CN113913556A - Kit for rapidly detecting bat adenovirus and detection method thereof - Google Patents

Abstract

The invention discloses a kit for rapidly detecting bat adenovirus and a detection method thereof. The method comprises the following steps: specific isothermal amplification primers designed aiming at small T-antigen gene fragment nucleic acid sequences with more conservative bat adenovirus Advcxc6 and corresponding RNA base-containing rProbe probes which can be digested by RNaseH; wherein, the two ends of the rProbe are respectively designed with a fluorescent group and a quenching group, after RNA base is cut by RNaseH to be dissociated, the bat adenovirus can be rapidly detected by utilizing the activity of DNA polymerase and efficient primer and probe of isothermal amplification, and the method has the advantages of high sensitivity and stability and strong specificity and has strong practical application value.

Description

Kit for rapidly detecting bat adenovirus and detection method thereof

Technical Field

The invention relates to a kit for rapidly detecting bat adenovirus and a detection method thereof, belonging to the technical field of molecular biology.

Background

In recent years, bats are proved to be storage hosts of various important zoonosis viruses, and due to the characteristics of complicated feeding property, long flight distance, close relationship with people and livestock and the like, the bats often bring great threat to the health of human beings. The study of scholars in China reveals that about 20% of bat species in China carry adenoviruses, and bat adenoviruses show remarkable genetic diversity due to the difference of bat species and regional distribution. Therefore, a method for rapidly detecting the bat carried adenovirus is established, and has important significance for prediction and early warning of the epidemic situation of the adenovirus.

Isothermal nucleic acid amplification method, also known as isothermal nucleic acid amplification method, is a nucleic acid amplification method that has been rapidly developed since the 21 st century. The isothermal amplification technology can basically realize the detection of target nucleic acid within 1 hour, and some can even realize the detection within 20 min. Currently, the determination methods of isothermal amplification results can be basically divided into three categories: firstly, running agarose gel electrophoresis and observing a gel picture; secondly, observing the turbidity or color change of the reaction tube before and after amplification by a visual method; and thirdly, introducing a fluorescent signal into the reaction solution, amplifying the reaction solution on a simple device capable of reading the fluorescent signal, and reading the change of the fluorescent signal. With the development of the technology, products of a third isothermal amplification result judgment mode are popularized and applied better and better in the market.

An enzyme digestion Probe Isothermal Amplification technology (EPIA) designs specific Isothermal Amplification primers and a rProbe Probe aiming at a target nucleic acid conserved region to be detected, wherein two ends of the rProbe are respectively designed with a fluorescent group and a quenching group. The method comprises the steps of amplifying a target nucleic acid sequence to be detected by using DNA polymerase activity, combining an rProbe with the corresponding target nucleic acid sequence to be detected to form a probe-target nucleic acid hybrid double chain, cutting RNA base in the probe-target nucleic acid hybrid double chain through RNaseH, enabling the RNA base and a probe fragment containing a quenching group on the right side of the RNA base to be free, enabling the fragment containing a fluorescent group on the left side of the RNA base to still form a hybrid chain and be used as a primer to continue to extend, and enabling the fluorescent group to emit fluorescence. The presence or absence of the target nucleic acid is indicated by the presence or absence of an amplification signal.

The existing preventive medicine and clinic batus adenovirus detection technology has the requirements of simplicity, convenience, rapidness, high sensitivity and good specificity, and the prior art has limitations, so that a rapid, accurate and low-cost batus adenovirus detection technology is urgently needed to be developed.

Disclosure of Invention

In order to solve the technical problems, the invention discloses a kit for rapidly detecting bat adenovirus and a detection method thereof, wherein a probe (RNHP) containing an RNA base and a high-temperature resistant RNaseH are introduced on the basis of isothermal amplification, a specific isothermal amplification primer and an rProbe probe are designed aiming at a nucleic acid conserved region of adenovirus, the high-temperature resistant RNaseH is combined, the characteristic that RNaseH can cut the phosphodiester bond of RNA in a DNA and RNA hybrid chain is utilized, when a sample to be detected contains target nucleic acid, a large amount of target DNA/cDNA is amplified through isothermal amplification, the rProbe can be combined with the target DNA/cDNA to form a probe-target nucleic acid hybrid double chain, the RNA base in the probe-target nucleic acid hybrid double chain is cut through the RNaseH, so that the RNA base and a probe segment containing a quenching group on the right side are dissociated, and a segment containing a fluorescent group on the left side of the RNA base still forms a hybrid chain and can be used as a primer to continue extension, and the fluorescent group emits fluorescence at the same time, thereby determining the presence of the target nucleic acid.

The kit of the invention is an enzyme digestion isothermal amplification detection kit for detecting bat adenovirus small T-antigen gene, a primer probe for detecting bat adenovirus nucleic acid is matched with a primer probe for detecting internal reference to form a double real-time loop-mediated isothermal amplification process, which comprises nucleic acid reaction liquid, detection enzyme liquid, a positive quality control product and a negative reference product,

the nucleic acid reaction solution comprises a specific enzyme digestion isothermal amplification primer, a ribonuclease RNaseH and a fluorescent probe RNHP, wherein the ribonuclease RNaseH is a heat-resistant ribonuclease RNaseH, the fluorescent probe RNHP comprises an RNA base, and bases at two ends of the fluorescent probe RNHP are respectively marked with a fluorescent group and a quenching group,

the detection enzyme solution comprises Bst nucleic acid polymerase and AMV reverse transcriptase,

the positive quality control substance is a standard plasmid of an exogenous internal reference gene segment and adenovirus pseudovirus cRNA, and the negative control substance is RNA/DNA-free water.

Furthermore, the loop-mediated isothermal amplification primers are provided with six primers, and the sequences of the primers are respectively shown as SEQ ID NO: 6. SEQ ID NO: 7. SEQ ID NO: 8. SEQ ID NO: 9. SEQ ID NO: 10 and SEQ ID NO: 11, the sequence of the used fluorescent probe RNHP is shown as SEQ ID NO: 35.

further, the kit also comprises an internal reference substance, wherein the internal reference substance is a human ACTB gene, six loop-mediated isothermal amplification primers are used, and the sequences are respectively shown as SEQ ID NO: 36. SEQ ID NO: 37. SEQ ID NO: 38. SEQ ID NO: 39. SEQ ID NO: 40. SEQ ID NO: 41, the sequence of the used fluorescent probe RNHP is shown as SEQ ID NO: 42.

further, the length of the fluorescent probe RNHP is 19bp, and the sequence is shown as SEQ ID NO: 35 and the sequence is shown in SEQ ID NO: 42 is respectively marked by different fluorescence, and the specific isothermal amplification primer segment is 18-39 bp; the length of the screened exogenous internal reference control product is 20-37 bp.

Further, the fluorescent group is FAM and ROX.

The invention also comprises a method for rapidly detecting the bat adenovirus by using the kit, which comprises the following steps:

step 1: preparation of positive quality control product

Construction of pseudoviral plasmids: adding enzyme cutting sites in a target gene amplification sequence, connecting and inserting the target small fragment into a modified carrier PET42a-MS2 with a pseudovirus induction function through T4 enzyme, and then carrying out sequencing identification without errors, and preserving bacteria for later use;

preparing pseudoviruses: adding 50 mu l of the bacterial liquid with the target fragment into 5ml of LB liquid culture medium, and performing shake culture at 37 ℃ and 200-; then adding IPTG (isopropyl thiogalactoside) into the mixture to enable the final concentration of the mixture to be 1mM, and then placing the mixture at 37 ℃ and incubating the mixture for 3-4 h at the rotating speed of 200 rpm; after incubation, cells were harvested, 0.5ml of sonication buffer was added, sonicated on ice: stopping the reaction for 5s at 350W, performing ultrasonic treatment for 5s, performing 30 cycles, centrifuging at 6000rpm for 10min, collecting supernatant to obtain pseudovirus solution, and extracting RNA (ribonucleic acid) to obtain a positive quality control product;

finally, preparing a nucleic acid reaction solution, a detection enzyme solution, a negative reference substance and an internal reference substance, wherein the nucleic acid reaction solution comprises a primer, a probe, RNaseH, betaine, dNTP, MgSO4 and buffer; the detection enzyme solution comprises Bst polymerase and AMV reverse transcriptase; the positive quality control product is the pseudovirus prepared above, and the internal reference product is human ACTB gene; the negative control is water without RNA/DNA;

step 2: primer probe screening

Selecting small T-antigen as a gene target sequence, locating at 1829-2307bp of the bat adenovirus Advcxc6 genome sequence, wherein the size of the target sequence is 479bp, designing a specific primer and a fluorescent probe RNHP, and a group of human ACTB genes are arranged in the system as an exogenous reference to avoid false negative;

and step 3: double real-time isothermal amplification system

The double real-time isothermal amplification reaction system of the primers and the probes used by the adenovirus pseudovirus and the internal reference is 30 mu L, and the reaction program is as follows: amplifying at 63 ℃ for 1min for 30 cycles, and collecting a fluorescent group FAM and a quenching group ROX;

and 4, step 4: determination of results

Positive target: the Ct of the FAM channel is less than or equal to 28, the ROX channel does not need to be referred,

negative in target: FAM channel Ct >28, and ROX channel <30,

and (3) detection invalidation: FAM channel Ct >28 or no amplification information, and ROX channel no amplification signal; in this case, the sample is re-extracted and retested.

Has the advantages that: the invention realizes real-time isothermal rapid detection of bat adenovirus nucleic acid, completes detection within 25-30min, has the method sensitivity and other indexes not lower than rRT-PCR, and provides an effective solution for tracing the adenovirus epidemic situation and detecting the positive rate of bat adenovirus carried. On the basis of the enzyme digestion isothermal amplification technology, primers and probes are designed corresponding to different regions respectively, the adenovirus nucleic acid is detected, the sensitivity is high, the specificity is strong, the practical application value is very strong, and the method is suitable for being used in basic medical health units. Under the condition that the target nucleic acid exists, the linear probe labeling group is simple and is easier to combine with the target nucleic acid, so that the sensitivity is improved; compared with a single isothermal amplification mode: the method can be added with the detection of internal parameters, so that the detection result is more effective and reliable, and the result judgment mode is more objective. The whole process is operated in a closed tube mode, so that amplification pollution is avoided; the time is fast, the detection of the pathogen RNA is finished within 1 hour, and a detection report can be obtained within 30min as soon as possible; and (3) real-time amplification: contains an enzyme-cutting probe, and can observe the amplification condition in real time.

Drawings

FIG. 1 is a schematic diagram of the detection principle of the method of the present invention,

FIG. 2 is a graph showing the results of the kit of the present invention for detecting 10Copies/mL of a sample 20 times,

FIG. 3 is a diagram showing the result of multi-well-validated amplification of other negative human genomic nucleic acids by the kit of the present invention,

FIG. 4 is a graph showing the results of blank control in the test using the kit according to the example of the present invention,

FIG. 5 is a graph showing the results of the test of the kit on positive quality control substances in the example of the present invention,

FIG. 6 is a graph showing the results of 1 bat adenovirus clinical sample detected by the kit in the embodiment of the present invention,

reference numerals: 1-isothermal amplification primer, 2-probe containing RNA base, 3-RNaseH, 4-probe fragment with fluorescent group after enzyme digestion, and 5-free quenching group after enzyme digestion.

Detailed Description

The present invention is further illustrated by the following figures and specific examples, which are to be understood as illustrative only and not as limiting the scope of the invention, which is to be given the full breadth of the appended claims and any and all equivalent modifications thereof which may occur to those skilled in the art upon reading the present specification.

Unless otherwise specified, all methods are conventional in the art. In the following examples, the reagents and materials used, unless otherwise specified, were purchased from biochemicals companies in the field. Isothermal amplification buffer, MgSO4, BstDNA polymerase and AMV enzyme were purchased from New England Biolabs, N.Y., and dNTPs were purchased from Bao bioengineering, Inc., and primers and probes were synthesized by Shanghai Bioengineering services, Inc. The plasmid mini-extraction kit and the virus RNA extraction kit are purchased from Beijing Tiangen Biotechnology GmbH.

As shown in figure 1, 1 is an isothermal amplification primer, 2 is a probe containing RNA base, 3 is RNaseH, 4 is a probe fragment with a fluorescent group after enzyme digestion, 5 is a free quenching group after enzyme digestion, and R is the RNA base in the probe. The method comprises the steps of amplifying a target nucleic acid sequence to be detected by using the activity of DNA polymerase, simultaneously combining a probe with the corresponding target sequence to be detected to form a probe-target nucleic acid hybrid double chain, cutting RNA base in the probe-target nucleic acid hybrid double chain by RNaseH, dissociating the RNA base and a probe fragment containing a quenching group on the right side of the RNA base, still keeping the fragment containing the fluorescent group on the left side of the RNA base to form a hybrid chain and serving as a primer to continue to extend, and simultaneously enabling the fluorescent group to emit fluorescence. The presence or absence of the target nucleic acid is indicated by determining the presence or absence of an amplified signal. The detection steps are as follows:

step 1: preparation of positive quality control product

Construction of pseudoviral plasmids: adding enzyme cutting sites in a target gene amplification sequence, connecting and inserting the target small fragment into a modified carrier PET42a-MS2 with a pseudovirus induction function through T4 enzyme, and then carrying out sequencing identification without errors, and preserving bacteria for later use;

preparing pseudoviruses: adding 50 mu l of the bacterial liquid with the target fragment into 5ml of LB liquid culture medium, and performing shake culture at 37 ℃ and 200-; then adding IPTG (isopropyl thiogalactoside) into the mixture to enable the final concentration of the mixture to be 1mM, and then placing the mixture at 37 ℃ and incubating the mixture for 3-4 h at the rotating speed of 200 rpm; after incubation, cells were harvested, 0.5ml of sonication buffer was added, sonicated on ice: stopping the reaction for 5s at 350W, performing ultrasonic treatment for 5s, performing 30 cycles, centrifuging at 6000rpm for 10min, collecting supernatant to obtain pseudovirus solution, and extracting RNA (ribonucleic acid) to obtain a positive quality control product;

finally, preparing a nucleic acid reaction solution, a detection enzyme solution, a negative reference substance and an internal reference substance, wherein the nucleic acid reaction solution comprises a primer, a probe, RNaseH, betaine, dNTP, MgSO4 and buffer; the detection enzyme solution comprises Bst polymerase and AMV reverse transcriptase; the positive quality control product is the pseudovirus prepared above, and the internal reference product is human ACTB gene; the negative control is water without RNA/DNA;

step 2: primer probe screening

Selecting small T-antigen as a gene target sequence, locating at 1829-2307bp of the Advcxc6 genome sequence of the bat adenovirus, wherein the size of the target sequence is 479bp, the target sequence has the characteristic of highly conservative interspecies specificity in species, and a specific primer and a fluorescent probe RNHP are designed, wherein a group of human ACTB genes are arranged in the system as an exogenous reference to avoid false negative; target gene synthesis and sequencing were sent to Shanghai Biotechnology corporation for synthesis and sequencing.

Primer design and screening

A total of 5 sets of primers were designed for the target region, as shown in Table 1

TABLE 1 target sequence LAMP Primary screening primer sequence

And (3) verifying sensitivity and specificity: the second set of primers met the performance requirements.

Probe design and screening

2 probes were designed for the 2 nd primer set in total, as shown in Table 2

TABLE 2 target primer Probe sequences

Primer sequence number	Primer name	Primer sequences
			SEQ ID NO：34	Adv-LF-P	CGGACTCAGCACCTCGT
SEQ ID NO：35	Adv-LB-P	ATTGAGCGGGGTGGCTCCA

And (3) verifying sensitivity and specificity: the Adv-LB-P accords with the performance requirements of sensitivity and specificity.

Screening of exogenous internal reference primers and probes

3 kinds of exogenous internal references existing in a laboratory are used as system internal references to carry out optimization screening. Wherein the exogenous internal references 1 and 2 and the target are mutually inhibited and cannot be used as the system internal reference, the internal reference 3 is selected as the system internal reference, the primers and the probes are shown in table 3, and finally the internal reference in a double detection system is constructed by selecting six primers and one probe, wherein the RNA concentration of the extracted internal reference pseudovirus is 5000 copies/mL.

TABLE 3 exogenous internal reference primer and Probe sequences

Primer sequence number	Primer name	Primer sequences
			SEQ ID NO：36	ACTB/F3	GTGGCACCACCATGTACC
SEQ ID NO：37	ACTB/B3	TCCACATCTGCTGGAAGGT
			SEQ ID NO：38	ACTB/FIP	TCTTCATCGTGCTGGGCGCAGGCATCGCCGACAGG
SEQ ID NO：39	ACTB/BIP	TCAAGATCATCGCGCCTCCAGAGCGAGGCCAGGATGG
			SEQ ID NO：40	ACTB/LF	GCCGTGATCTCCTTCTGCAT
SEQ ID NO：41	ACTB/LB	CGCAAGTACTCCGTGTGGAT
			SEQ ID NO：42	ACTB/LF-p	GCCGTGATCTCCTTCTGCAT

And step 3: double real-time isothermal amplification system

The double detection system of single target and internal reference is established, the double real-time isothermal amplification reaction system of adenovirus pseudovirus and primers and probes used by the internal reference is 30 mu L, the components and the final concentration of the nucleic acid reaction solution are shown in Table 4, and the reaction program is as follows: amplifying at 63 ℃ for 1min for 30 cycles, and collecting a fluorescent group FAM and a quenching group ROX;

TABLE 4 Dual reaction liquid system table for specific detection of bat adenovirus

The sensitivity of the duplex system for detecting the target is 10 copies/uL.

As shown in table 5, the model to be used is the model of the macro stone SLAN 96, and the default threshold line is not used for the detection on the macro stone instrument, but should be set to 0.36 when the reaction program is set.

TABLE 5 reaction procedure for the detection system

Number of cycles	Reaction conditions	Whether or not to collect fluorescence
			30cycles	63℃,1min	Is (FAM, ROX)

And 4, step 4: determination of results

Positive target: the Ct of the FAM channel is less than or equal to 28, the ROX channel does not need to be referred,

negative in target: FAM channel Ct >28, and ROX channel <30,

and (3) detection invalidation: FAM channel Ct >28 or no amplification information, and ROX channel no amplification signal; in this case, the sample is re-extracted and retested.

Performance validation data for detection architecture

And (3) sensitivity verification: the amplification of the multiple wells at 10copies/uL, as shown in FIG. 2, was stable at the lowest detection limit.

And (3) specificity verification:

the system detects the multi-hole verification of negative human genome DNA, and the amplification is shown in figure 3: the target channel was not non-specifically amplified.

The system detects the multi-well verification of the blank, and the amplification is shown in figure 4: the target channel was not non-specifically amplified.

And (3) positive quality control product verification:

amplification of RNA extracted from positive quality control for 20 duplicate wells is shown in fig. 5.

And (3) clinical sample verification:

1 bat adenovirus clinical sample (B2) was verified and the results showed normal expansion. The results of the verification are shown in the following table, and the amplification graph is shown in FIG. 6:

it will be evident to those skilled in the art that the invention is not limited to the details of the foregoing illustrative embodiments, and that the present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof. The present embodiments are therefore to be considered in all respects as illustrative and not restrictive, the scope of the invention being indicated by the appended claims rather than by the foregoing description, and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein. Any reference sign in a claim should not be construed as limiting the claim concerned.

Furthermore, it should be understood that although the present description refers to embodiments, not every embodiment may contain only a single embodiment, and such description is for clarity only, and those skilled in the art should integrate the description, and the embodiments may be combined as appropriate to form other embodiments understood by those skilled in the art.

Sequence listing

<110> prevention and control center for east war zone disease of people liberation army in China

<120> kit for rapidly detecting bat adenovirus and detection method thereof

<160> 42

<170> SIPOSequenceListing 1.0

<210> 1

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 1

gagagggagg acacggag 18

<210> 2

<211> 16

<212> DNA

<213> Artificial Sequence

<400> 2

ggggtcggac tcagca 16

<210> 3

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 3

ggcatctcct cctcttcccc ctgcatctag cggagccagc 40

<210> 4

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 4

tgggagagga ggaattggag gacctcgttc tcggcagcaa 40

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 5

agtggagaca gaggaggaca 20

<210> 6

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 6

ggaggacagc gagttgga 18

<210> 7

<211> 17

<212> DNA

<213> Artificial Sequence

<400> 7

gaggcacgac cctctct 17

<210> 8

<211> 39

<212> DNA

<213> Artificial Sequence

<400> 8

cctgcctcaa caggtccgga gtagtttttg ctgccgaga 39

<210> 9

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 9

ctgagcagca gcagcgagga gaacaagagc tgtccgaaga 40

<210> 10

<211> 17

<212> DNA

<213> Artificial Sequence

<400> 10

cggactcagc acctcgt 17

<210> 11

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 11

attgagcggg gtggctcca 19

<210> 12

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 12

cgagaacgag gtgctgagt 19

<210> 13

<211> 17

<212> DNA

<213> Artificial Sequence

<400> 13

gcgggagcgt gaacgat 17

<210> 14

<211> 42

<212> DNA

<213> Artificial Sequence

<400> 14

caccccgctc aatgggctga aattgaggca ggctgcagtt tc 42

<210> 15

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 15

cggacagctc ttgttcagag cccacgctga ctcggatggc 40

<210> 16

<211> 17

<212> DNA

<213> Artificial Sequence

<400> 16

tcctcgctgc tgctgct 17

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 17

agaagagagg gtcgtgcctc c 21

<210> 18

<211> 17

<212> DNA

<213> Artificial Sequence

<400> 18

tgctcctcgc tgctgct 17

<210> 19

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 19

agaagaagaa gagagggtcg tg 22

<210> 20

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 20

tccatggtgg gggagacc 18

<210> 21

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 21

gcacctcgtt ctcggcag 18

<210> 22

<211> 39

<212> DNA

<213> Artificial Sequence

<400> 22

ttccccctcg ctctccgtct gaggaagggg agttgcatc 39

<210> 23

<211> 38

<212> DNA

<213> Artificial Sequence

<400> 23

cctggaggag agcgagagcg cgctgtcctc ctctgtct 38

<210> 24

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 24

cctgaatcac tgctggctcc 20

<210> 25

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 25

ggagagcatg ggagaggagg aat 23

<210> 26

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 26

cctgaatcac tgctggctcc 20

<210> 27

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 27

agaggaggaa ttggaggaag tgg 23

<210> 28

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 28

ggaggaattg gaggaagtgg 20

<210> 29

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 29

cgaagaggcc agtggagc 18

<210> 30

<211> 39

<212> DNA

<213> Artificial Sequence

<400> 30

ggtcggactc agcacctcgt gaggaggaca gcgagttgg 39

<210> 31

<211> 39

<212> DNA

<213> Artificial Sequence

<400> 31

ccggacctgt tgaggcaggg ctcaatgggc tgaaacact 39

<210> 32

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 32

ctgcagtttc tggcctgagc a 21

<210> 33

<211> 17

<212> DNA

<213> Artificial Sequence

<400> 33

ctgagcagca gcagcga 17

<210> 34

<211> 17

<212> DNA

<213> Artificial Sequence

<400> 34

cggactcagc acctcgt 17

<210> 35

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 35

attgagcggg gtggctcca 19

<210> 36

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 36

gtggcaccac catgtacc 18

<210> 37

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 37

tccacatctg ctggaaggt 19

<210> 38

<211> 35

<212> DNA

<213> Artificial Sequence

<400> 38

tcttcatcgt gctgggcgca ggcatcgccg acagg 35

<210> 39

<211> 37

<212> DNA

<213> Artificial Sequence

<400> 39

tcaagatcat cgcgcctcca gagcgaggcc aggatgg 37

<210> 40

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 40

gccgtgatct ccttctgcat 20

<210> 41

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 41

cgcaagtact ccgtgtggat 20

<210> 42

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 42

gccgtgatct ccttctgcat 20

Claims (6)

1. A kit for rapidly detecting bat adenovirus is characterized in that the kit is an enzyme digestion isothermal amplification detection kit for detecting bat adenovirus small T-antigen gene, a primer probe for detecting bat adenovirus nucleic acid is matched with a primer probe for detecting internal reference to form a double real-time loop-mediated isothermal amplification process, and the double real-time loop-mediated isothermal amplification process comprises a nucleic acid reaction solution, a detection enzyme solution, a positive quality control product and a negative control product,

the nucleic acid reaction solution comprises a specific enzyme digestion isothermal amplification primer, a ribonuclease RNaseH and a fluorescent probe RNHP, wherein the ribonuclease RNaseH is a heat-resistant ribonuclease RNaseH, the fluorescent probe RNHP comprises an RNA base, and bases at two ends of the fluorescent probe RNHP are respectively marked with a fluorescent group and a quenching group,

the detection enzyme solution comprises Bst nucleic acid polymerase and AMV reverse transcriptase,

the positive quality control substance is a standard plasmid of an exogenous internal reference gene segment and adenovirus pseudovirus cRNA, and the negative control substance is RNA/DNA-free water.

2. The kit for rapidly detecting bat adenovirus according to claim 1, wherein the loop-mediated isothermal amplification primer is provided with six primers, the sequences of which are respectively shown in SEQ ID NO: 6. SEQ ID NO: 7. SEQ ID NO: 8. SEQ ID NO: 9. SEQ ID NO: 10 and SEQ ID NO: 11, the sequence of the used fluorescent probe RNHP is shown as SEQ ID NO: 35.

3. the kit for rapidly detecting bat adenovirus of claim 1, further comprising an internal reference, wherein the internal reference is human ACTB gene, the loop-mediated isothermal amplification primers used are provided with six, and the sequences are respectively shown in SEQ ID NO: 36. SEQ ID NO: 37. SEQ ID NO: 38. SEQ ID NO: 39. SEQ ID NO: 40. SEQ ID NO: 41, the sequence of the used fluorescent probe RNHP is shown as SEQ ID NO: 42.

4. the kit for rapidly detecting bat adenovirus according to claim 2 or 3, wherein the length of the fluorescent probe RNHP is 19bp, and the sequence is as shown in SEQ ID NO: 35 and the sequence is shown in SEQ ID NO: 42 is respectively marked by different fluorescence, and the specific isothermal amplification primer segment is 18-39 bp; the length of the screened exogenous internal reference control product is 20-37 bp.

5. The kit for rapidly detecting bat adenovirus according to claim 1, wherein the fluorescent group is FAM and ROX.

6. A method for rapidly detecting bat adenovirus based on the kit of any one of the preceding claims, which is characterized by comprising the following steps:

step 1: preparation of positive quality control product

Construction of pseudoviral plasmids: adding enzyme cutting sites in a target gene amplification sequence, connecting and inserting the target small fragment into a modified carrier PET42a-MS2 with a pseudovirus induction function through T4 enzyme, and then carrying out sequencing identification without errors, and preserving bacteria for later use;

preparing pseudoviruses: adding 50 mu l of the bacterial liquid with the target fragment into 5ml of LB liquid culture medium, and performing shake culture at 37 ℃ and 200-; then adding IPTG (isopropyl thiogalactoside) into the mixture to enable the final concentration of the mixture to be 1mM, and then placing the mixture at 37 ℃ and incubating the mixture for 3-4 h at the rotating speed of 200 rpm; after incubation, cells were harvested, 0.5ml of sonication buffer was added, sonicated on ice: stopping the reaction for 5s at 350W, performing ultrasonic treatment for 5s, performing 30 cycles, centrifuging at 6000rpm for 10min, collecting supernatant to obtain pseudovirus solution, and extracting RNA (ribonucleic acid) to obtain a positive quality control product;

finally, preparing a nucleic acid reaction solution, a detection enzyme solution, a negative reference substance and an internal reference substance, wherein the nucleic acid reaction solution comprises a primer, a probe, RNaseH, betaine, dNTP, MgSO4 and buffer; the detection enzyme solution comprises Bst polymerase and AMV reverse transcriptase; the positive quality control product is the pseudovirus prepared above, and the internal reference product is human ACTB gene; the negative control is water without RNA/DNA;

step 2: primer probe screening

Selecting small T-antigen as a gene target sequence, locating at 1829-2307bp of the bat adenovirus Advcxc6 genome sequence, wherein the size of the target sequence is 479bp, designing a specific primer and a fluorescent probe RNHP, and a group of human ACTB genes are arranged in the system as an exogenous reference to avoid false negative;

and step 3: double real-time isothermal amplification system

The double real-time isothermal amplification reaction system of the primers and the probes used by the adenovirus pseudovirus and the internal reference is 30 mu L, and the reaction program is as follows: amplifying at 63 ℃ for 1min for 30 cycles, and collecting a fluorescent group FAM and a quenching group ROX;

and 4, step 4: determination of results

Positive target: the Ct of the FAM channel is less than or equal to 28, the ROX channel does not need to be referred,

negative in target: FAM channel Ct >28, and ROX channel <30,

and (3) detection invalidation: FAM channel Ct >28 or no amplification information, and ROX channel no amplification signal; in this case, the sample is re-extracted and retested.

Images