CN113913516B - Application of hsa_circ_0006470 serving as target spot in preparation of miR-27b-3p regulator - Google Patents
Application of hsa_circ_0006470 serving as target spot in preparation of miR-27b-3p regulator Download PDFInfo
- Publication number
- CN113913516B CN113913516B CN202110581631.7A CN202110581631A CN113913516B CN 113913516 B CN113913516 B CN 113913516B CN 202110581631 A CN202110581631 A CN 202110581631A CN 113913516 B CN113913516 B CN 113913516B
- Authority
- CN
- China
- Prior art keywords
- circ
- hsa
- mir
- pik3ca
- group
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Pharmacology & Pharmacy (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Pathology (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- General Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention provides application of hsa_circ_0006470 serving as a target spot in preparation of a miR-27b-3p regulator and other applications. The inventor finds that the miR-27b-3p interacts with hsa_circ_0006470 through a double-luciferase report experiment, and finds that silencing hsa_circ_0006470 can improve the expression of miR-27b-3p, further can influence a downstream pathway of miR-27b-3p such as ROR1 so as to inhibit proliferation and migration capacity of gastric cancer cells, and can inhibit the expression of PIK3CA so as to promote autophagy through RNAi experiments; phenotype due to silencing hsa_circ_0006470 can be alleviated by over-expression of PIK3CA in cancer cells that silence hsa_circ_0006470. The results show that hsa_circ_0006470 has close relation with miR-27b-3p, PIK3CA, proliferation and migration of gastric cancer cells, autophagy of cells and the like, so that the application of hsa_circ_0006470 serving as a target spot in preparation of a regulator of miR-27b-3p, a regulator of PIK3CA, autophagy and autophagy related diseases, a cancer therapeutic drug and the application of hsa_circ_0006470 serving as a molecular marker in preparation of a diagnostic reagent of cancer has great potential value.
Description
Technical Field
The invention relates to the field of biological medicine, in particular to an application of hsa_circ_0006470 serving as a target point in preparation of a miR-27b-3p regulator, an application of hsa_circ_0006470 serving as a target point in preparation of a PIK3CA regulator and an application of hsa_circ_0006470 serving as a target point in preparation of autophagy-related diseases. Use of hsa_circ_0006470 as a target in the preparation of a medicament for the treatment of cancer. Use of hsa_circ_0006470 as a biomarker for the preparation of a diagnostic reagent for cancer.
Background
Autophagy is a lysosome-mediated degradation and energy circulation pathway of intracellular substances, and autophagy can encapsulate macromolecules such as redundant or wrong proteins in cells, and then form autophagy lysosomes with the lysosomes so as to degrade the encapsulated macromolecular substances. Autophagy is an evolutionarily protected cellular process that is involved in many processes of cell growth and development, and abnormalities in autophagy can lead to abnormalities in various vital activities of the cell.
Non-coding RNA circRNAs (Circular RNA molecules) are a class of non-coding RNA molecules that do not have a 5 'terminal cap and a 3' terminal poly (A) tail and form a Circular structure by covalent bonds. The circRNA is formed by reverse splicing by a non-classical splicing method. The circRNAs are considered to be closely related to a variety of life processes, with great potential value as targeting sites.
Gastric Cancer (GC) is one of the major malignant diseases in humans, and has a high mortality rate due to the lack of advanced diagnosis and effective treatment. Among the global cancer-related deaths, the number of deaths caused by gastric cancer is the fifth, and the average five-year survival rate of gastric cancer patients is less than 20%, and more than 70 ten thousand deaths are caused by gastric cancer each year. Gastric cancer is mainly due to dangerous factors such as helicobacter pylori infection, epstein-Barr (EBV) infection, smoking, and the like. Surgical resection and chemotherapy have been the primary treatment modalities for gastric cancer patients in the last decade. Genetic mutations and abnormalities in various signaling pathways are thought to promote the occurrence of gastric cancer, such as the Hedgehog signaling pathway, notch signaling pathway, and NF-KB signaling pathway. Targeting therapy is considered as an alternative therapy to gastric cancer therapy with the highest development prospect, but its clinical application also faces a number of difficulties, and current researchers have not yet fully elucidated the pathogenesis of gastric cancer, and many unknown targeting sites and signaling pathways are urgently explored.
Disclosure of Invention
The first aspect of the invention provides the use of hsa_circ_0006470 as a target in the preparation of a modulator of miR-27b-3 p.
The inventor finds that the miR-27b-3p interacts with hsa_circ_0006470 through a double-luciferase report experiment, and finds that silencing hsa_circ_0006470 can improve the expression of miR-27b-3p, further can influence a downstream pathway of miR-27b-3p such as ROR1 so as to inhibit proliferation and migration capacity of gastric cancer cells, and can inhibit the expression of PIK3CA so as to promote autophagy through RNAi experiments; phenotype due to silencing hsa_circ_0006470 can be alleviated by over-expression of PIK3CA in cancer cells that silence hsa_circ_0006470. The results show that hsa_circ_0006470 has close relation with miR-27b-3p, PIK3CA, proliferation and migration of gastric cancer cells, autophagy of cells and the like, so that the application of hsa_circ_0006470 serving as a target point in preparation of a miR-27b-3p regulator has great potential value.
Further, the expression of hsa_circ_0006470 was down-regulated using inhibitors of hsa_circ_0006470. Inhibitors of hsa_circ_0006470 may be compounds, proteins, polypeptides and the like.
Further, expression of hsa_circ_0006470 was down-regulated using genetic engineering methods. Further, genetic engineering methods include gene editing and epigenetic modification. Further, the epigenetic modification comprises RNAi.
The second part of the invention provides the use of hsa_circ_0006470 as a target in the preparation of modulators of PIK3 CA. Experimental data indicate that hsa_circ_0006470 has a close relationship with PIK3CA, and silencing hsa_circ_0006470 can significantly reduce the level of PIK3CA, so that hsa_circ_0006470 can be used as a target for preparing a regulator and applied to regulation of PIK3 CA.
The third part of the invention provides the application of hsa_circ_0006470 serving as a target spot in preparing the medicine for autophagy-related diseases. Experimental data show that hsa_circ_0006470 has close relation with autophagy and autophagy related diseases, and hsa_circ_0006470 can regulate the phenotype of autophagy and autophagy related diseases through the PIK3CA pathway, so that the hsa_circ_0006470 can be used as a target for preparing a regulator and applied to the treatment of autophagy and autophagy related diseases.
The fourth part of the invention provides the application of hsa_circ_0006470 serving as a target in preparing a cancer therapeutic drug. Experimental data indicate that hsa_circ_0006470 is closely related to proliferation and migration of cancer cells, and silencing hsa_circ_0006470 can promote proliferation and migration of cancer cells, so that activation of hsa_circ_0006470 can also be expected to inhibit proliferation and migration of cancer cells, and thus hsa_circ_0006470 can be used as a target for preparing a medicament for cancer treatment. Further, the cancer may be gastric cancer.
The fifth aspect of the invention provides the use of hsa_circ_0006470 as a biomarker in the manufacture of a diagnostic reagent for cancer. Experimental data indicate that hsa_circ_0006470 is closely related to proliferation and migration of cancer cells, and thus it can be expected that it can be applied as a biomarker to the preparation of diagnostic reagents for cancer.
Drawings
FIG. 1 is experimental data for a dual luciferase reporter assay.
FIG. 2 is experimental data of RT-PCR experiments with hsa_circ_0006470 and miR-27b-3p of the silencing group and control group 48h after transfection.
FIG. 3 is experimental data of RT-PCR experiments with ROR1 of the silencing group and the control group 48h after transfection.
FIG. 4 is experimental data of cell proliferation rates of the silencing group and the control group 48h after transfection.
