cagtgggagg agcttgatgt t 21
<210> 125
<211> 21
<212> DNA
<213> Artificial
<400> 125
ttctcatagc aaccctgtgg t 21
<210> 126
<211> 20
<212> DNA
<213> Artificial
<400> 126
ctaccacctc gtggctgttt 20
<210> 127
<211> 21
<212> DNA
<213> Artificial
<400> 127
aaatatacgg ctggcaccac a 21
<210> 128
<211> 20
<212> DNA
<213> Artificial
<400> 128
ggagagttca ctgtcgcaga 20
<210> 129
<211> 24
<212> DNA
<213> Artificial
<400> 129
tgaagtcatc atcaacttgg aacc 24
<210> 130
<211> 21
<212> DNA
<213> Artificial
<400> 130
cccacaagtt tggtctgttg g 21
<210> 131
<211> 20
<212> DNA
<213> Artificial
<400> 131
acttgcccag aggctaaagg 20
<210> 132
<211> 21
<212> DNA
<213> Artificial
<400> 132
accacaccta actcacctcc a 21
<210> 133
<211> 21
<212> DNA
<213> Artificial
<400> 133
agtgtttcca aggcaaacca a 21
<210> 134
<211> 21
<212> DNA
<213> Artificial
<400> 134
gctaatttct gccacgcaac t 21
<210> 135
<211> 20
<212> DNA
<213> Artificial
<400> 135
tgaggtgccc tcattcaacc 20
<210> 136
<211> 24
<212> DNA
<213> Artificial
<400> 136
caccagtatc catttaatgc ctca 24
<210> 137
<211> 20
<212> DNA
<213> Artificial
<400> 137
acgctatttt ccggggtcaa 20
<210> 138
<211> 22
<212> DNA
<213> Artificial
<400> 138
agtgccatgc tgtgaaggat aa 22
<210> 139
<211> 22
<212> DNA
<213> Artificial
<400> 139
aagccactaa aatccacagg gt 22
<210> 140
<211> 21
<212> DNA
<213> Artificial
<400> 140
tacccctgta aaccatgtgg g 21
<210> 141
<211> 20
<212> DNA
<213> Artificial
<400> 141
gagtgccata gggagcaagt 20
<210> 142
<211> 20
<212> DNA
<213> Artificial
<400> 142
aatgggcaga gcttccaagg 20
<210> 143
<211> 20
<212> DNA
<213> Artificial
<400> 143
tggctttgtc agaccgactc 20
<210> 144
<211> 23
<212> DNA
<213> Artificial
<400> 144
tgtaggcata aaaagttagc ggc 23
<210> 145
<211> 20
<212> DNA
<213> Artificial
<400> 145
gccacccatc ctctctagtt 20
<210> 146
<211> 20
<212> DNA
<213> Artificial
<400> 146
cttggctcca gtgctactct 20
<210> 147
<211> 19
<212> DNA
<213> Artificial
<400> 147
ttcaccccat ggagttggg 19
<210> 148
<211> 20
<212> DNA
<213> Artificial
<400> 148
atccaggaag gacgtctgct 20
<210> 149
<211> 22
<212> DNA
<213> Artificial
<400> 149
agtgactagt atggaaggca cc 22
<210> 150
<211> 25
<212> DNA
<213> Artificial
<400> 150
tgatcgtctt ctaggtgaga tttgt 25
<210> 151
<211> 20
<212> DNA
<213> Artificial
<400> 151
cccagctcgt agttgtgtct 20
<210> 152
<211> 20
<212> DNA
<213> Artificial
<400> 152
ggtgccccag tcaaacagta 20
<210> 153
<211> 20
<212> DNA
<213> Artificial
<400> 153
cattcacgca ttgggcaact 20
<210> 154
<211> 20
<212> DNA
<213> Artificial
<400> 154
ggtggcatga caaacaggga 20
<210> 155
<211> 21
<212> DNA
<213> Artificial
<400> 155
tgcccccaaa ataccatctc c 21
<210> 156
<211> 20
<212> DNA
<213> Artificial
<400> 156
aaacgcccct ctgtgttgaa 20
<210> 157
<211> 23
<212> DNA
<213> Artificial
<400> 157
aggttctttt ctcctcagct gtt 23
<210> 158
<211> 21
<212> DNA
<213> Artificial
<400> 158
cccctcccag accacttaca t 21
<210> 159
<211> 25
<212> DNA
<213> Artificial
<400> 159
gtgaatacag agtgagttgt tcagt 25
<210> 160
<211> 21
<212> DNA
<213> Artificial
<400> 160
aaatgtatgg ggtcgcaggg t 21
<210> 161
<211> 21
<212> DNA
<213> Artificial
<400> 161
acgtaccagg ctttgtttca c 21
<210> 162
<211> 20
<212> DNA
<213> Artificial
<400> 162
tgtctcccca tccaccaaac 20
<210> 163
<211> 21
<212> DNA
<213> Artificial
<400> 163
gctgagaaat cattgcagcg t 21
<210> 164
<211> 20
<212> DNA
<213> Artificial
<400> 164
gggtgtgtgt agtctctgcc 20
<210> 165
<211> 20
<212> DNA
<213> Artificial
<400> 165
aaacctgtgg ccagaaggag 20
<210> 166
<211> 20
<212> DNA
<213> Artificial
<400> 166
ctttgctcac cagtctctgc 20
<210> 167
<211> 22
<212> DNA
<213> Artificial
<400> 167
gtgcttgttt ttgccttttg gg 22
<210> 168
<211> 20
<212> DNA
<213> Artificial
<400> 168
gagcatgcta cagggctgat 20
<210> 169
<211> 21
<212> DNA
<213> Artificial
<400> 169
cccattcaaa taccctcccc a 21
<210> 170
<211> 20
<212> DNA
<213> Artificial
<400> 170
acgcttcccc taggaattgg 20
<210> 171
<211> 21
<212> DNA
<213> Artificial
<400> 171
gaaagtgctg ctgatgtgca a 21
<210> 172
<211> 21
<212> DNA
<213> Artificial
<400> 172
gatgggtttt gggaacacag c 21
<210> 173
<211> 21
<212> DNA
<213> Artificial
<400> 173
gaagggtgat gtaggcacca a 21
<210> 174
<211> 21
<212> DNA
<213> Artificial
<400> 174
tcttaagcct gccagtcaca g 21
<210> 175
<211> 21
<212> DNA
<213> Artificial
<400> 175
tccccatctc tttgaacagc c 21
<210> 176
<211> 21
<212> DNA
<213> Artificial
<400> 176
ggctgtttga caactgctga g 21
<210> 177
<211> 20
<212> DNA
<213> Artificial
<400> 177
tgcccctact tgctggattg 20
<210> 178
<211> 20
<212> DNA
<213> Artificial
<400> 178
gcaggttctt ccctgcatct 20
<210> 179
<211> 22
<212> DNA
<213> Artificial
<400> 179
gcaaggcatg aggtttttgc ta 22
<210> 180
<211> 20
<212> DNA
<213> Artificial
<400> 180
aagccttcca tgccctaacc 20
<210> 181
<211> 22
<212> DNA
<213> Artificial
<400> 181
ggtggagcac agggtattgt ta 22
<210> 182
<211> 20
<212> DNA
<213> Artificial
<400> 182
acagagagtg attgccctgc 20
<210> 183
<211> 23
<212> DNA
<213> Artificial
<400> 183
tcatcacagg aggaacatgg aag 23
<210> 184
<211> 21
<212> DNA
<213> Artificial
<400> 184
cacgcatgaa aatgcaccag a 21
<210> 185
<211> 21
<212> DNA
<213> Artificial
<400> 185
cttcacctgg tcctcgtctt c 21
<210> 186
<211> 21
<212> DNA
<213> Artificial
<400> 186
gctacacgtc tgagaacacg a 21
<210> 187
<211> 24
<212> DNA
<213> Artificial
<400> 187
tacagtccta catttctgga aggc 24
<210> 188
<211> 22
<212> DNA
<213> Artificial
<400> 188
gaggagcttc cactatttgc ct 22
<210> 189
<211> 23
<212> DNA
<213> Artificial
<400> 189
aggaggaaag gaactatctg ggt 23
<210> 190
<211> 20
<212> DNA
<213> Artificial
<400> 190
ttctcagttg gggaggggaa 20
<210> 191
<211> 23
<212> DNA
<213> Artificial
<400> 191
acagtttcac acactggagg att 23
<210> 192
<211> 21
<212> DNA
<213> Artificial
<400> 192
atgttttggg gctggaactc a 21
<210> 193
<211> 21
<212> DNA
<213> Artificial
<400> 193
ccctacaacg actaaggctg g 21
<210> 194
<211> 21
<212> DNA
<213> Artificial
<400> 194
actggaattg ctggggtttg a 21
<210> 195
<211> 21
<212> DNA
<213> Artificial
<400> 195
gtggtctccc tgcttatgga c 21
<210> 196
<211> 21
<212> DNA
<213> Artificial
<400> 196
ccaagtggag caggagagat g 21
<210> 197
<211> 21
<212> DNA
<213> Artificial
<400> 197
tctgaccaca ctcagggaag a 21
<210> 198
<211> 21
<212> DNA
<213> Artificial
<400> 198
cgctctgtcc acttcctact g 21
<210> 199
<211> 21
<212> DNA
<213> Artificial
<400> 199
cactcagggt acggacatca c 21
<210> 200
<211> 22
<212> DNA
<213> Artificial
<400> 200
aggctgacaa agaagaaacg ga 22
<210> 201
<211> 20
<212> DNA
<213> Artificial
<400> 201
agccagagac ccacctacaa 20
<210> 202
<211> 23
<212> DNA
<213> Artificial
<400> 202
tgacaacaca taatgaccca cca 23
<210> 203
<211> 21
<212> DNA
<213> Artificial
<400> 203
tcttgaatgc cagcctttgg a 21
<210> 204
<211> 21
<212> DNA
<213> Artificial
<400> 204
tagctagcgg aattgtcagc c 21
<210> 205
<211> 21
<212> DNA
<213> Artificial
<400> 205
ccttcagcag gaccagaaac a 21
<210> 206
<211> 21
<212> DNA
<213> Artificial
<400> 206
ttgccaccct ggctcaaaat a 21
<210> 207
<211> 23
<212> DNA
<213> Artificial
<400> 207
tctctggtga gtgctaaagt tgg 23
<210> 208
<211> 20
<212> DNA
<213> Artificial
<400> 208
gaacattgtc ccccagtgct 20
<210> 209
<211> 20
<212> DNA
<213> Artificial
<400> 209
cccgtttgtg gggaacagat 20
<210> 210
<211> 20
<212> DNA
<213> Artificial
<400> 210
acatgctcca agtaggggga 20
<210> 211
<211> 24
<212> DNA
<213> Artificial
<400> 211
ggtaaatgct atacaagtgc cagc 24
<210> 212
<211> 21
<212> DNA
<213> Artificial
<400> 212
cactgtcttg atcacctggc a 21
<210> 213
<211> 21
<212> DNA
<213> Artificial
<400> 213
gccccaagtg actgacaatc t 21
<210> 214
<211> 20
<212> DNA
<213> Artificial
<400> 214
cattccacac tgctggctct 20
<210> 215
<211> 20
<212> DNA
<213> Artificial
<400> 215
ggggtgggac cctggtataa 20
<210> 216
<211> 21
<212> DNA
<213> Artificial
<400> 216
atttccctcg gggagaagct a 21
<210> 217
<211> 21
<212> DNA
<213> Artificial
<400> 217
atgccctttc agccaaaatg c 21
<210> 218
<211> 22
<212> DNA
<213> Artificial
<400> 218
gagcagcgat agtatgtccc ag 22
<210> 219
<211> 23
<212> DNA
<213> Artificial
<400> 219
tgaagtctta taggcctgtt gcc 23
<210> 220
<211> 20
<212> DNA
<213> Artificial
<400> 220
tgttctgtgt ttggcagcct 20
<210> 221
<211> 20
<212> DNA
<213> Artificial
<400> 221
ctgaaggggg caacctttgt 20
<210> 222
<211> 21
<212> DNA
<213> Artificial
<400> 222
gagcttggaa aggggttgga a 21
<210> 223
<211> 22
<212> DNA
<213> Artificial
<400> 223
ggcaggatgg ctgcttttta tg 22
<210> 224
<211> 21
<212> DNA
<213> Artificial
<400> 224
atggaggctg gataggaggt c 21
<210> 225
<211> 21
<212> DNA
<213> Artificial
<400> 225
taggggactc aaggtgactg g 21
<210> 226
<211> 21
<212> DNA
<213> Artificial
<400> 226
gggggttgag gtatcagagg t 21
<210> 227
<211> 21
<212> DNA
<213> Artificial
<400> 227
gaccctcccc ctgatgagat t 21
<210> 228
<211> 20
<212> DNA
<213> Artificial
<400> 228
aggggactca aggtgactgg 20
<210> 229
<211> 21
<212> DNA
<213> Artificial
<400> 229
gatgccccgt tatgagctct g 21
<210> 230
<211> 20
<212> DNA
<213> Artificial
<400> 230
gtgacacaag catgagggca 20
<210> 231
<211> 21
<212> DNA
<213> Artificial
<400> 231
agctgcatgg tgagagagag t 21
<210> 232
<211> 20
<212> DNA
<213> Artificial
<400> 232
atcccaagca gcaaatgcca 20
<210> 233
<211> 20
<212> DNA
<213> Artificial
<400> 233
ttcccgtaag gcgtttgagc 20
<210> 234
<211> 21
<212> DNA
<213> Artificial
<400> 234
agctcagata gctccctgca a 21
<210> 235
<211> 20
<212> DNA
<213> Artificial
<400> 235
ttgggcacag tcagactcca 20
<210> 236
<211> 20
<212> DNA
<213> Artificial
<400> 236
tacgccatgc tcctgtttgc 20
<210> 237
<211> 20
<212> DNA
<213> Artificial
<400> 237
gcgcctgcaa gacacctaag 20
<210> 238
<211> 23
<212> DNA
<213> Artificial
<400> 238
tcctttgggt ttagaggcat tga 23
<210> 239
<211> 21
<212> DNA
<213> Artificial
<400> 239
ctgaggggtc ttagaacagg c 21
<210> 240
<211> 20
<212> DNA
<213> Artificial
<400> 240
tgtggtcatc ccactagcct 20
<210> 241
<211> 20
<212> DNA
<213> Artificial
<400> 241
gtcgcatctc catgtttgcc 20
<210> 242
<211> 21
<212> DNA
<213> Artificial
<400> 242
agacccaagt ccacctcttc t 21
<210> 243
<211> 20
<212> DNA
<213> Artificial
<400> 243
ccatcaggcg attttgctgc 20
<210> 244
<211> 21
<212> DNA
<213> Artificial
<400> 244
tgccttagta cctacctggc t 21
<210> 245
<211> 25
<212> DNA
<213> Artificial
<400> 245
actcagttat gtcttttggg aagga 25
<210> 246
<211> 21
<212> DNA
<213> Artificial
<400> 246
attacaagct tgcctgcctc t 21
<210> 247
<211> 20
<212> DNA
<213> Artificial
<400> 247
gagaatgcac agtgggtgga 20
<210> 248
<211> 21
<212> DNA
<213> Artificial
<400> 248
catgaaggaa gctgcctgag a 21
<210> 249
<211> 22
<212> DNA
<213> Artificial
<400> 249
agcattgtct cagggttgta ct 22
<210> 250
<211> 21
<212> DNA
<213> Artificial
<400> 250
ctccaagccc acctttctct a 21
<210> 251
<211> 23
<212> DNA
<213> Artificial
<400> 251
tgcctgtctt taacatactg ctg 23
<210> 252
<211> 21
<212> DNA
<213> Artificial
<400> 252
ggagcacttg ggaagaacaa c 21
<210> 253
<211> 21
<212> DNA
<213> Artificial
<400> 253
tcctattggg tatccctgca t 21
<210> 254
<211> 22
<212> DNA
<213> Artificial
<400> 254
atgtggaagg gtctcaacag aa 22
<210> 255
<211> 22
<212> DNA
<213> Artificial
<400> 255
agatggtcaa agtaggcaca cc 22
<210> 256
<211> 21
<212> DNA
<213> Artificial
<400> 256
acaagtgact ctgcctcatc a 21
<210> 257
<211> 23
<212> DNA
<213> Artificial
<400> 257
tgattaggtc ccattttacc cca 23
<210> 258
<211> 20
<212> DNA
<213> Artificial
<400> 258
aggaggccag tttggatctg 20
<210> 259
<211> 21
<212> DNA
<213> Artificial
<400> 259
gcaaccccta cccattccat a 21
<210> 260
<211> 21
<212> DNA
<213> Artificial
<400> 260
ccttatctgt tccctgtccc c 21
<210> 261
<211> 20
<212> DNA
<213> Artificial
<400> 261
tttcagccct ggcgttttga 20
<210> 262
<211> 20
<212> DNA
<213> Artificial
<400> 262
gggttcttcc ttcagtgcca 20
<210> 263
<211> 21
<212> DNA
<213> Artificial
<400> 263
ttctgaaagc tgctgtcctc a 21
<210> 264
<211> 21
<212> DNA
<213> Artificial
<400> 264
tcatggcatc agccatcaag t 21
<210> 265
<211> 20
<212> DNA
<213> Artificial
<400> 265
tctccccttt gcaggtcttc 20
<210> 266
<211> 20
<212> DNA
<213> Artificial
<400> 266
acctacacac cccctagcat 20
<210> 267
<211> 20
<212> DNA
<213> Artificial
<400> 267
cccgtggttt gaaccttcct 20
<210> 268
<211> 20
<212> DNA
<213> Artificial
<400> 268
ttgttatcag gctgtgcccc 20
<210> 269
<211> 22
<212> DNA
<213> Artificial
<400> 269
ggccaggcca gatgttatta gt 22
<210> 270
<211> 21
<212> DNA
<213> Artificial
<400> 270
ctcttcccct cttggctcat t 21
<210> 271
<211> 21
<212> DNA
<213> Artificial
<400> 271
tgaggagccc cagtatctct g 21
<210> 272
<211> 21
<212> DNA
<213> Artificial
<400> 272
cgagaaaggc tcatggctgt a 21
<210> 273
<211> 21
<212> DNA
<213> Artificial
<400> 273
agctcttaag ggactgggct a 21
<210> 274
<211> 21
<212> DNA
<213> Artificial
<400> 274
ttcttcagta ggagcaagcc a 21
<210> 275
<211> 21
<212> DNA
<213> Artificial
<400> 275
ttgtaatgca gtcctcctgg g 21
<210> 276
<211> 20
<212> DNA
<213> Artificial
<400> 276
cccaggagag gatagggcaa 20
<210> 277
<211> 21
<212> DNA
<213> Artificial
<400> 277
gcactgcatc ctaacttctg c 21
<210> 278
<211> 20
<212> DNA
<213> Artificial
<400> 278
gcctgtacag caaaggccaa 20
<210> 279
<211> 21
<212> DNA
<213> Artificial
<400> 279
ccaaagtgag ggtgcttgag t 21
<210> 280
<211> 20
<212> DNA
<213> Artificial
<400> 280
tatcgcactt gtgtccgtgg 20
<210> 281
<211> 21
<212> DNA
<213> Artificial
<400> 281
tggttgcagg cttgtttagg a 21
<210> 282
<211> 20
<212> DNA
<213> Artificial
<400> 282
ccaagcttgc ctggtggtta 20
<210> 283
<211> 21
<212> DNA
<213> Artificial
<400> 283
ttcagggtta caaggagcag c 21
<210> 284
<211> 20
<212> DNA
<213> Artificial
<400> 284
atctgggtcc tctggtgtgt 20
<210> 285
<211> 21
<212> DNA
<213> Artificial
<400> 285
ctaggaccct ctggtgtttc c 21
<210> 286
<211> 24
<212> DNA
<213> Artificial
<400> 286
tgaggaaaat ctcagcttct gtgt 24
<210> 287
<211> 20
<212> DNA
<213> Artificial
<400> 287
cattttggtg gccattcccg 20
<210> 288
<211> 21
<212> DNA
<213> Artificial
<400> 288
agccagcaat tctactcctc g 21
<210> 289
<211> 21
<212> DNA
<213> Artificial
<400> 289
cctgtctgtc cactgctgta a 21
<210> 290
<211> 24
<212> DNA
<213> Artificial
<400> 290
gctaaattgc cctgtaagaa actg 24
<210> 291
<211> 21
<212> DNA
<213> Artificial
<400> 291
cttccccagg tagagcaaca c 21
<210> 292
<211> 21
<212> DNA
<213> Artificial
<400> 292
gatcactgtg ccaacctcct g 21
<210> 293
<211> 21
<212> DNA
<213> Artificial
<400> 293
aaactgagac atcagggtgg c 21
<210> 294
<211> 20
<212> DNA
<213> Artificial
<400> 294
tcacagactc caggcatcag 20
<210> 295
<211> 20
<212> DNA
<213> Artificial
<400> 295
ttgctcagcc ccaaagatgg 20
<210> 296
<211> 25
<212> DNA
<213> Artificial
<400> 296
actgaagaga ctgatagcca gtatg 25
<210> 297
<211> 21
<212> DNA
<213> Artificial
<400> 297
tcgggctcca atatgttgac t 21
<210> 298
<211> 21
<212> DNA
<213> Artificial
<400> 298
atcccagtca cagtatggtg g 21
<210> 299
<211> 21
<212> DNA
<213> Artificial
<400> 299
tccctgtctt cctcagtggt a 21
<210> 300
<211> 22
<212> DNA
<213> Artificial
<400> 300
taagaactca cccatgtcag gc 22
<210> 301
<211> 20
<212> DNA
<213> Artificial
<400> 301
tgaagtccca tggccttgtt 20
<210> 302
<211> 21
<212> DNA
<213> Artificial
<400> 302
ggtggaggct tctgatacgt g 21
<210> 303
<211> 21
<212> DNA
<213> Artificial
<400> 303
actttctggg aaactcaggg c 21
<210> 304
<211> 19
<212> DNA
<213> Artificial
<400> 304
ggcttcttca ccaggccat 19
<210> 305
<211> 25
<212> DNA
<213> Artificial
<400> 305
aatgatacgg cgaccaccga gatct 25
<210> 306
<211> 24
<212> DNA
<213> Artificial
<400> 306
caagcagaag acggcatacg agat 24
Claims (2)
1. An amplification primer set for detecting children allergy-related genotyping, wherein the amplification primer set comprises a first set of amplification primers and/or a second set of amplification primers;
the upstream amplification primer sequence of the first amplification primer set is shown as SEQ ID NO: 1-85, and the sequence of the downstream amplification primer is shown as SEQ ID NO: 86-170;
the upstream amplification primer sequence of the second amplification primer set is shown as SEQ ID NO: 171-237, the downstream amplification primer sequence is shown as SEQ ID NO: 238-304.
2. The amplification primer set of claim 1, further comprising an index sequence comprising the sequence set forth in SEQ ID NO:305 and SEQ ID NO: 306.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2021109152137 | 2021-08-10 | ||
| CN202110915213 | 2021-08-10 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113930494A CN113930494A (en) | 2022-01-14 |
| CN113930494B true CN113930494B (en) | 2023-09-26 |
Family
ID=79276543
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111113119.6A Active CN113930494B (en) | 2021-08-10 | 2021-09-18 | Detection method for genotyping of 152 gene loci related to allergy of children |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113930494B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117418000A (en) * | 2023-12-05 | 2024-01-19 | 广州达安临床检验中心有限公司 | Library construction method for allergy-associated gene detection, primer composition and product thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009073628A2 (en) * | 2007-11-30 | 2009-06-11 | Celera Corporation | Genetic polymorphisms associated with psoriasis, methods of detection and uses thereof |
| CN105950738A (en) * | 2016-05-27 | 2016-09-21 | 福建爱我健康生物科技有限公司 | Primer, probe and kit for evaluating skin anti-allergy condition |
| CN106381335A (en) * | 2016-10-25 | 2017-02-08 | 北京亿昊基因技术有限公司 | Vitamin C individualized quantitative compensating detecting method based on genetic typing |
| CN107446994A (en) * | 2017-06-16 | 2017-12-08 | 安徽安龙基因医学检验所有限公司 | A kind of detection method of alcohol metabolism related gene |
| CN109402257A (en) * | 2018-11-03 | 2019-03-01 | 杭州链康医学检验实验室有限公司 | A kind of primer, method and kit for the detection of the gene whole coding sequence mutational site mankind BRCA1 and BRCA2 |
| NL1042665B1 (en) * | 2017-11-30 | 2019-06-07 | Hakken Entpr Sa De Cv | Methods and kits for determining risk of cancer |
| CN110511989A (en) * | 2019-08-01 | 2019-11-29 | 杭州和壹基因科技有限公司 | A kind of high-flux sequence method and its application of hypertension therapeutic pharmaceutical relevant gene |
-
2021
- 2021-09-18 CN CN202111113119.6A patent/CN113930494B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009073628A2 (en) * | 2007-11-30 | 2009-06-11 | Celera Corporation | Genetic polymorphisms associated with psoriasis, methods of detection and uses thereof |
| CN105950738A (en) * | 2016-05-27 | 2016-09-21 | 福建爱我健康生物科技有限公司 | Primer, probe and kit for evaluating skin anti-allergy condition |
| CN106381335A (en) * | 2016-10-25 | 2017-02-08 | 北京亿昊基因技术有限公司 | Vitamin C individualized quantitative compensating detecting method based on genetic typing |
| CN107446994A (en) * | 2017-06-16 | 2017-12-08 | 安徽安龙基因医学检验所有限公司 | A kind of detection method of alcohol metabolism related gene |
| NL1042665B1 (en) * | 2017-11-30 | 2019-06-07 | Hakken Entpr Sa De Cv | Methods and kits for determining risk of cancer |
| CN109402257A (en) * | 2018-11-03 | 2019-03-01 | 杭州链康医学检验实验室有限公司 | A kind of primer, method and kit for the detection of the gene whole coding sequence mutational site mankind BRCA1 and BRCA2 |
| CN110511989A (en) * | 2019-08-01 | 2019-11-29 | 杭州和壹基因科技有限公司 | A kind of high-flux sequence method and its application of hypertension therapeutic pharmaceutical relevant gene |
Non-Patent Citations (1)
| Title |
|---|
| 儿童哮喘与炎症基因SNP及炎症生物标志物的相关性研究;龙易勤;严提珍;;现代预防医学(第20期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113930494A (en) | 2022-01-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Earl et al. | The changing face of asthma and its relation with microbes | |
| Rosenthal et al. | Viral respiratory tract infections and asthma: the course ahead | |
| CN102344961B (en) | A kind of polygenic method of application extensive parallel sequencing technology inspection multiple goal of economy | |
| CN111304368A (en) | Method, oligonucleotide and kit for detecting novel coronavirus | |
| Webster et al. | Early life stress causes persistent impacts on the microbiome of Atlantic salmon | |
| CN113930494B (en) | Detection method for genotyping of 152 gene loci related to allergy of children | |
| CN111020018B (en) | Macrogenomics-based pathogenic microorganism detection method and kit | |
| CN109355395B (en) | Multiplex PCR detection method for three fluke metacercaria in freshwater fish and primers for detection | |
| Marfell et al. | Global gene expression profiling of monocyte-derived macrophages from red deer (Cervus elaphus) genotypically resistant or susceptible to Mycobacterium avium subspecies paratuberculosis infection | |
| CN111808995A (en) | Respiratory tract pathogen nucleic acid detection kit | |
| CN105063229B (en) | For detecting quantitative fluorescent PCR specific primer, probe and its kit of sheep derived material in meat products | |
| Guntur et al. | Refractory neutrophilic asthma and ciliary genes | |
| CN108411041B (en) | Fluorescent quantitative RT-PCR kit for detecting novel chicken reovirus and application thereof | |
| Hodeib et al. | IL-8 gene expression and bronchial asthma phenotypes in children | |
| KR20220034863A (en) | Avian pathogenic lice in avian flocks. How to determine your risk of coli (APEC) infection | |
| CN111793702A (en) | RPA primer group, probe and kit for detecting aeromonas hydrophila and application thereof | |
| CN115976178A (en) | SFTSV (Small form-factor TSV) detection method based on nanopore metagenome sequencing | |
| CN113373248B (en) | Probe combination, chip, kit and method for detecting pathogenic bacteria | |
| CN109880897A (en) | The marker and screening technique of enteric microorganism for VKH syndrome and the purposes of the marker | |
| Akhlaghi et al. | Isolation and Antibiotic Resistance of Helicobacter pullorum from Chicken Wings. | |
| CN111304342A (en) | PCR kit for identifying Brucella strain S2 vaccine strain and wild strains of other species and use method thereof | |
| Giles et al. | Differential gene response to coccidiosis in modern fast growing and slow growing broiler genotypes | |
| CN114107325B (en) | Metagenome internal reference, preparation method and application thereof, and metagenome blood flow pathogen detection method | |
| CN117568494B (en) | Multiple PCR (polymerase chain reaction) detection primer group, kit and detection method for zoonotic metacercaria in freshwater fish | |
| RU2809221C1 (en) | Method for indirect determining of the titer of infectious activity of feline calicivirus in raw materials for vaccine using real-time pcr |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |