CN113925957A - Application of heat shock protein 90 in preparation of medicine for treating cataract - Google Patents

Abstract

The invention belongs to the field of medicine, and particularly relates to a new application of a heat shock protein 90(HSP90 alpha) and a truncated protein HSP90-M (namely human HSP90 alpha amino acid 357-749). The heat shock protein HSP90 alpha and the truncated protein HSP90 alpha-M thereof can induce the terminal differentiation of lens epithelial cells into lens fibers, promote the terminal differentiation of the lens epithelial cells and inhibit the epithelial mesenchymal transformation of the lens epithelial cells induced by TGF-beta 2, and can be used for treating cataract and has great development potential as a novel candidate medicament for promoting lens regeneration on the premise of not implanting lenses artificially.

Description

Application of heat shock protein 90 in preparation of medicine for treating cataract

Technical Field

The invention belongs to the field of medicines, and particularly relates to application of heat shock protein 90 in preparation of a medicine for treating cataract.

Background

Cataract is the first eye disease causing blindness in the world, no effective medicine is available at present, the only treatment mode is surgical removal of turbid crystalline lens fiber and combination with transparent intraocular lens replacement, but various complications are easily caused after surgery, such as secondary cataract and the like, and visual impairment is caused again. Animal experiments and clinical studies have demonstrated that residual epithelial cells of the capsular bag of the Lens can regenerate into the Lens after cataract surgery in infants (see Haotian Lin, Hong Ouyang, et al, Lens regeneration using end Lens cells with a gain of visual function, Nature, 2016, 531(7594): 323-plus 328.). The tissue regeneration crystalline lens is a novel method which has the most prospect for replacing the artificial lens to treat cataract and avoiding complications caused by the artificial lens treatment. The key technical problem of lens regeneration is to promote the differentiation of residual epithelial cells of the postoperative lens capsular bag to lens fiber cells. Therefore, the development of key factors for regulating and controlling tissue regeneration is a technical key for promoting tissue to regenerate crystalline lens.

Heat shock protein 90(HSP90 alpha) is one of the important proteins in cells and is involved in various cell signaling. HSP90 has long been recognized as an intracellular protein that performs a chaperone function. In recent years, HSP90 is discovered to be secreted to the outside of cells and exert biological functions other than molecular chaperones, for example, extracellular HSP90 alpha can promote the migration capability of skin cells at injured parts and promote skin healing. The tumor cell secretes HSP90 alpha and participates in the regulation of tumor growth, invasion and metastasis.

Our earlier studies found that inhibition of HSP90 a chaperone activity in lens epithelial cells could treat secondary cataract, a complication that results after cataract surgery-secondary cataract. However, the present application has unexpectedly found that said extracellular HSP90 α (eHSP90) can directly promote the terminal differentiation of lens epithelial cells into lens fibers, i.e. eHSP90 is a novel regulatory lens epithelial differentiation factor and plays an important role in lens regeneration.

Disclosure of Invention

In view of the above problems, the present invention unexpectedly finds: HSP90 alpha can directly promote the terminal differentiation of lens epithelial cells into lens fibers, and has the effects of promoting lens regeneration and treating cataract. Therefore, the present invention aims at providing a new use of heat shock protein 90, which specifically comprises the following contents:

in a first aspect, the invention provides an application of heat shock protein 90 in preparing a medicament for treating cataract, wherein the amino acid sequence of the heat shock protein 90 is shown as SEQ ID NO. 1.

In a second aspect, the invention provides an application of heat shock protein 90 in preparing a medicament for promoting the terminal differentiation of lens epithelial cells into lens fibers, wherein the amino acid sequence of the heat shock protein 90 is shown as SEQ ID NO. 1.

In a third aspect, the invention provides an application of heat shock protein 90 in preparing a medicament for inhibiting lens epithelial cell keratinization, wherein the amino acid sequence of the heat shock protein 90 is shown as SEQ ID NO. 1.

In a fourth aspect, the invention provides an application of heat shock protein 90 in preparing a medicine for promoting lens regeneration, wherein the amino acid sequence of the heat shock protein 90 is shown as SEQ ID NO. 1.

Preferably, the heat shock protein 90 is added with a pharmaceutically acceptable carrier to prepare any pharmaceutically acceptable dosage form.

In a fifth aspect, the invention provides an application of a heat shock protein 90 truncated protein in preparing a medicament for treating cataract, wherein the amino acid sequence of the heat shock protein 90 truncated protein is shown as SEQ ID No. 3.

In a sixth aspect, the invention provides an application of a heat shock protein 90 truncated protein in preparing a medicament for promoting terminal differentiation of lens epithelial cells into lens fibers, wherein the amino acid sequence of the heat shock protein 90 truncated protein is shown as SEQ ID NO. 3.

In a seventh aspect, the invention provides an application of a heat shock protein 90 truncated protein in preparing a medicament for inhibiting keratinization of lens epithelial cells, wherein an amino acid sequence of the heat shock protein 90 truncated protein is shown as SEQ ID No. 3.

In an eighth aspect, the invention provides an application of a heat shock protein 90 truncated protein in preparing a medicine for promoting lens regeneration, wherein the amino acid sequence of the heat shock protein 90 truncated protein is shown as SEQ ID No. 3.

Preferably, the heat shock protein 90 truncated protein is added into a pharmaceutically acceptable carrier to prepare any pharmaceutically acceptable dosage form.

The invention has the beneficial effects that:

(1) the invention discovers that the heat shock protein 90(HSP90 alpha) can promote the terminal differentiation of lens epithelial cells into lens fibers, inhibit the keratinization of the lens epithelial cells and promote the lens regeneration, and can be used for treating cataract;

(2) the invention discovers that the heat shock protein 90 truncated protein (HSP90 alpha amino acid 385-750) can obviously promote the terminal differentiation of lens epithelial cells into lens fibers, inhibit the keratinization of the lens epithelial cells and promote the regeneration of lenses, can be used for treating cataract and has the effect obviously better than that of the heat shock protein 90(HSP90 alpha);

(3) the invention provides a new medicine for treating cataract without implanting artificial lens, which has higher safety, can avoid the development of complications such as after cataract and the like, and has wide application value.

Drawings

FIG. 1 shows the results of counterstaining of prokaryotic expression of human HSP90 alpha and truncation;

FIG. 2 Lenticular epithelial cells secrete HSP90 alpha;

FIG. 3HSP90 α inhibits TGF-. beta.2-induced epithelial mesenchymal transition;

FIG. 4HSP90 alpha induces fusiform changes in lens epithelial cells;

FIG. 5HSP90 alpha promotes lens regeneration;

FIG. 6HSP90 alpha truncated protein (358-750aa) promotes terminal differentiation of lens epithelial cells.

Detailed Description

The present invention will be described in further detail with reference to specific examples, but the scope of the present invention is not limited to the following.

Example 1 preparation of full-Length human HSP90 alpha and its truncation protein

Extracting RNA of human Hela cells, and obtaining a heat shock protein 90(HSP90 alpha) gene (shown in SEQ ID NO. 2) by RT-PCR technology. The DNA fragment of HSP90 alpha and the prokaryotic expression vector pGEX-6p-1 labeled by GST are subjected to double enzyme digestion by Sma I and Xho I respectively, and are connected by ligase to obtain a recombinant vector pGEX-6p-1-HSP90 alpha, and the recombinant vector pGEX-6p-1-HSP90 alpha is verified by sequencing.

pGEX-6p-1-HSP90 alpha and pGEX-6p-1 plasmids respectively transform BL21 bacteria, after the plate is coated overnight, white bacteria are selected and cloned into 5 ml of LB liquid culture medium, and are cultured overnight at 220rpm and 37 ℃; inoculating to fresh 5 ml LB culture medium at a ratio of 1:100 the next day, and continuing to culture at 37 ℃; when the OD value of the bacteria is about 0.8, adding IPTG with the final concentration of 0.1mM, culturing for 5 hours at 30 ℃ and 200 rpm; centrifuging at 4000rpm/min for 5 min, collecting bacterial precipitate, adding 500 μ L PBS, ultrasonic crushing at 8000rpm/min, centrifuging for 5 min, and collecting supernatant; whether the protein is expressed or not is detected by SDS-PAGE gel electrophoresis and Coomassie brilliant blue staining.

Taking positive clones expressing protein, carrying out amplification culture, carrying out ultrasonic disruption on collected bacterial precipitates, carrying out protein purification by using a glutathione prepacked column in combination with an AKATA protein purifier, dialyzing for two days, concentrating by using a 30KD ultrafiltration tube, and removing endotoxin by using Triton X-114. Detection was by SDS-PAGE, stained with Coomassie Brilliant blue.

The following primer pairs were designed, respectively:

HSP90 α (1-853 amino acids): a forward primer TCCCCCGGGTcccccgtgttcgggcggggac; a reverse primer CCCCTCGAGttagtctacttcttccatgcgtgatgtgtc;

HSP90 α -N (amino acids 1-392): a forward primer CATGCCATGGCTcccccgtgttcgggcggggac; a reverse primer CCCCTCGAGTTAatccttcttttcttcttcctc;

HSP90 α -M (357-749 amino acids): a forward primer CATGCCATGGCTgaagaaaaggaagacaaagaa; a reverse primer CCCCTCGAGTTAcatgtaacccattgttgagtt;

HSP90 alpha-C (750-853 amino acids): a forward primer CATGCCATGGCTgcagcaaagaaacacctggag; a reverse primer CCCCTCGAGTTAgtctacttcttccatgcgtgatgtgtc;

HSP90 α - Δ N (357-853 amino acids): a forward primer CATGCCATGGCTgaagaaaaggaagacaaagaa; reverse primer: CCCCTCGAGTTAgtctacttcttccatgcgtgatgtgtc are provided.

pGEX-6p-1-HSP90 alpha is taken as a template, and genes of HSP90 alpha truncation body amino acids 1-392, 357-749, 750-853 and 357-853 are obtained by a PCR technology, wherein the gene sequence of the 357-749 (the heat shock protein 90 truncation protein of the invention) is shown as SEQ ID NO. 4; the DNA fragment and the His-tagged prokaryotic expression vector pET-30a (+) are subjected to double digestion by Nco I and Xho I respectively, and are connected by ligase to obtain vectors pET-30a (+) -HSP90 alpha-N (1-392), pET-30a (+) -HSP90 alpha-M (357-749), pET-30a (+) -HSP90 alpha-C (750-853) and pET-30a (+) -HSP90 alpha-delta N (357-853) respectively, and the sequences of the vectors are verified. As shown in FIG. 1, the expression method of these truncation proteins was the same as that of HSP90 α full-length protein, and the proteins were purified using a nickel column.

Example 2 secretion of HSP90 alpha by lens epithelial cells

Constructing a lens capsular bag tissue in-vitro culture model: wistar rats (6-8 weeks, male and female are unlimited, 200-250g) are experimental animals, and after isoflurane inhalation anesthesia, the eyeballs of the rats are taken out, and the lenses are taken out after 3 times of washing by PBS (phosphate buffered saline) solution containing 5% of streptomycin. Autoclaved 2% cryoagar was cooled to 37 ℃ and poured into sterile molds. The prepared lens was placed in the center of the agarose and excess agar was aspirated down to the lens equator. The mold was cooled to room temperature until the agar solidified. Tearing the anterior capsule of the crystalline lens by using capsule tearing forceps, injecting the ringer's lactate into the capsule for water separation, and completely separating the cortex of the crystalline lens from the capsule membrane and taking out the crystalline lens from the outside of the eye. The lactated ringer's solution irrigates the capsular bag to ensure that no lens cortex remains. Agar containing the lens was removed from the molds and placed in 24-well plates and cultured in M199 medium without serum and containing non-essential amino acids. Culturing the lens capsular bag tissue in vitro, changing a fresh serum-free culture medium after 2 days of serum-free culture, and collecting supernatant according to a specified time point.

Lens epithelial cell lines human SRA01/04 and HLE-B3, murine lens epithelial cell line mLEC were cultured in vitro. Collecting the supernatant of capsular bag tissue culture and the supernatant of lens epithelial cells in 3, and further performing TCA precipitation to obtain supernatant protein. The lens epithelial cells were found to secrete HSP90 α by immunoblot detection, the results are shown in fig. 2 a-C.

Constructing a secondary cataract model: long-ear white rabbits (12-16W, half female and half male, about 3 kg) are experimental animals, and the extracapsular lens extraction of the right eye is combined with artificial lens replacement. Pentobarbital sodium (1mL/kg) 3% was anesthetized via the auricular peripheral vein in combination with the topical anesthesia of oxybuprocaine eye drops. Mydriasis is performed with compound tropicamide eye drops for 3 times 20 minutes before operation. Sterilizing povidone iodine in conjunctival sac before operation. An approximately 3mm transparent corneal incision was made with a 1mm jewel knife at the 12 o 'clock position, the anterior chamber was filled and maintained with sodium hyaluronate (Healon), a circular capsulorhexis approximately 5mm in diameter was performed with capsulorhexis forceps, the incision was enlarged to approximately 90 ° along the limbus with Vannas scissors, and lactational ringer's fluid was injected under the capsule for water separation, allowing the lens cortex to completely separate from the capsular sac and exit the eye. Sodium lactate ringer's solution washes the capsular bag and anterior chamber to ensure no lens cortex remains. After the artificial lens is implanted, the position of the artificial lens is well adjusted by the lens positioning hook, the corneal incision is intermittently sutured by 2-3 needles of 10-0 nylon thread, and Healon is replaced by the sodium lactate ringer's solution. A2.5 microliter microinjector injects 17AAG 1mg or an equal volume of DMSO into the anterior chamber. After the operation, 2 ten thousand units of tobramycin is injected under the bulbar conjunctiva, 2.5mg of dexamethasone is injected, and compound tobramycin eye ointment is coated in the conjunctival sac. Each group after operation is dripped with tobramycin dexamethasone eye drops every day, 3 times a day till 7 days after operation. On day 30 after molding, aqueous humor of the operative eye (right eye) and the normal eye (left eye) were collected, centrifuged at 5000rpm/min for 5 minutes, and the supernatants were collected. Post-cataract is characterized by abnormal proliferation, migration and epithelial-mesenchymal transition (EMT) of residual lens epithelial cells. The aqueous humor of the posterior cataract can therefore reflect the condition of the lens epithelial cells. Immunoprecipitation by anti-HSP 90 antibody and immunoblotting results are shown in D in FIG. 2, and the aqueous humor of the secondary cataract contained higher HSP 90. alpha. protein than the normal aqueous humor.

Example 3 inhibition of TGF-. beta.2-induced epithelial mesenchymal transition by HSP90 alpha

Culturing the capsular bag tissues in vitro in a serum-free manner, and after culturing for 2 days, replacing fresh culture medium, wherein the first group is the serum-free culture medium containing 10 mu g/mL GST, the second group is the serum-free culture medium containing 10 mu g/mL GST-HSP90 alpha, the third group is the serum-free culture medium containing 10ng/mL TGF- beta 2 and 10 mu g/mL GST, and the fourth group is the serum-free culture medium containing 10ng/mL TGF- beta 2 and 10 mu g/mL GST-HSP90 alpha. Culturing for 36 hours, respectively extracting RNA and protein of the capsular bag tissue, respectively carrying out RT-qPCR and immunoblotting, and detecting markers of epithelial-mesenchymal transition (EMT), alpha-SMA and E-cadherin.

The results are shown in FIG. 3, the TGF-beta 2 treatment group has a large amount of EMT marker alpha-SMA expression, and the epithelial cell marker E-cadherin expression is reduced; the expression of alpha-SMA and E-cadherin in the TGF-beta 2 and GST-HSP90 alpha co-treated groups is reduced, namely HSP90 alpha inhibits TGF-beta 2 induced lens epithelial cell EMT.

Example 4HSP90 alpha promotes lens regeneration

(1) Culturing the capsular bag tissue in vitro in a serum-free manner, and after culturing for 2 days, replacing fresh culture media, wherein one group is a serum-free culture medium containing 10 mu g/mL GST, and the other group is a serum-free culture medium containing 10 mu g/mL GST-HSP90 alpha. Culturing for 48 hours, respectively extracting RNA of GST and GST-HSP90 alpha tissue bag tissues, and carrying out RT-qPCR; after 4-5 days of culture, proteins of GST and GST-HSP90 alpha capsular bag tissues were extracted, respectively, and immunoblotting was performed.

As a result, as shown in FIGS. 4 and 5, the morphology of the lens epithelial cells in the GST-HSP90 alpha-treated group underwent fusiform change (shown in FIG. 4); and the PROX1 which is an important transcription factor for the differentiation of the lens fibers is highly expressed, and a plurality of downstream fiber cell marker proteins such as CRYBA1, CRYBB1, CRYGA, CRYGD, BFSP1 and MIP26 are highly expressed (shown as A-B in figure 5); when lens epithelial cells finally differentiate into fibroblasts, cell cycle arrest occurs, and both p27Kip1 and p57Kip2, which inhibit the cell cycle downstream of PROX1, are highly expressed (shown in fig. 5B).

(2) To further confirm that extracellular HSP90 induced differentiation of lens epithelial cells by PROX1, shRNA of rat PROX1, rat PROX1 target sequence: GGCGAACTCGTATGAAGATGC, and GGCGCTCAGACAATGAGATGT. The shRNA sequence and the pLKO.1 vector are subjected to double enzyme digestion through Age I and EcoR I, are connected through ligase to obtain a recombinant vector pLKO.1-PROX1, and are verified through sequencing. 293T cells were co-transfected with pLKO.1-shLRP1 and helper plasmid, and after 2 days of culture, culture supernatants were collected and filtered through 0.45 μm filters. After the capsular bag tissue of the lens is cultured by the supernatant for 2 days, a fresh serum-free culture medium is replaced for overnight culture, then a serum-free culture medium containing 10 mu g/mL of GST or GST-HSP90 alpha is replaced, and after 2 days of culture, proteins are extracted from 3 capsular bag tissues of each group to verify the shRNA knockdown effect. RNA was extracted from 3 capsular bag tissues, and the mRNA levels of the lens fiber markers CRYBB1, CRYGB and p27Kip1 were measured and the results are shown in E-G in FIG. 5, which inhibits HSP 90-induced expression of the lens fiber marker protein after knocking down PROX 1. It was shown that extracellular HSP90 α promotes terminal differentiation of lens epithelial cells by PROX 1.

(3) Culturing rat lens capsular bag tissue in vitro in a serum-free manner, and after culturing for 2 days, replacing fresh culture media, wherein one group is a serum-free culture medium, the other group is a serum-free culture medium containing 10 mu g/mL GST, and the other group is a serum-free culture medium containing 10 mu g/mL GST-HSP90 alpha. After 4-5 days of culture, proteins were extracted and found by immunoblot detection to increase the phosphorylation level of AKT S473 in HSP90 alpha-treated group (C-D in FIG. 5), i.e., HSP90 alpha regulates PROX1 overexpression through AKT signaling pathway.

(4) To further confirm that extracellular HSP90 α promotes lens regeneration, we cultured primary lens epithelial cell masses in vitro, performed GST-HSP90 α and GST treatments, respectively, and examined whether GST-HSP90 α promotes differentiation of lens epithelial cells of the cell masses. Rat lens epithelial tissues were digested with 0.125% pancreatic enzymes, and rat primary lens epithelial cells were cultured in M199 culture medium containing 10% FBS. When the cells were transferred to the 10 th generation, cell mass culture was performed using Matrigel gel (BD Co.). Primary lens epithelial cells, counting, pipetting and taking 5X 10⁴The individual cells were placed in a 1.5 ml EP tube at 2000g and centrifuged for 5 minutes to prepare a cell pellet. Incubate at 37 degrees overnight. The next day, 300. mu.L of Matrigel gel was added to a pre-cooled 24-well plate, left to stand at 37 ℃ for 20 minutes, and then cell masses were seeded into Matrigel gel using a pipette, 3 cell masses per well, left to stand at 37 ℃ for 1 hour, and then M199 serum-free medium containing 10. mu.g/mL of GST-HSP 90. alpha. or GST was added thereto, respectively, for a total treatment of 4 weeks. The cell pellet was fixed with 4% paraformaldehyde, and after gradient dehydration, paraffin-embedded to prepare a paraffin section (4 μm). Paraffin sections were HE stained and cell mass structure was observed with an optical microscope. The results are shown in FIG. 5 as H: in the GST-HSP90 alpha treatment group, lens epithelial cells in the cell cluster are subjected to terminal differentiation, the cell nucleus is degraded, only a small amount of incompletely degraded cell nucleus (blue-purple) remains, and the cell cluster is only surrounded by thin-layer epithelial cells at the periphery, so that the cell nucleus is larger; in the GST-treated group, only a part of epithelial cells in the cell mass were terminally differentiated, and the interior was largeThe amount of the blue-violet cell nucleus is not degraded, and the periphery of the cell nucleus is surrounded by a plurality of layers of lens epithelial cells with larger cell nuclei. All scales are 50 μm. The results indicate that GST-HSP90 alpha can promote lens regeneration.

The above results indicate that HSP90 α can promote the terminal differentiation of lens epithelial cells into fibroblasts, promote lens regeneration, and can be used for treating cataract.

Example 5HSP90 alpha-M Domain (amino acid 357-

Culturing the capsular bag tissue in vitro in a serum-free manner, after culturing for 2 days, changing a fresh culture medium, respectively adding 10 mu g/mL of GST, GST-HSP90 alpha, His-HSP90 alpha-N, His-HSP90 alpha-M, His-HSP90 alpha-delta N and His-HSP90 alpha-C, extracting protein after treating for 4-5 days, and observing cell morphology and immunoblotting, wherein the results are shown in figure 6, HSP90 alpha-M and HSP90 alpha-delta N segregant promote fusiform change of lenticular epithelial cell morphology, and both the HSP90 alpha-N and HSP90 alpha-C segregant do not influence the morphology, so that the functional domain of HSP90 alpha protein for promoting the terminal differentiation of the lenticular epithelial cell is HSP90 alpha-M. Further, the above conclusion is confirmed by immunoblotting, as shown in fig. 6C, HSP90 α -M in three truncations of HSP90 α promotes high expression of the key factor PROX1 for lens fiber differentiation, therefore, HSP90 α -M domain (HSP90 truncate protein 357-749aa) can significantly promote terminal differentiation of lens epithelial cells into fibroblasts, and can be used for treating cataract.

Sequence listing

<110> university of Henan

Application of heat shock protein 90 in preparation of medicine for treating cataract

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 853

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Pro Pro Cys Ser Gly Gly Asp Gly Ser Thr Pro Pro Gly Pro Ser Leu

1 5 10 15

Arg Asp Arg Asp Cys Pro Ala Gln Ser Ala Glu Tyr Pro Arg Asp Arg

20 25 30

Leu Asp Pro Arg Pro Gly Ser Pro Ser Glu Ala Ser Ser Pro Pro Phe

35 40 45

Leu Arg Ser Arg Ala Pro Val Asn Trp Tyr Gln Glu Lys Ala Gln Val

50 55 60

Phe Leu Trp His Leu Met Val Ser Gly Ser Thr Thr Leu Leu Cys Leu

65 70 75 80

Trp Lys Gln Pro Phe His Val Ser Ala Phe Pro Val Thr Ala Ser Leu

85 90 95

Ala Phe Arg Gln Ser Gln Gly Ala Gly Gln His Leu Tyr Lys Asp Leu

100 105 110

Gln Pro Phe Ile Leu Leu Arg Leu Leu Met Pro Glu Glu Thr Gln Thr

115 120 125

Gln Asp Gln Pro Met Glu Glu Glu Glu Val Glu Thr Phe Ala Phe Gln

130 135 140

Ala Glu Ile Ala Gln Leu Met Ser Leu Ile Ile Asn Thr Phe Tyr Ser

145 150 155 160

Asn Lys Glu Ile Phe Leu Arg Glu Leu Ile Ser Asn Ser Ser Asp Ala

165 170 175

Leu Asp Lys Ile Arg Tyr Glu Ser Leu Thr Asp Pro Ser Lys Leu Asp

180 185 190

Ser Gly Lys Glu Leu His Ile Asn Leu Ile Pro Asn Lys Gln Asp Arg

195 200 205

Thr Leu Thr Ile Val Asp Thr Gly Ile Gly Met Thr Lys Ala Asp Leu

210 215 220

Ile Asn Asn Leu Gly Thr Ile Ala Lys Ser Gly Thr Lys Ala Phe Met

225 230 235 240

Glu Ala Leu Gln Ala Gly Ala Asp Ile Ser Met Ile Gly Gln Phe Gly

245 250 255

Val Gly Phe Tyr Ser Ala Tyr Leu Val Ala Glu Lys Val Thr Val Ile

260 265 270

Thr Lys His Asn Asp Asp Glu Gln Tyr Ala Trp Glu Ser Ser Ala Gly

275 280 285

Gly Ser Phe Thr Val Arg Thr Asp Thr Gly Glu Pro Met Gly Arg Gly

290 295 300

Thr Lys Val Ile Leu His Leu Lys Glu Asp Gln Thr Glu Tyr Leu Glu

305 310 315 320

Glu Arg Arg Ile Lys Glu Ile Val Lys Lys His Ser Gln Phe Ile Gly

325 330 335

Tyr Pro Ile Thr Leu Phe Val Glu Lys Glu Arg Asp Lys Glu Val Ser

340 345 350

Asp Asp Glu Ala Glu Glu Lys Glu Asp Lys Glu Glu Glu Lys Glu Lys

355 360 365

Glu Glu Lys Glu Ser Glu Asp Lys Pro Glu Ile Glu Asp Val Gly Ser

370 375 380

Asp Glu Glu Glu Glu Lys Lys Asp Gly Asp Lys Lys Lys Lys Lys Lys

385 390 395 400

Ile Lys Glu Lys Tyr Ile Asp Gln Glu Glu Leu Asn Lys Thr Lys Pro

405 410 415

Ile Trp Thr Arg Asn Pro Asp Asp Ile Thr Asn Glu Glu Tyr Gly Glu

420 425 430

Phe Tyr Lys Ser Leu Thr Asn Asp Trp Glu Asp His Leu Ala Val Lys

435 440 445

His Phe Ser Val Glu Gly Gln Leu Glu Phe Arg Ala Leu Leu Phe Val

450 455 460

Pro Arg Arg Ala Pro Phe Asp Leu Phe Glu Asn Arg Lys Lys Lys Asn

465 470 475 480

Asn Ile Lys Leu Tyr Val Arg Arg Val Phe Ile Met Asp Asn Cys Glu

485 490 495

Glu Leu Ile Pro Glu Tyr Leu Asn Phe Ile Arg Gly Val Val Asp Ser

500 505 510

Glu Asp Leu Pro Leu Asn Ile Ser Arg Glu Met Leu Gln Gln Ser Lys

515 520 525

Ile Leu Lys Val Ile Arg Lys Asn Leu Val Lys Lys Cys Leu Glu Leu

530 535 540

Phe Thr Glu Leu Ala Glu Asp Lys Glu Asn Tyr Lys Lys Phe Tyr Glu

545 550 555 560

Gln Phe Ser Lys Asn Ile Lys Leu Gly Ile His Glu Asp Ser Gln Asn

565 570 575

Arg Lys Lys Leu Ser Glu Leu Leu Arg Tyr Tyr Thr Ser Ala Ser Gly

580 585 590

Asp Glu Met Val Ser Leu Lys Asp Tyr Cys Thr Arg Met Lys Glu Asn

595 600 605

Gln Lys His Ile Tyr Tyr Ile Thr Gly Glu Thr Lys Asp Gln Val Ala

610 615 620

Asn Ser Ala Phe Val Glu Arg Leu Arg Lys His Gly Leu Glu Val Ile

625 630 635 640

Tyr Met Ile Glu Pro Ile Asp Glu Tyr Cys Val Gln Gln Leu Lys Glu

645 650 655

Phe Glu Gly Lys Thr Leu Val Ser Val Thr Lys Glu Gly Leu Glu Leu

660 665 670

Pro Glu Asp Glu Glu Glu Lys Lys Lys Gln Glu Glu Lys Lys Thr Lys

675 680 685

Phe Glu Asn Leu Cys Lys Ile Met Lys Asp Ile Leu Glu Lys Lys Val

690 695 700

Glu Lys Val Val Val Ser Asn Arg Leu Val Thr Ser Pro Cys Cys Ile

705 710 715 720

Val Thr Ser Thr Tyr Gly Trp Thr Ala Asn Met Glu Arg Ile Met Lys

725 730 735

Ala Gln Ala Leu Arg Asp Asn Ser Thr Met Gly Tyr Met Ala Ala Lys

740 745 750

Lys His Leu Glu Ile Asn Pro Asp His Ser Ile Ile Glu Thr Leu Arg

755 760 765

Gln Lys Ala Glu Ala Asp Lys Asn Asp Lys Ser Val Lys Asp Leu Val

770 775 780

Ile Leu Leu Tyr Glu Thr Ala Leu Leu Ser Ser Gly Phe Ser Leu Glu

785 790 795 800

Asp Pro Gln Thr His Ala Asn Arg Ile Tyr Arg Met Ile Lys Leu Gly

805 810 815

Leu Gly Ile Asp Glu Asp Asp Pro Thr Ala Asp Asp Thr Ser Ala Ala

820 825 830

Val Thr Glu Glu Met Pro Pro Leu Glu Gly Asp Asp Asp Thr Ser Arg

835 840 845

Met Glu Glu Val Asp

850

<210> 2

<211> 2562

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgcccccgt gttcgggcgg ggacggctcc acccctcctg ggccctccct tcgggacagg 60

gactgtcccg cccagagtgc tgaatacccg cgcgaccgtc tggatccccg cccaggaagc 120

ccctctgaag cctcctcgcc gccgtttctg agaagcaggg cacctgttaa ctggtaccaa 180

gaaaaggccc aagtgtttct ctggcatctg atggtgtctg gatccaccac tctactctgt 240

ctctggaaac agcccttcca cgtctctgca ttccctgtca ccgcgtcact ggccttcaga 300

cagagccaag gtgcagggca acacctctac aaggatctgc agccatttat attgcttagg 360

ctactgatgc ctgaggaaac ccagacccaa gaccaaccga tggaggagga ggaggttgag 420

acgttcgcct ttcaggcaga aattgcccag ttgatgtcat tgatcatcaa tactttctac 480

tcgaacaaag agatctttct gagagagctc atttcaaatt catcagatgc attggacaaa 540

atccggtatg aaagcttgac agatcccagt aaattagact ctgggaaaga gctgcatatt 600

aaccttatac cgaacaaaca agatcgaact ctcactattg tggatactgg aattggaatg 660

accaaggctg acttgatcaa taaccttggt actatcgcca agtctgggac caaagcgttc 720

atggaagctt tgcaggctgg tgcagatatc tctatgattg gccagttcgg tgttggtttt 780

tattctgctt atttggttgc tgagaaagta actgtgatca ccaaacataa cgatgatgag 840

cagtacgctt gggagtcctc agcaggggga tcattcacag tgaggacaga cacaggtgaa 900

cctatgggtc gtggaacaaa agttatccta cacctgaaag aagaccaaac tgagtacttg 960

gaggaacgaa gaataaagga gattgtgaag aaacattctc agtttattgg atatcccatt 1020

actctttttg tggagaagga acgtgataaa gaagtaagcg atgatgaggc tgaagaaaag 1080

gaagacaaag aagaagaaaa agaaaaagaa gagaaagagt cggaagacaa acctgaaatt 1140

gaagatgttg gttctgatga ggaagaagaa aagaaggatg gtgacaagaa gaagaagaag 1200

aagattaagg aaaagtacat cgatcaagaa gagctcaaca aaacaaagcc catctggacc 1260

agaaatcccg acgatattac taatgaggag tacggagaat tctataagag cttgaccaat 1320

gactgggaag atcacttggc agtgaagcat ttttcagttg aaggacagtt ggaattcaga 1380

gcccttctat ttgtcccacg acgtgctcct tttgatctgt ttgaaaacag aaagaaaaag 1440

aacaacatca aattgtatgt acgcagagtt ttcatcatgg ataactgtga ggagctaatc 1500

cctgaatatc tgaacttcat tagaggggtg gtagactcgg aggatctccc tctaaacata 1560

tcccgtgaga tgttgcaaca aagcaaaatt ttgaaagtta tcaggaagaa tttggtcaaa 1620

aaatgcttag aactctttac tgaactggcg gaagataaag agaactacaa gaaattctat 1680

gagcagttct ctaaaaacat aaagcttgga atacacgaag actctcaaaa tcggaagaag 1740

ctttcagagc tgttaaggta ctacacatct gcctctggtg atgagatggt ttctctcaag 1800

gactactgca ccagaatgaa ggagaaccag aaacatatct attatatcac aggtgagacc 1860

aaggaccagg tagctaactc agcctttgtg gaacgtcttc ggaaacatgg cttagaagtg 1920

atctatatga ttgagcccat tgatgagtac tgtgtccaac agctgaagga atttgagggg 1980

aagactttag tgtcagtcac caaagaaggc ctggaacttc cagaggatga agaagagaaa 2040

aagaagcagg aagagaaaaa aacaaagttt gagaacctct gcaaaatcat gaaagacata 2100

ttggagaaaa aagttgaaaa ggtggttgtg tcaaaccgat tggtgacatc tccatgctgt 2160

attgtcacaa gcacatatgg ctggacagca aacatggaga gaatcatgaa agctcaagcc 2220

ctaagagaca actcaacaat gggttacatg gcagcaaaga aacacctgga gataaaccct 2280

gaccattcca ttattgagac cttaaggcaa aaggcagagg ctgataagaa cgacaagtct 2340

gtgaaggatc tggtcatctt gctttatgaa actgcgctcc tgtcttctgg cttcagtctg 2400

gaagatcccc agacacatgc taacaggatc tacaggatga tcaaacttgg tctgggtatt 2460

gatgaagatg accctactgc tgatgatacc agtgctgctg taactgaaga aatgccaccc 2520

cttgaaggag atgacgacac atcacgcatg gaagaagtag ac 2562

<210> 3

<211> 393

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Glu Glu Lys Glu Asp Lys Glu Glu Glu Lys Glu Lys Glu Glu Lys Glu

1 5 10 15

Ser Glu Asp Lys Pro Glu Ile Glu Asp Val Gly Ser Asp Glu Glu Glu

20 25 30

Glu Lys Lys Asp Gly Asp Lys Lys Lys Lys Lys Lys Ile Lys Glu Lys

35 40 45

Tyr Ile Asp Gln Glu Glu Leu Asn Lys Thr Lys Pro Ile Trp Thr Arg

50 55 60

Asn Pro Asp Asp Ile Thr Asn Glu Glu Tyr Gly Glu Phe Tyr Lys Ser

65 70 75 80

Leu Thr Asn Asp Trp Glu Asp His Leu Ala Val Lys His Phe Ser Val

85 90 95

Glu Gly Gln Leu Glu Phe Arg Ala Leu Leu Phe Val Pro Arg Arg Ala

100 105 110

Pro Phe Asp Leu Phe Glu Asn Arg Lys Lys Lys Asn Asn Ile Lys Leu

115 120 125

Tyr Val Arg Arg Val Phe Ile Met Asp Asn Cys Glu Glu Leu Ile Pro

130 135 140

Glu Tyr Leu Asn Phe Ile Arg Gly Val Val Asp Ser Glu Asp Leu Pro

145 150 155 160

Leu Asn Ile Ser Arg Glu Met Leu Gln Gln Ser Lys Ile Leu Lys Val

165 170 175

Ile Arg Lys Asn Leu Val Lys Lys Cys Leu Glu Leu Phe Thr Glu Leu

180 185 190

Ala Glu Asp Lys Glu Asn Tyr Lys Lys Phe Tyr Glu Gln Phe Ser Lys

195 200 205

Asn Ile Lys Leu Gly Ile His Glu Asp Ser Gln Asn Arg Lys Lys Leu

210 215 220

Ser Glu Leu Leu Arg Tyr Tyr Thr Ser Ala Ser Gly Asp Glu Met Val

225 230 235 240

Ser Leu Lys Asp Tyr Cys Thr Arg Met Lys Glu Asn Gln Lys His Ile

245 250 255

Tyr Tyr Ile Thr Gly Glu Thr Lys Asp Gln Val Ala Asn Ser Ala Phe

260 265 270

Val Glu Arg Leu Arg Lys His Gly Leu Glu Val Ile Tyr Met Ile Glu

275 280 285

Pro Ile Asp Glu Tyr Cys Val Gln Gln Leu Lys Glu Phe Glu Gly Lys

290 295 300

Thr Leu Val Ser Val Thr Lys Glu Gly Leu Glu Leu Pro Glu Asp Glu

305 310 315 320

Glu Glu Lys Lys Lys Gln Glu Glu Lys Lys Thr Lys Phe Glu Asn Leu

325 330 335

Cys Lys Ile Met Lys Asp Ile Leu Glu Lys Lys Val Glu Lys Val Val

340 345 350

Val Ser Asn Arg Leu Val Thr Ser Pro Cys Cys Ile Val Thr Ser Thr

355 360 365

Tyr Gly Trp Thr Ala Asn Met Glu Arg Ile Met Lys Ala Gln Ala Leu

370 375 380

Arg Asp Asn Ser Thr Met Gly Tyr Met

385 390

<210> 4

<211> 1179

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gaagaaaagg aagacaaaga agaagaaaaa gaaaaagaag agaaagagtc ggaagacaaa 60

cctgaaattg aagatgttgg ttctgatgag gaagaagaaa agaaggatgg tgacaagaag 120

aagaagaaga agattaagga aaagtacatc gatcaagaag agctcaacaa aacaaagccc 180

atctggacca gaaatcccga cgatattact aatgaggagt acggagagtt ctataagagc 240

ttgaccaatg actgggaaga tcacttggca gtgaagcatt tttcagttga aggacagttg 300

gagttcagag cccttctatt tgtcccacga cgtgctcctt ttgatctgtt tgaaaacaga 360

aagaaaaaga acaacatcaa attgtatgta cgcagagttt tcatcatgga taactgtgag 420

gagctaatcc ctgaatatct gaacttcatt agaggggtgg tagactcgga ggatctccct 480

ctaaacatat cccgtgagat gttgcaacaa agcaaaattt tgaaagttat caggaagaat 540

ttggtcaaaa aatgcttaga actctttact gaactggcgg aagataaaga gaactacaag 600

aaattctatg agcagttctc taaaaacata aagcttggaa tacacgaaga ctctcaaaat 660

cggaagaagc tttcagagct gttaaggtac tacacatctg cctctggtga tgagatggtt 720

tctctcaagg actactgcac cagaatgaag gagaaccaga aacatatcta ttatatcaca 780

ggtgagacca aggaccaggt agctaactca gcctttgtgg aacgtcttcg gaaacatggc 840

ttagaagtga tctatatgat tgagcccatt gatgagtact gtgtccaaca gctgaaggaa 900

tttgagggga agactttagt gtcagtcacc aaagaaggcc tggaacttcc agaggatgaa 960

gaagagaaaa agaagcagga agagaaaaaa acaaagtttg agaacctctg caaaatcatg 1020

aaagacatat tggagaaaaa agttgaaaag gtggttgtgt caaaccgatt ggtgacatct 1080

ccatgctgta ttgtcacaag cacatatggc tggacagcaa acatggagag aatcatgaaa 1140

gctcaagccc taagagacaa ctcaacaatg ggttacatg 1179

Claims (10)

1. The application of the heat shock protein 90 in preparing the medicine for treating cataract is characterized in that the amino acid sequence of the heat shock protein 90 is shown as SEQ ID NO. 1.

2. The application of the heat shock protein 90 in preparing the medicine for promoting the terminal differentiation of lens epithelial cells into lens fibers is characterized in that the amino acid sequence of the heat shock protein 90 is shown as SEQ ID NO. 1.

3. The application of the heat shock protein 90 in preparing the medicine for inhibiting the keratinization of the lens epithelial cells is characterized in that the amino acid sequence of the heat shock protein 90 is shown as SEQ ID NO. 1.

4. The application of the heat shock protein 90 in preparing the medicine for promoting the lens regeneration is characterized in that the amino acid sequence of the heat shock protein 90 is shown as SEQ ID NO. 1.

5. The use of any one of claims 1-4, wherein the heat shock protein 90 is incorporated into a pharmaceutically acceptable carrier and formulated into any one of pharmaceutically acceptable dosage forms.

6. The application of the heat shock protein 90 truncated protein in preparing the medicine for treating cataract is characterized in that the amino acid sequence of the heat shock protein 90 truncated protein is shown as SEQ ID NO. 3.

7. The application of the heat shock protein 90 truncated protein in preparing the medicine for promoting the terminal differentiation of lens epithelial cells into lens fibers is characterized in that the amino acid sequence of the heat shock protein 90 truncated protein is shown as SEQ ID No. 3.

8. The application of the heat shock protein 90 truncated protein in preparing the medicine for inhibiting the keratinization of the lens epithelial cells is characterized in that the amino acid sequence of the heat shock protein 90 truncated protein is shown as SEQ ID NO. 3.

9. The application of the heat shock protein 90 truncated protein in preparing the medicine for promoting the lens regeneration is characterized in that the amino acid sequence of the heat shock protein 90 truncated protein is shown as SEQ ID NO. 3.

10. The use of any one of claims 6 to 9, wherein the heat shock protein 90 truncated protein is incorporated into a pharmaceutically acceptable carrier and formulated into any one of pharmaceutically acceptable dosage forms.

Images