Fig. 5 is experimental data for apoptosis in the silencing group and the control group 48h post-transfection.
Fig. 6 is experimental data of tumor cell migration capacity of the silencing group and the control group 48h after transfection.
FIG. 7 is experimental data showing the detection of autophagy-related gene expression in the silencing group and the control group 48h after transfection by Western blot.
FIG. 8 is experimental data showing the detection of PIK3CA expression in the silence group and the control group 48h after transfection by immunofluorescence assay.
FIG. 9 is experimental data for autophagy in the silence group and the control group 48h after transfection under electron microscopy.
FIG. 10 is experimental data of hsa_circ_0006470, PIK3CA and miR-27b-3p expression levels of the silencing group, PIK3CA over-expression group and control group, detected 48h after transfection by RT-PCR assay.
FIG. 11 is experimental data showing the expression levels of PIK3CA in the silencing group, PIK3CA overexpressing group and control group at 48h after transfection detected by immunofluorescence assay.
FIG. 12 is experimental data showing the detection of autophagy-related gene expression in the silent group and the control group by Western blot.
FIG. 13 is experimental data showing autophagy in the 48h post-electron transfection silencing group, PIK3CA overexpressing group and control group.
FIG. 14 is experimental data for cell proliferation rates of PIK3CA overexpressing, silencing and control groups 48h post-transfection.
Fig. 15 is experimental data for apoptosis in PIK3CA over-expression, silencing and control groups 48h post-transfection.
FIG. 16 is experimental data of tumor cell migration capacity of PIK3CA overexpressing, silencing and control groups 48h post-transfection.
Detailed Description
For a better description of the objects, technical solutions and advantageous effects of the present invention, the present invention will be further described with reference to specific examples. It should be noted that the following examples are given for further explanation of the present invention and should not be construed as limiting the present invention. The materials involved in this example are all commercially available.
The related experimental materials and experimental methods are as follows:
cell culture and transfection
Human gastric mucosal epithelial cell lines GES-1 and 4 GC cell lines AGS, HGC-27, hs 746.T and SNU-1 were purchased from Procell (Wuhan, china). Cells were incubated in DMEM medium (Thermo Fishier Scientific) supplemented with 10% bovine serum albumin (BSA; sigma Aldrich) and 50U/mL penicillin and streptomycin in a humidified environment of 5% CO2 at 37 ℃.
RT-PCR and quantitative RT-PCR
Total RNA samples from each group of cells were prepared using TRIzol Universal Total RNA extraction reagent (#DP424; tianGen Biotech, beijing, china) according to the manufacturer's instructions. The concentration of the RNA samples was determined by measurement on a NanoDrop micro-spectrophotometer and cDNA library synthesis was performed using FastQuant RT Super Mix (#KR108; tiangen Biotech, beijing, china) according to the manufacturer's protocol. Subsequently, a quantitative PCR method was performed using a Talent fluorescent quantitative detection kit (SYBR Green) (#FP209; tiangen Biotech, beijing, china) according to the procedure suggested by the manufacturer. Finally, the relative expression of the circRNA or microRNA is calculated by a 2-delta Ct method by taking U6 or GAPDH as an internal reference for normalization.
TABLE 1 RT primers for PCR experiments
| Gene ID | Sequence(5’-3’) |
| U6.F | CTCGCTTCGGCAGCACA |
| U6.R | AACGCTTCACGAATTTGCGT |
| GAPDH.F | TGTTCGTCATGGGTGTGAAC |
| GAPDH.R | ATGGCATGGACTGTGGTCAT |
| hsa_circ_0138960.F | TCCTTGCCGACATTACAGATA |
| hsa_circ_0138960.R | GTGGCAGGTCTATGCTACTTC |
| hsa_circ_0001895.F | CATCGTGATAGTACCCAAGGAC |
| hsa_circ_0001895.R | CTCCCGATCTGCCTCTTTG |
| hsa_circ_0006470.F | ACTCATCATGGACTCCCTGC |
| hsa_circ_0006470.R | TGAGCACCTCCTTAGCAGACA |
| hsa-miR-27b-3p.RT | CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCAGAACT |
| hsa-miR-27b-3p.F | ACACTCCAGCTGGGTTCACAGTGGCTAAGT |
| hsa-miR-27b-3p.R | CTCAACTGGTGTCGTGGA |
| hsa_circ_006470X.F | GGGACCGCATCTTCTTTGT |
| hsa_circ_006470X.R | GTGCTGCTCAAACTTGGTCTT |
F, forward primer and upstream primer; reverse primer, downstream primer; RT reverse transcription primer, reverse transcription primer.
