CN110066870A

CN110066870A - Application of hsa-miR-382-5p in preparation of kit for diagnosing retinal degeneration diseases

Info

Publication number: CN110066870A
Application number: CN201910293864.XA
Authority: CN
Inventors: 陈雪; 刘庆淮; 蒋超; 杨戴帝; 孙汝许; 赵晨; 计江东
Original assignee: Jiangsu Province Hospital First Affiliated Hospital With Nanjing Medical University
Current assignee: Jiangsu Province Hospital First Affiliated Hospital With Nanjing Medical University
Priority date: 2019-04-12
Filing date: 2019-04-12
Publication date: 2019-07-30
Anticipated expiration: 2039-04-12
Also published as: CN110066870B

Abstract

The invention discloses application of hsa-miR-382-5p in preparation of a kit for diagnosing retinal degeneration diseases. A diagnostic kit for retinal degeneration diseases comprises a reagent for detecting the expression quantity of hsa-miR-382-5 p. The application of the substance for inhibiting the expression quantity of hsa-miR-382-5p in the preparation of the medicine for treating the retinal degeneration disease. Researches show that the expression quantity of hsa-miR-382-5p is increased to be used as an auxiliary diagnosis basis for retinal degeneration diseases, and the early diagnosis of the retinal degeneration diseases is facilitated. The damage effect of hsa-miR-382-5p on retina suggests that the hsa-miR-382-5p can be used for preparing and screening medicaments for treating retinal degeneration diseases. The invention provides a novel detection marker and a novel therapeutic target for retinal degenerative diseases, and provides brand-new molecular information and biological basis for diagnosis and treatment of the diseases.

Description

Hsa-miR-382-5p is in the kit of preparation diagnosis retinal degenerative disease Using

Technical field

The invention belongs to fields of biomedicine, are related to Microrna hsa-miR-382-5p preparation diagnosis retinosis disease Application in the kit of disease.

Background technique

Blinding eye disease is the third-largest influence human health disease of World Health Organization, global about 2.5 hundred million eyesights Disabled person and China accounts for nearly 20%.Retinal degenerative disease there is no effective treatment method at present, is important blinding eye disease, is The sciences problems and great public health problem urgently captured.The pathogenesis multiplicity of retinal degenerative disease, can according to the cause of disease To be divided into the hereditary retinal dystrophy disease as caused by single-gene defect and the complexity retina as caused by multifactor damage Degenerative disease.

Hereditary retinal dystrophy disease be with inherent cause it is closely related, with primary degeneration of retina be main pathology Change, be badly damaged with visual functions such as eyesight and the visuals field as main clinical phenotypes.Hereditary retinal dystrophy disease is world's model The primary blinding eye disease of disease incidence in interior work age groups is enclosed, disease incidence is about 1/3000 in developed country, at me State is then higher, and only the disease incidence of retinal pigment degeneration is as high as 1/1000 or so, estimates the Inherited retinal in China accordingly Degenerative disease patient is more than 1,300,000.Clinically it there is no effective therapeutic modality for hereditary retinal dystrophy disease at present, sternly The health of compatriots is compromised again.

Age-related macular degeneration (age-related macular degeneration, AMD) is most commonly seen A kind of complexity retinal degenerative disease, also referred to as senile macular degeneration are that the aging of macula lutea plot structure sexually revises, the head of patient Sending out clinical symptoms is metamorphopsia and visual impairment.AMD mostly occurs in 45 years old or more crowd, illness rate with the growth at age and by Step increases, and is the irreversible blind first cause of elderly population in world wide.In China, with the acceleration of population aging, AMD Illness rate increase year by year, show AMD in each age group crowd of Shanghai City according to the cri dernier cri disease statistical result in multiple cities Recall rate respectively be up to 6.23% (60~69 years old), 14.98% (70~79 years old) and 29.91% (80 years old or more), Wuxi City The recall rate of AMD then be respectively 3.43% (50~59 years old), 7.73% (60~69 years old), 14.69% (70~79 years old) and 16.51% (80 years old or more), more some researches show that, Hangzhou cause 70 years old and the cause of disease of above the elderly's inpairment of vision in, AMD accounts for 45.64%, these epidemic datas all show AMD gradually as the irreversible vision impairment of China's elderly population Main cause.Can be divided AMD according to the course of disease of disease in clinical manifestation then can further divide for early and late AMD, advanced stage AMD For stemness and moist amphitypy.Clinical effective therapeutic modality still without being directed to stemness AMD at present.It is clinical at present for moist AMD Upper master is to be used to be treated for anti-vegf, and anti-VEGF antibody can effectively inhibit the expression of VEGF, inhibit the generation of CNV and reduction Vascular leakage.However, there is also a series of defects for anti vegf agents treatment, multiple intraocular injection is generally required, is increased The pain of patient has also aggravated financial burden, and the therapeutic effect of anti vegf agents differs greatly with different patients, part Patient's unsatisfactory curative effect after the treatment of multiple anti-vegf, eyesight still can not improve or improve unobvious.Retinal degenerative disease is not only The quality of life of our people is drastically influenced, also brings harm to the development of national economy.Therefore, to retinosis disease The early diagnosis of disease is intervened, and finds novel, sensitive and applies convenient disease detection marker, view can effectively be controlled by finding The treatment and prevention means of nethike embrane degenerative disease disease, are of great practical significance.

Microrna (MicroRNA, miRNA) is tiny RNA of a kind of length between 20-24 nucleotide, in the cell With a variety of important adjustment effects, the post-transcriptional control of gene is participated in.It is assumed that miRNA adjusts one of trichotomy Gene.The regulating networks of this complexity can both regulate and control the expression of multiple genes by a miRNA, can also be by several The combination of miRNA carrys out the expression of some gene of finely regulating.MiRNA depends primarily on it and target base to the effect of target gene mRNA Because of the degree of transcription sequence complementation: (1) cut off the mRNA molecule of target gene: miRNA is in conjunction with target gene complete complementary, effect Mode and function are closely similar with siRNA, finally cut said target mrna；(2) inhibit the translation of target gene: miRNA and target gene are not Complete complementary combines, stability of the aporepressor translation without influencing mRNA.MiRNA participates in intracellular various procedures regulation, Play a significant role in numerous vital movements, at the same also with the generation of many diseases, development there is very closely contact. MiRNA can be used as a new class of disease markers, its specific variations are inevitable associated with disease generation development.Meanwhile MiRNA is alternatively arranged as potential drug target, by inhibiting the miRNA raised in lysis or being overexpressed downward MiRNA, it would be possible to greatly alleviate the occurrence and development of disease.

Summary of the invention

The object of the present invention is to provide the new opplications of hsa-miR-382-5p.

The purpose of the present invention can be achieved through the following technical solutions:

It is a kind of detect hsa-miR-382-5p expression quantity reagent preparation diagnosis retinal degenerative disease kit in Application, it is characterised in that the hsa-miR-382-5p sequence is as shown in SEQ ID NO.4.

The reagent of the detection hsa-miR-382-5p expression quantity preferably has detection special hsa-miR-382-5p Anisotropic probe, genetic chip or real-time quantitative PCR (quantitative real-time polymerase chain Reaction, Q-PCR) primer.

Described has the stem-loop RT PCR primer sequence of detection specificity preferably such as to hsa-miR-382-5p Under:

GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGAATC(SEQ ID NO.1)。

Described has the Q-PCR primer of detection specificity preferably as follows hsa-miR-382-5p:

Upstream primer: GCGCGAAGTTGTTCGTGGTG (SEQ ID NO.2)；

Downstream primer: GTGCAGGGTCCGAGGT (SEQ ID NO.3).

A kind of diagnostic kit of retinal degenerative disease, the reagent comprising detecting hsa-miR-382-5p expression quantity.

The kit is preferably comprised to the hsa-miR-382-5p probe with detection specificity or to hsa-miR- 382-5p has the real-time quantitative PCR primer of detection specificity.

Described has the probe sequence of detection specificity as shown in SEQ ID NO.1 hsa-miR-382-5p；It is described To hsa-miR-382-5p have detection specificity real-time quantitative PCR primer such as SEQ ID NO.2 and SEQ ID NO.3 institute Show.

Inhibit application of the substance of hsa-miR-382-5p expression quantity in the drug of preparation treatment retinal degenerative disease.

Application of the hsa-miR-382-5p as drug target in the drug of screening treatment retinal degenerative disease.

The utility model has the advantages that

1. applicant filters out hsa-miR-382-5p conduct on the basis of being engaged in clinical treatment and basic research for many years The detection marker of retinal degenerative disease, and hsa-miR-382-5p and retinosis disease are specified by the method for the invention The relationship of disease.

2. inventor is it has been investigated that hsa-miR-382-5p expression quantity increases the auxiliary that can be used as retinal degenerative disease Diagnosis basis helps the early diagnosis for realizing retinal degenerative disease.Damaging effect of the hsa-miR-382-5p to retina, It is prompted to can be used for preparing and screening the drug for treating retinal degenerative disease.The present invention provides new retinosises The detection marker and therapy target of disease provide completely new molecular information and biologically-based for the diagnosing and treating of the disease Plinth.

Detailed description of the invention

Fig. 1 hsa_circ_0001543 is in the retinal tissue of 6 normal persons and 9 retinal degenerative disease patients Expression compare

Fig. 2 hsa_circ_0001543 and hsa-miR-382-5p interaction sites schematic diagram

Luciferase reporter gene experimental result in Fig. 3 ARPE19 cell

Hsa-miR-382-5p strikes the (hsa_circ_ that comes down to a lower group in hsa_circ_0001543 in Fig. 4 ARPE19 cell 0001543siRNA) compared with the expression in control group (scramble siRNA)

The expression of Fig. 5 U6, GAPDH and hsa-miR-382-5p in ARPE19 cytoplasm and nucleus compares

Retinal specific marker gene is in hsa-miR-382-5p overexpression group (hsa-miR- in Fig. 6 ARPE19 cell 382-5p mimic) compared with the expression in control group (NC mimic)

Retinal specific labelled protein BEST1 is in hsa-miR- in the ARPE19 cell that Fig. 7 immunofluorescence dyeing is shown 382-5p overexpression group is compared with the expression in control group

Cell connects specific marker proteins ZO-1 in hsa-miR- in the ARPE19 cell that Fig. 8 immunofluorescence dyeing is shown 382-5p overexpression group is compared with the expression in control group

Cell connection specific marker proteins β-catenin exists in the ARPE19 cell that Fig. 9 immunofluorescence dyeing is shown Hsa-miR-382-5p overexpression group is compared with the expression in control group

The microsphere particle swallowed in the ARPE19 cell that Figure 10 immunofluorescence dyeing is shown crosses table in hsa-miR-382-5p Up to group compared with the content situation in control group

The microsphere particle swallowed in Figure 11 ARPE19 cell content in hsa-miR-382-5p overexpression group and control group Quantization compare

ARPE19 cell Mitochondria active oxygen (the reactive oxygen that Figure 12 immunofluorescence dyeing is shown Species, ROS) in hsa-miR-382-5p overexpression group compared with content in control group

The amount of Figure 13 ARPE19 cell Mitochondria ROS content in hsa-miR-382-5p overexpression group and control group Change is compared

The cell of the EdU positive is overexpressed in hsa-miR-382-5p in the ARPE19 cell that Figure 14 immunofluorescence dyeing is shown Group is compared in control group

The cell proportion of the EdU positive is in hsa-miR-382-5p overexpression group and control group in Figure 15 ARPE19 cell Comparison

Mouse Retina pigment epithelium that Figure 16 immunofluorescence dyeing is shown (retinal pigment epithelium, RPE) in tissue ZO-1 albumen expression quantity mmu-miR-382-5p overexpression group (mmu-miR-382-5p agomir) with it is right Compare according to the expression in group (NC agomir)

The expression quantity of β-catenin albumen is in mmu-miR- in the mouse RPE tissue that Figure 17 immunofluorescence dyeing is shown 382-5p overexpression group is compared with the expression in control group

The Mouse Retina RPE and photosensory cell that Figure 18 transmission electron microscope is shown mmu-miR-382-5p overexpression group with it is right According to the Morphological comparison in group

Specific embodiment

Embodiment 1:

Our induce multi-potent stem cell-retinal color to each different divergaence time points by circRNA chip early periods Plain epithelial cell (induced pluripotent stem cells-retinal pigment epithelium, iPSC- RPE the detection for) having carried out circRNA expression quantity finds the expression quantity of hsa_circ_0001543 with RPE cell differentiation Increase and increase, height prompts potential important function of the hsa_circ_0001543 in RPE cell differentiation procedure.For into one Pathology sense of the clear hsa_circ_0001543 in retinal degenerative disease is walked, we are first in normal control and retina The expression quantity of hsa_circ_0001543 is detected in the retinal tissue of degenerative disease patient.

Experimental method:

1. the acquisition of normal control and the blood preparation of retinal degenerative disease patient:

Collect the blood sample of patient and 6 normal controls that 9 clinical definites are retinal degenerative disease voluntarily contributed This, carries out RNA extraction.With 5~8mL of peripheric venous blood of EDTA anticoagulant blood-collecting pipe collection research object, total serum IgE is extracted.

2.Q-PCR detection:

Further by reverse transcription PCR (reverse transcription-PCR, RT-PCR) and Q-PCR to blood rna The expression quantity of hsa_circ_0001543 is detected in sample.

RT-PCR:

Reverse transcription reaction is carried out by following system using Takara Reverse Transcriptase kit, mRNA is transcribed into cDNA, is reacted System (40 μ l) is as follows:

Reaction condition: room temperature 10min, 42 DEG C of 45min, 95 DEG C of 5min, 4 DEG C of 5min.

Q-PCR:

Q-PCR reaction is carried out using the cDNA template generated by RT-PCR, reaction system is as follows:

Involved primer sequence is referring to following table:

Q-PCR reaction condition:

According to formula R (relative expression quantity)=2^-ΔΔct=2^{[(ct sample-ct internal reference)-(ct blank-ct internal reference blank)]}Calculate relative expression quantity.

Experimental result:

Chip test result discovery hsa_circ_0001543 is deposited in retinal degenerative disease patient and Normal group In differential expression, the expression in the retina group of retinal degenerative disease patient significantly reduces (figure compared with normal control 1).Disease associated, the hsa_circ_0001543 of hsa_circ_0001543 and retinal degenerative disease is further prompted It may play the role of to the course of disease of retinal degenerative disease protective.

2 hsa_circ_0001543 of embodiment can adsorb hsa-miR-382-5p as miRNA sponge, regulate and control its table It reaches

We have found that hsa_circ_0001543 and miRNA hsa-miR-382-5p is deposited by online sequence alignment program At potential interaction sites (Fig. 2), prompt hsa_circ_0001543 that may can be used as miRNA sponge absorption hsa-miR- 382-5p.To confirm this viewpoint, we detect the interaction relationship of the two by luciferase reporter gene experiment, And hsa_circ_0001543 is detected by Q-PCR referring to embodiment 1, the expression regulation of hsa-miR-382-5p is acted on.

Experimental method:

1. the building of Reporter gene vector:

Using human gene group DNA as template, the hsa_circ_0001543 sequence of PCR amplification wild type (WT), PCR product is pure Change, recycling, using the T-A Cloning Kit of Promega company, clone's building obtains the hsa_circ_0001543 sequence with WT The carrier of column, reaction system (10 μ l) are as follows:

After 4 DEG C of connections overnight, using being converted in DH5 α competent cell, growth is stayed overnight, the single colonies of picking, Carry out digestion identification, the specific steps are as follows:

(1) preparation of DH5 α competent cell

The E.coli DH5 α single colonie newly activated from picking on LB plate, is inoculated in 3~5ml LB liquid medium, Shaken cultivation 12h or so at 37 DEG C, until the logarithmic growth later period.The bacteria suspension is inoculated in the ratio of 1:100~1:50 In 100ml LB liquid medium, 37 DEG C of 2~3h to OD600 ≈ of shaken cultivation 0.5 or so.Culture solution is transferred in centrifuge tube, 10min is placed on ice, and then 3000rpm is centrifuged 10min at 4 DEG C.It discards supernatant, with the CaCl of the 0.05mol/L of pre-cooling₂It is molten Liquid 10ml gently suspension cell, after placing 30min on ice, 3000rpm is centrifuged 10min at 4 DEG C.It discards supernatant, 4ml pre-cooling is added 0.05M CaCl containing 15% glycerol₂Solution, gently suspension cell, is placed several minutes on ice, competent cell suspension.Sense It is distributed into the aliquot of 200 μ l by state cell, is stored in -70 DEG C of storable half a year；

(2) conversion of connection product

Full dose (10 μ l) is added into E.coli DH5 α competent cell, and 30min is placed in ice；42 DEG C of heat shocks 45sec, then 1min is placed in ice；Be added 890 μ l LB culture mediums, after 37 DEG C of shaken cultivation 60min, containing X-Gal, It is incubated overnight on the L- Agar Plating of IPTG, Amp, forms single colonie；

(3) screening and identification of positive colony

5~6 white colonies of picking, are inoculated in the LB culture medium that 2ml contains Amp, 37 DEG C respectively, 220rpm oscillation training It supports overnight.Plasmid is extracted using plasmid extraction kit (Promega company).Spectrophotometric determination plasmid concentration, plasmid warp XbaI single endonuclease digestion Preliminary Identification, plasmid pMD18T-MPFG-flag single endonuclease digestion reaction system (20 μ l) are as follows:

After 37 DEG C of digestion 4h, through 1% agarose gel electrophoresis, the sample of the digestion positive recycles mesh using plastic recovery kit Segment, it is spare.Every part of mark product take 200ng Plasmid DNA that Nanjing Jin Sirui company is sent to be sequenced respectively simultaneously.Sequencing result is just True sample marks spare.After sequencing is confirmed that sequence is correct, by by the segment after XbaI enzyme cutting, connect into same enzyme PGL3-Promoter carrier after cutting forms plasmid.Reaction system (20 μ l) is as follows:

After 4 DEG C of connections overnight, conversion, digestion is selected positive colony, is verified by bidirectional sequencing.The correct sample of sequencing result Product, the purpose plasmid Circ of as WT^WT；

(5) with plasmid Circ^WTFor template, QuikChange Lightning Site-Directed is utilized Mutagenesis kit (Aglient company, the U.S.), in Circ^WTThe mutation being introduced into Fig. 2 in plasmid, obtains plasmid Circ^MU, reaction system (50 μ l) is as follows:

PCR reaction condition:

2 μ l DpnI restriction enzymes are added in PCR reaction product, after reacting 5min at 37 DEG C, product purification turns Change, digestion is selected positive colony, verified by bidirectional sequencing.The correct sample of sequencing result, the purpose plasmid of as MU Circ^MU。

2. luciferase reporter gene is tested:

(1) the previous day transfected is with 5 × 10⁵The quantity in/hole is planted respectively into ARPE19 cell；

(2) by internal reference plasmid CMV-Renilla (Promega company) respectively with NC mimic/hsa-miR-382-5p Mimic and Circ^WT/Circ^MUIt is transfected into ARPE19 cell jointly；

(3) 48h receives cell after transfecting, and abandons culture solution, and ice-cold PBS is washed twice, and the detection of Luciferase reporter gene is added Albumen is extracted in 100 hole μ l/ 1 × lysis buffer that (Promega company) provides in kit；

(4) 20 μ l albumen are added in the firefly reaction substrat of every 100 μ l of pipe, are put at once Machine testing readings on GloMax-96 luminometer measures respectively and records Luciferase fluorescent value and CMV-Renilla Fluorescent value, use wherein CMV-Renilla fluorescent value balance transfection efficiency as internal reference.Each experimental group is all provided with three pairs It averages in hole.Experimental result:

It is prompted by the luciferase reporter gene experimental result of Fig. 3, compared to NC mimic and Circ^WTCotransfection group, Hsa-miR-382-5p mimic and Circ^WTThe uciferase activity of cotransfection group is remarkably decreased, and NC mimic and Circ^MU Cotransfection group is compared to hsa-miR-382-5p mimic and Circ^MUThe uciferase activity of cotransfection group is without significant difference.By The Q-PCR result of Fig. 4 prompts, and the expression quantity of hsa-miR-382-5p significantly increases in hsa_circ_0001543 strikes and comes down to a lower group, Hsa_circ_0001543 is prompted to there is expression negative regulation to hsa-miR-382-5p.Accordingly, it is believed that hsa_circ_ 0001543 can adsorb hsa-miR-382-5p as miRNA sponge, and reduce the expression of hsa-miR-382-5p.

The analysis of 3 hsa-miR-382-5p intracellular targeting of embodiment

Hsa-miR-382-5p is expressed in ARPE19 cell by caryoplasm separation RNA quantitative detection experiment and is determined U6 is set as nucleus specific localization reference by position, and GAPDH is the reference of cytoplasm specific localization, and caryoplasm separates RNA and extracts institute Use PARIS^TMKit (Invitrogen company), RNA quantitative detecting method is referring to embodiment 1.In strict accordance with reagent Box specification is operated.

Experimental result:

Caryoplasm separation RNA extracts discovery hsa-miR-382-5p and is mainly expressed in the cytoplasm of ARPE19 cell (Fig. 5).

Influence of 4 hsa-miR-382-5p of embodiment to RPE cell function related genes and protein expression

In retinal degenerative disease, the expression of RPE cell degeneration, RPE cell function related genes and albumen is lowered, RPE cell is caused dysfunction occur.For pathological effect of the clear hsa-miR-382-5p in retinal degenerative disease, we Have detected its influence to RPE cell function related genes and protein expression.Two groups of different ARPE19 cell processing are set altogether Group, respectively hsa-miR-382-5p overexpression group (hsa-miR-382-5p mimic) and its control group (NC mimic).Its In, NC mimic and hsa-miR-382-5p mimic are purchased from Rui Bo biotech firm.

Experimental method:

1. extracting the RNA in cell first.

2. by reverse transcription PCR (reverse transcription-PCR, RT-PCR) and Q-PCR, to different disposal group The table of retinal specific marker gene (including MITF, RLBP1, LRAT, KRT18, CTNNB1 and TJP1) in ARPE19 cell Up to being detected.

RT-PCR:

Q-PCR:

Involved primer sequence is referring to following table:

Q-PCR reaction condition:

3. by immunofluorescence dyeing, to retinal specific labelled protein BEST1 in different disposal group ARPE19 cell, The expression of cell connection specific marker proteins ZO-1 and β-catenin detects, and steps are as follows for specific experiment:

(1) cell climbing sheet: cell is laid in 8 hole Chamber slide tissue culture plates (Millipore company), reference Cell culture part；

(2) go out from incubator and take out cell, after PBS washing, 4% paraformaldehyde (paraformaldehyde, PFA) is fixed 30~60min；

(3) after PBS rinses 10min, 0.5%Triton X-100 perforation 20min；

(4) PBS is rinsed 2 times, and after each 10min, 1%BSA closes 30min；

(5) the diluted primary antibody of 1%BSA is added, in 4 DEG C of hybridized overnights；

(6) PBS is rinsed 2 times, and after each 10min, the diluted fluorescence secondary antibody of 1%BSA, 37 DEG C of hybridization 2h are added；

(7) PBS is rinsed 2 times, and after each 10min, DAPI (Sigma company) the dye core containing anti-quencher simultaneously prevents fluorescence It is quenched, mounting；

(8) it Olympus IX70 confocal laser scanning microscope and takes pictures.

Related antibody information is referring to following table:

Experimental result:

The result of Q-PCR prompts, retinal specific marker gene in ARPE19 cell (including MITF, RLBP1, LRAT, KRT18, CTNNB1 and TJP1) expression (figure is significantly reduced in hsa-miR-382-5p overexpression group compared with its control group 6).The result of immunofluorescence dyeing prompts, and retinal specific labelled protein BEST1, cell connection are special in ARPE19 cell The fluorescence intensity of property labelled protein ZO-1 and β-catenin obviously weaken in hsa-miR-382-5p overexpression group compared with control group (Fig. 7,8,9) further prompt the expression quantity of these albumen significantly to drop in hsa_circ_0001543 strikes and comes down to a lower group compared with control group It is low.

To sum up, ours as a result, it has been found that be overexpressed hsa-miR-382-5p be able to suppress RPE cell function related proteins Expression, further prompt its latent lesion to RPE cell and in the retinal degenerative disease course of disease to act on.

Influence of 5 hsa-miR-382-5p of embodiment to RPE cytophagy

Two groups of different ARPE19 cell processing groups, respectively hsa-miR-382-5p overexpression group and its control are set altogether Group, with embodiment 3.Polystyrene latex microballoon (Sigma company) the specific detection different disposal group modified by carboxylate The phagocytic function of APRE19 cell.The microsphere particle has green fluorescence, and can be swallowed by RPE cell, by detecting and comparing Compared with the intensity of the intracellular green fluorescence of different disposal group APRE19, to help to assess the phagocytic activity of RPE cell.It is intracellular green Color fluorescence intensity is higher, shows that the microsphere particle of cell phagocytosis is more, the phagocytic activity of RPE cell is stronger.Experimental implementation is stringent It is carried out according to kit specification.

Experimental result:

The intracellular green fluorescence intensity of ARPE19 obviously weakens (figure in hsa-miR-382-5p overexpression group compared with control group 10,11) microsphere particle, swallowed in prompt RPE substantially reduces in hsa-miR-382-5p overexpression group compared with control group.We The result shows that hsa-miR-382-5p is able to suppress the phagocytosis of RPE cell, further prompted it to RPE cell and in view Latent lesion effect in the film degenerative disease course of disease.

6 hsa-miR-382-5p of embodiment to RPE cellular oxidation stress influence

Two groups of different ARPE19 cell processing groups, respectively hsa-miR-382-5p overexpression group and its control are set altogether Group；With embodiment 3.By MitoSOX red mitochondria superoxides fluorescence probe, (Thermo Fisher Scientific is public Department) content of mitochondria activity oxygen (ROS) in each processing group living cells of specific detection, to help to assess the oxygen of RPE cell Change stress situation.Intracellular red fluorescence intensity is higher, shows that the ROS content generated into the cell is higher, and RPE cell is in oxidation Stress situation.Experimental implementation is carried out in strict accordance with kit specification.

Experimental result:

By Figure 12 and Figure 13 as it can be seen that the fluorescence intensity of hsa-miR-382-5p overexpression group ARPE19 cell is significantly stronger than pair According to group, show that the intracellular ROS content of ARPE19 significantly increases in hsa-miR-382-5p overexpression group compared with control group.We The result shows that hsa-miR-382-5p can promote the oxidative stress of RPE cell, further prompted its to RPE cell and Latent lesion effect in the retinal degenerative disease course of disease.

Influence of 7 hsa-miR-382-5p of embodiment to RPE ability of cell proliferation

Two groups of different ARPE19 cell processing groups, respectively hsa-miR-382-5p overexpression group and its control are set altogether Group；With embodiment 3.ByEdU Alexa488Imaging Kit (Invitrogen company) statistics is different The EdU positive cell ratio of processing group ARPE19 cell, to help to assess the proliferative capacity of cell.Experimental implementation in strict accordance with Kit specification carries out.

Experimental result:

Figure 14 and Figure 15 are shown: the cell proportion of the EdU positive is aobvious in hsa-miR-382-5p overexpression group ARPE19 cell It writes and is higher than control group.As it can be seen that the proliferative capacity of ARPE19 cell is significant compared with control group in hsa-miR-382-5p overexpression group It improves.Our result indicate that being overexpressed the proliferation that hsa-miR-382-5p is able to suppress RPE cell, prompt it in RPE cell Potential inhibiting effect in atomization has further prompted it latent to RPE cell and in the retinal degenerative disease course of disease In damaging effect.

Influence of 8 mmu-miR-382-5p of embodiment in mouse to its RPE form and functional dependency protein expression

Two eyes of same mouse are set to mmu-miR-382-5p mistake by the C57BL/6 mouse for selecting 5-6 week old Expression group (mmu-miR-382-5p agomir (sequence is as shown in SEQ ID NO.5)；Mmu-miR-382-5p is hsa-miR- 382-5p corresponding same miRNAs in mouse) and control group (NC agomir), the specific operation method is as follows:

(1) 4.3% chloraldurate 0.01ml/g intraperitoneal anesthesia mouse；

(2) Tropicamide and Phenylephrine eyedrop eyes mydriasis, preoperative double ocellus table anaesthetic keep eye with methylcellulose in art Table is wet；

(3) the 1 μ L (mmu-miR-382-5p of injection drug of 1nmol/ μ L is drawn with 33G syringe (Hamilton company) Agomir or NC agomir is purchased from Rui Bo biotech firm), 1mm avoids doing notch at blood vessel after corneoscleral junction, and needle point is vertical Into towards vitreous chamber center.It slowly injects after syringe needle enters vitreous chamber, let the acupuncture needle remain at a certain point after pushing pin 0.5-1min, goes out rapidly Needle.

Mouse is spaced after injecting for the first time goes identical injection for 2 weeks again, and second of injection took out eyeball of mouse after 2 weeks, respectively It is observed and is compared by expression of the immunofluorescence dyeing to retinal specific albumen ZO-1, seen by transmission electron microscope Examine retina microstructure.The specific operation method is as follows:

(1) immunofluorescence dyeing: taking out eyeball of mouse, removes prosthomere and is fixed on 4%PFA, isolated RPE choroid Tissue, immunofluorescence dyeing are observed and are compared, concrete operation method to the expression of retinal specific albumen ZO-1 Referring to embodiment 3；

(2) transmission electron microscope observing retina microstructure: eyeball of mouse is taken out, 2.5% glutaraldehyde is fixed on.It is de- through ethyl alcohol Water, embedding, solidification, ultramicrotome 70nm slice, the double dyeing of 3% acetic acid uranium-lead citrate, transmission electron microscope observing retina are aobvious Micro-structure.

Experimental result:

By Figure 16 with Figure 17 as it can be seen that cell connects specific marker in immunofluorescence dyeing result prompt mouse RPE tissue The expression quantity of albumen ZO-1 and β-catenin significantly reduce in mmu-miR-382-5p overexpression group compared with control group.Transmission electricity The RPE cell of mirror result prompt mmu-miR-382-5p overexpression group mouse is significantly thickened compared with control group, RPE substrate folding part, Microvillus and photosensory cell acromere dish structure disorder (Figure 18).Our result indicate that mmu-miR-382-5p can be in mouse The expression for inhibiting RPE cell function related proteins, causes the abnormal change of RPE and photosensory cell, has further prompted its right RPE cell and the latent lesion effect in the retinal degenerative disease course of disease.

Sequence table

<110>Jiangsu Prov. People's Hospital (No.1 Attached Hospital, Nanjing Medical Univ)

<120>application of the hsa-miR-382-5p in the kit of preparation diagnosis retinal degenerative disease

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 50

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgaccgaatc 50

<210> 2

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

gcgcgaagtt gttcgtggtg 20

<210> 3

<211> 16

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

gtgcagggtc cgaggt 16

<210> 4

<211> 22

<212> RNA

<213>mankind (Homo sapiens)

<400> 4

gaaguuguuc gugguggauu cg 22

<210> 5

<211> 22

<212> RNA

<213>mankind (Homo sapiens)

<400> 5

gaaguuguuc gugguggauu cg 22

Claims

1.hsa-miR-382-5p as application of the biomarker in the kit of preparation diagnosis retinal degenerative disease, It is characterized in that the hsa-miR-382-5p sequence as shown in SEQ ID NO.4.

2. a kind of reagent for detecting hsa-miR-382-5p expression quantity is in the kit of preparation diagnosis retinal degenerative disease Using.

3. application according to claim 2, it is characterised in that the reagent of the detection hsa-miR-382-5p expression quantity To have probe, genetic chip or the real-time quantitative PCR primer of detection specificity to hsa-miR-382-5p.

4. application according to claim 3, it is characterised in that described that there is detection specificity to hsa-miR-382-5p Probe sequence as shown in SEQ ID NO.1.

5. application according to claim 3, it is characterised in that described that there is detection specificity to hsa-miR-382-5p Real-time quantitative PCR primer as shown in SEQ ID NO.2 and SEQ ID NO.3.

6. a kind of diagnostic kit of retinal degenerative disease, it is characterised in that include detection hsa-miR-382-5p expression quantity Reagent.

7. diagnostic kit according to claim 6, it is characterised in that the kit includes to hsa-miR-382- Probe of the 5p with detection specificity or the real-time quantitative PCR primer to hsa-miR-382-5p with detection specificity.

8. diagnostic kit according to claim 6, it is characterised in that described that there is detection to hsa-miR-382-5p The probe sequence of specificity is as shown in SEQ ID NO.1；Described has the real-time of detection specificity to hsa-miR-382-5p Quantification PCR primer is as shown in SEQ ID NO.2 and SEQ ID NO.3.

9. inhibiting application of the substance of hsa-miR-382-5p expression quantity in the drug of preparation treatment retinal degenerative disease.

10.hsa-miR-382-5p as application of the drug target in the drug of screening treatment retinal degenerative disease.