Dual luciferase reporter detection
The hsa_circ_0006470 wild-type (WT) or Mutant (MUT) sequence and the 3' UTR sequence of PIK3CA were ligated with the pmirGLO dual luciferase miRNA target expression vector (#E1330; promega) as indicated by the manufacturer. In addition, miR-27b-3pmimics (5'-UUCACAGUGGCUAAGUUCUGC-3') and its negative control (NC; 5'-UUUGUACUACACAAAAGUACUG-3') sequences were synthesized by GenePharma Company (Shanghai, china). Lipofectamine 3000 reagent (Thermo Fishier Scientific) was used and following the manufacturer's instructions, as well as the indicated miR-27b-3p chemicals or NC sequences. Finally, luciferase activity in the cells was measured by photometer to assess the interaction between the circRNA and microRNA.
Cell proliferation and migration
Proliferation of GC cells was measured by the CCK-8 method using the cell count kit-8 (#CK 04; dojindo, japan) according to the manufacturer's instructions. AGS cells were collected by centrifugation at 800g for 5min and seeded in 96-well plates (4000 cells/well). After incubation for 24h,48h and 72h at 37℃under normal culture conditions, the cells were incubated with 10. Mu.l of CCK-8 reagent for a further 3h at 37℃and finally the absorbance at 450nm (OD 450) was measured on a microplate reader. Proliferation of GC cells was assessed by changes in OD450 values.
Migration of GC cells was analyzed using a Transwell system (Corning). Cells in serum-free DMEM were seeded in the upper chamber of a Transwell plate and cultured at 37 ℃ for 24 hours. Cells that migrated into the lower chamber of DMEM containing 10% fbs were then stained with 1% crystal violet and observed under a microscope.
Western blot
Total protein was extracted from the cultured GC cells using RIPA lysis and extraction buffer (# 89900;Thermo Fishier Scientific) according to the manufacturer's instructions. The protein concentration was detected by the Pierce BCA protein detection kit (# 23227;Thermo Fishier Scientific) according to the manufacturer's instructions. Subsequently, the proteins were boiled in protein loading buffer at 100℃for 5min, separated by SDS-PAGE and transferred onto PVDF membrane (Millipore). After blocking with 5% lipid-free milk solution for 2h at room temperature, the proteins on PVDF membrane were then incubated with diluted primary antibody overnight at 4 ℃, or 2h at room temperature, then secondary antibody was incubated 1-left at room temperature for 2h and final development was performed using Pierce ECL Plus Western Blotting substrate (# 32134;Thermo Fishier Scientific). Meanwhile, GAPDH protein is used as an internal reference. Antibodies for protein quantification include LC3B (# ab51520; abcam), p62 (# 88588; cst), beclin-1 (# ab210498; abcam), ROR1 (# ab91187; abcam), PIK3CA (# ab 40776); abcam) and anti-GAPDH (#ab 181602; abcam).
Transmission electron microscope
Autophagy progression in AGS cells was assessed by observing autophagosome formation with Transmission Electron Microscopy (TEM). GC cells were grown on slides, then washed twice with PBS solution, fixed in 2.5% glutaraldehyde solution (in PBS solution) for 1.5h at room temperature, then incubated with 1.2% tetraoxide solution for 20min at room temperature. Temperature. Finally, autophagosome formation in GC cells was observed under transmission electron microscopy.
Statistical analysis method
Quantitative data, expressed as mean ± standard deviation, were analyzed using SPSS 20.0 software for this study. Differences between two or more groups were assessed by Student T test or ANOVA method. A significant difference was considered to exist when the P value was < 0.05.
Example 1 demonstration of interaction of hsa_circ_0006470 with miR-27b-3p by double-luciferase reporting
First, the wild-type gene sequence of hsa_circ_0006470 (WT, synthetic primer hsa_circ_0006470.F: ACTCATCTACCTGC, hsa_circ_0006470.R: TGAGCACTCTCTTAGCAGCA) and the mutant gene sequence (MUT, synthetic primer hsa_circ_006470X. F: GGGACCGCATCTTTCTTTGT, hsa_circ_006470X. R: GTGCTGCTCAACTTGGTCTTT) were synthesized, and their 3' -UTR ends were ligated to the rear of the reporter gene Luciferase of the pmilGLO vector, respectively, to construct a Luciferase plasmid (pmirGLO-circ_ 006470 WT vectors or pmirGLO-circ_006470 MUT vectors). RNA sequences of miR-27b-3p chemicals (5'-UUCACAGUGGCUAAGUUCUGC-3') and control (NC: 5'-UUUGUACUACACAAAAGUACUG-3') were then synthesized by the company GenePharma Company. Double luciferase reporting experiments were performed using gastric cancer cells (AGS) and divided into four groups in table 2, and the experimental data are shown in fig. 1.
From the data of FIG. 1, it can be seen that the fluorescence intensity of experimental group 2 co-transfected with miR-27b-3p mimics+pmirGLO-circ_006470 WT vector was lower relative to that of experimental group 1 co-transfected with NC+pmirGLO-circ_006470 WT vector, whereas the fluorescence difference between experimental group 4 co-transfected with miR-27b-3p mimics+pmirGLO-circ_006470 MUT vector and experimental group 3 co-transfected with NC+pmirGLO-circ_006470 WT vector was smaller, which experimental data indicated that overexpression of miR-27b-3p could inhibit hsa_circ_0006470 expression, and that there was an interaction.
Table 2 group of dual luciferase reporter experiments
EXAMPLE 2hsa_circ_0006470 RNAi experiments
Synthesis of siRNAs from hsa_circ_0006470 AGS cells of the same origin, which are well-conditioned, were divided into two groups, one of which was transfected with siRNAs from hsa_circ_0006470 as silencing group (si-sirc-RNA) and the other was transfected using the same transfection protocol but without adding siRNAs as Control group (Control).
The expression levels of hsa_circ_0006470 and miR-27b-3p in the two groups are detected by RT-PCR experiments, and experimental data are shown in FIG. 2.
The expression level of the target gene ROR1 of miR-27b-3p in the two groups is detected by RT-PCR experiments, and experimental data are shown in figure 3.
From the data in FIGS. 2-3, the expression level of hsa_circ_0006470 in the silenced group of siRNAs transfected with hsa_circ_0006470 was significantly reduced relative to the control group, indicating that the silenced group successfully silences hsa_circ_0006470. The expression level of miR-27b-3p in the silencing group of siRNAs transfected with hsa_circ_0006470 is obviously improved relative to that of a control group, so that the expression level of miR-27b-3p can be improved by silencing hsa_circ_0006470, and the inhibition effect of hsa_circ_0006470 on miR-27b-3p is shown. The significantly reduced expression level of ROR1 in the silenced group of siRNAs transfected with hsa_circ_0006470 relative to the control group indicates that silencing of hsa_circ_0006470 gene affects the miR-27b-3p downstream gene.
Cell proliferation rates were measured in the silencing group and the control group 48h after transfection, and experimental data are shown in FIG. 4.
From the results of fig. 4, it can be seen that 48 hours after transfection, the proliferation rate of cells in the silent group was significantly reduced relative to the control group, indicating that decreasing hsa_circ_0006470 expression could inhibit AGS cell proliferation.
Apoptosis was detected in the silencing group and the control group 48h after transfection, and experimental data are shown in FIG. 5.
From the results of fig. 5, it can be seen that 48h after transfection, the apoptosis rate of the silent group was significantly increased relative to the control group, indicating that decreasing hsa_circ_0006470 expression could promote AGS apoptosis.
Tumor cell migration capacity of the silencing group and the control group 48h after transfection was examined, and experimental data are shown in FIG. 6.
From the data in fig. 6, the cell mobility of the silent group was significantly reduced relative to the control group at 48h post-transfection, indicating that decreasing hsa_circ_0006470 expression could inhibit AGS cell migration.
Expression of autophagy-related genes in the silencing group and the control group was detected by Western blot, and experimental data are shown in fig. 7.
Expression of PIK3CA in the silenced and control groups was detected by immunofluorescence experiments, and the experimental data are shown in fig. 8.
The autophagy in the silent and control groups was observed by electron microscopy and experimental data are shown in fig. 9.
As can be seen from the data in FIG. 7, 48h after transfection, the amount of PIK3CA and p62 protein was reduced in the silencing group and the ratio between Beclin-1 and LC3B II/LC3B I was increased, indicating a higher autophagy level in the silencing group. From the data in fig. 8, the fluorescence intensity of PIK3CA in the silenced group was lower relative to the control group, indicating that silencing hsa_circ_0006470 results in down-regulation of PIK3CA expression. From the data in FIG. 9, the number of autophagy bubbles in the silent group was significantly increased, indicating that higher autophagy levels in the silent group, silencing hsa_circ_0006470, could promote autophagy of AGS.
Example 3 Effect of over-expressed PIK3CA on hsa_circ_0006470 silenced AGS cells
Synthesis of PIK3CA over-expression plasmid PIK3CA over-expression group (si-circRNA+PIK3CA) was obtained by transfecting siRNAs of PIK3CA and hsa_circ_0006470 into AGS cells according to the same host and transfection conditions as the silencing group and the control group.
Expression levels of hsa_circ_0006470, PIK3CA and miR-27b-3p in the silent group, PIK3CA over-expression group and control group were detected 48h after transfection by RT-PCR experiments, and experimental data are shown in FIG. 10.
The expression levels of PIK3CA in the silencing group, PIK3CA overexpression group and control group were detected 48h after transfection by immunofluorescence assay, and experimental data are shown in fig. 11.
From the results of fig. 10 and 11, PIK3CA expression was significantly up-regulated in the PIK3CA over-expression group 48h after transfection, indicating successful PIK3CA over-expression. There was no significant difference in the expression level of miR-27b-3p in the PIK3CA over-expression group and in the silencing group, indicating that PIK3CA over-expression does not affect miR-27b-3p expression.
Expression of autophagy-related genes in the silencing group and the control group was detected by Western blot, and experimental data are shown in fig. 12.
The autophagy in the silencing group, PIK3CA overexpressing group and control group was observed by electron microscopy, and experimental data are shown in fig. 13.
From the results shown in FIG. 12, the PIK3CA over-expressed group showed a significant decrease in the ratio of the protein amounts of PIK3CA and p62 to the protein amount of LC3B II/LC3B I and the protein amount of Beclin-1 relative to the silenced group, and from the results shown in FIG. 13, the PIK3CA over-expressed group showed a small number of autophages relative to the silenced group, indicating that the PIK3CA over-expressed group showed a low autophagy relative to the silenced group, indicating that over-expression of PIK3CA can alleviate the increase in autophagy level of AGS due to hsa_circ_0006470 silencing.
Cell proliferation rates of the PIK3CA overexpressing group, the silencing group, and the control group 48h after transfection were examined, and experimental data are shown in fig. 14. Apoptosis in the PIK3CA overexpression, silencing and control groups 48h post-transfection were detected and experimental data are shown in fig. 15. The tumor cell migration ability of the PIK3CA over-expression group, the silencing group and the control group which are 48 hours after transfection was detected, and experimental data are shown in FIG. 16.
From the results of fig. 14, it can be seen that 48h after transfection, the cell proliferation rate of the pik3ca overexpressing group was significantly increased relative to the silencing group. From the results of fig. 15, it can be seen that 48h after transfection, the apoptosis rate of the pik3ca over-expressed group was significantly reduced relative to the silenced group. From the data in fig. 16, cell mobility was significantly up-regulated in the pik3ca over-expressed group at 48h post-transfection relative to the silenced group. The above results demonstrate that over-expression of PIK3CA can alleviate the decrease in cell proliferation rate, increase in apoptosis and decrease in cell mobility produced by silencing hsa_circ_0006470 in AGS.
Finally, it should be noted that the above embodiments are only for illustrating the technical solution of the present invention and not for limiting the scope of the present invention, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the present invention can be modified or substituted without departing from the spirit and scope of the technical solution of the present invention.
Claims (2)
- Use of an inhibitor of hsa_circ_0006470 for the preparation of a medicament for the treatment of gastric cancer, characterised in that the inhibitor of hsa_circ_0006470 is a siRNAs.
- 2. The use according to claim 1, wherein the inhibitor of hsa_circ_0006470 down regulates hsa_circ_0006470 expression and down regulates hsa_circ_0006470 results in down regulation of PIK3CA expression.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110581631.7A CN113913516B (en) | 2021-05-26 | 2021-05-26 | Application of hsa_circ_0006470 serving as target spot in preparation of miR-27b-3p regulator |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110581631.7A CN113913516B (en) | 2021-05-26 | 2021-05-26 | Application of hsa_circ_0006470 serving as target spot in preparation of miR-27b-3p regulator |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113913516A CN113913516A (en) | 2022-01-11 |
| CN113913516B true CN113913516B (en) | 2023-08-29 |
Family
ID=79232665
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110581631.7A Active CN113913516B (en) | 2021-05-26 | 2021-05-26 | Application of hsa_circ_0006470 serving as target spot in preparation of miR-27b-3p regulator |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113913516B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115261482B (en) * | 2022-10-08 | 2022-12-09 | 暨南大学 | Application of miR-4256 in treatment, diagnosis and prognosis evaluation of gastric cancer |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014201301A1 (en) * | 2013-06-12 | 2014-12-18 | New York University | Anti-mir-27b and anti-mir-148a oligonucleotides as therapeutic tools for treating dyslipidemias and cardiovascular diseases |
| WO2016022076A1 (en) * | 2014-08-07 | 2016-02-11 | Agency For Science, Technology And Research | Microrna biomarker for the diagnosis of gastric cancer |
| CN110117657A (en) * | 2019-06-10 | 2019-08-13 | 山东大学 | Application of the circular rna hsa_circ_0004872 in diagnosing gastric cancer |
| WO2019169710A1 (en) * | 2018-03-05 | 2019-09-12 | 南通大学附属医院 | Tumor molecular marker circbirc6 and inhibitor and use thereof |
-
2021
- 2021-05-26 CN CN202110581631.7A patent/CN113913516B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014201301A1 (en) * | 2013-06-12 | 2014-12-18 | New York University | Anti-mir-27b and anti-mir-148a oligonucleotides as therapeutic tools for treating dyslipidemias and cardiovascular diseases |
| WO2016022076A1 (en) * | 2014-08-07 | 2016-02-11 | Agency For Science, Technology And Research | Microrna biomarker for the diagnosis of gastric cancer |
| WO2019169710A1 (en) * | 2018-03-05 | 2019-09-12 | 南通大学附属医院 | Tumor molecular marker circbirc6 and inhibitor and use thereof |
| CN110117657A (en) * | 2019-06-10 | 2019-08-13 | 山东大学 | Application of the circular rna hsa_circ_0004872 in diagnosing gastric cancer |
Non-Patent Citations (1)
| Title |
|---|
| Downregulated expression of hsa circ 0074362 in gastric cancer and its potential diagnostic values;Xie 等;Biomarkers in Medicine;第12卷(第1期);第11-20页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113913516A (en) | 2022-01-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ye et al. | A genome-scale gain-of-function CRISPR screen in CD8 T cells identifies proline metabolism as a means to enhance CAR-T therapy | |
| Xu et al. | LncRNA PVT1 up-regulation is a poor prognosticator and serves as a therapeutic target in esophageal adenocarcinoma | |
| Wang et al. | miR-15a-3p and miR-16-1-3p negatively regulate twist1 to repress gastric cancer cell invasion and metastasis | |
| Yin et al. | Cancer-associated fibroblasts-derived exosomes upregulate microRNA-135b-5p to promote colorectal cancer cell growth and angiogenesis by inhibiting thioredoxin-interacting protein | |
| Zhang et al. | miR34a/GOLPH3 axis abrogates urothelial bladder cancer chemoresistance via reduced cancer stemness | |
| Gong et al. | LncRNA HAND2‐AS1 represses cervical cancer progression by interaction with transcription factor E2F4 at the promoter of C16orf74 | |
| Deng et al. | MicroRNA-34a regulates proliferation and apoptosis of gastric cancer cells by targeting silent information regulator 1 | |
| Tian et al. | miR‐505 acts as a tumor suppressor in gastric cancer progression through targeting HMGB1 | |
| Zhou et al. | MicroRNA-181b inhibits cellular proliferation and invasion of glioma cells via targeting Sal-like protein 4 | |
| Xu et al. | The differential expression of miRNAs and a preliminary study on the mechanism of miR-194-3p in keloids | |
| Karimi et al. | miRNA‐143 replacement therapy harnesses the proliferation and migration of colorectal cancer cells in vitro | |
| Chen et al. | MicroRNA-17-5p promotes gastric cancer proliferation, migration and invasion by directly targeting early growth response 2 | |
| Zhang et al. | LncRNA GAS5-mediated miR-1323 promotes tumor progression by targeting TP53INP1 in hepatocellular carcinoma | |
| Yang et al. | MiRNA-584 suppresses the progression of ovarian cancer by negatively regulating LPIN1. | |
| Wang et al. | Long noncoding RNA FBXL19‐AS1 induces tumor growth and metastasis by sponging miR‐203a‐3p in lung adenocarcinoma | |
| Wang et al. | Long non-coding RNA LOC283070 mediates the transition of LNCaP cells into androgen-independent cells possibly via CAMK1D | |
| Wei | Interleukin 6 signaling maintains the stem-like properties of bladder cancer stem cells | |
| Yu et al. | Lamin B1 deficiency promotes malignancy and predicts poor prognosis in gastric cancer | |
| CN113913516B (en) | Application of hsa_circ_0006470 serving as target spot in preparation of miR-27b-3p regulator | |
| Chen et al. | MiR-92b inhibits proliferation and invasion of lung cancer by targeting EZH2. | |
| Yang et al. | miR‑342‑3p suppresses cell migration and invasion in preeclampsia by targeting platelet‑derived growth factor receptor α | |
| Tian et al. | Long non-coding RNA BACE1-AS plays an oncogenic role in hepatocellular carcinoma cells through miR-214-3p/APLN axis | |
| Wan et al. | The miR-590-3p/CFHR3/STAT3 signaling pathway promotes cell proliferation and metastasis in hepatocellular carcinoma | |
| Bruno et al. | TRAP1 regulates the response of colorectal cancer cells to hypoxia and inhibits ribosome biogenesis under conditions of oxygen deprivation | |
| Zhu et al. | The miRNA125a-5p and miRNA125b-1-5p cluster induces cell invasion by down-regulating DDB2-reduced epithelial-to-mesenchymal transition (EMT) in colorectal cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |