CN113913516A

CN113913516A - Application of hsa _ circ _0006470 in preparation of miR-27b-3p regulator by using hsa _ circ _0006470 as target point

Info

Publication number: CN113913516A
Application number: CN202110581631.7A
Authority: CN
Inventors: 崔业佳; 蒲荣; 叶锦俊; 黄浩海; 廖丹; 陈婉婵
Original assignee: Dongguan Songshanhu Central Hospital Dongguan Shilong People's Hospital Dongguan Third People's Hospital Dongguan Cardiovascular Disease Research Institute
Current assignee: Dongguan Songshanhu Central Hospital Dongguan Shilong People's Hospital Dongguan Third People's Hospital Dongguan Cardiovascular Disease Research Institute
Priority date: 2021-05-26
Filing date: 2021-05-26
Publication date: 2022-01-11
Anticipated expiration: 2041-05-26
Also published as: CN113913516B

Abstract

The invention provides application and other application of hsa _ circ _0006470 serving as a target point in preparation of a miR-27b-3p regulator. The inventor discovers through a dual-luciferase report experiment that miR-27b-3p and hsa _ circ _0006470 have interaction, discovers through an RNAi experiment that silencing hsa _ circ _0006470 can improve the expression of miR-27b-3p, further can affect a downstream channel of miR-27b-3p such as ROR1 to further inhibit the proliferation and migration capacity of gastric cancer cells, and can also inhibit the expression of PIK3CA to further promote autophagy; the phenotype due to silencing hsa _ circ _0006470 can be alleviated by overexpressing PIK3CA in cancer cells that are silenced hsa _ circ _ 0006470. The results show that hsa _ circ _0006470 has close relation with miR-27b-3p, PIK3CA, proliferation and migration of gastric cancer cells, autophagy effect of cells and the like, so that the application of hsa _ circ _0006470 serving as a target point in preparation of regulators of miR-27b-3p, regulators of PIK3CA, drugs of autophagy and autophagy-related diseases and therapeutic drugs of cancers and the application of hsa _ circ _0006470 serving as a molecular marker in preparation of diagnostic reagents of cancers have great potential value.

Description

Application of hsa _ circ _0006470 in preparation of miR-27b-3p regulator by using hsa _ circ _0006470 as target point

Technical Field

The invention relates to the field of biological medicines, in particular to application of hsa _ circ _0006470 as a target point in preparation of a regulator of miR-27b-3p, application of hsa _ circ _0006470 as a target point in preparation of a regulator of PIK3CA, and application of hsa _ circ _0006470 as a target point in preparation of drugs for autophagy and autophagy-related diseases. Application of hsa _ circ _0006470 as a target in preparation of a cancer treatment drug. Use of hsa _ circ _0006470 as a biomarker for the preparation of a diagnostic reagent for cancer.

Background

Autophagy is a lysosome-mediated intracellular substance degradation and energy circulation path, and can wrap macromolecules such as redundant or wrong proteins in cells, and then form autophagy lysosomes with lysosomes so as to degrade the wrapped macromolecules. Autophagy is an evolutionarily protected cellular process that is involved in many processes in cell growth and development, and abnormalities in autophagy cause abnormalities in various vital activities of cells.

Non-coding RNA Circular RNAs (Circular RNA molecules) are a class of non-coding RNA molecules that do not have a 5 'end cap and a 3' end poly (A) tail and are covalently bonded to form a Circular structure. circRNA is formed by reverse splicing by a non-classical splicing means. The circRNAs are considered to be closely related to various life processes and have great potential value as target sites.

Gastric Cancer (GC) is one of the major malignant diseases in humans, and has a high mortality rate due to the lack of a late diagnosis and effective treatment. Among cancer-related deaths worldwide, the number of deaths caused by gastric cancer is the fifth, and the average five-year survival rate of gastric cancer patients is less than 20%, and more than 70 ten thousand deaths are caused by gastric cancer every year. Gastric cancer is mainly due to helicobacter pylori infection, Epstein-Barr (EBV) infection and smoking risk factors. Surgical resection and chemotherapy have been the primary treatment modalities for gastric cancer patients for the last decade. Genetic mutations and abnormalities in a variety of signaling pathways are thought to contribute to the development of gastric cancer, such as the Hedgehog signaling pathway, the Notch signaling pathway, and the NF-KB signaling pathway. Targeted therapy is considered to be the most promising alternative treatment for gastric cancer, but clinical application of targeted therapy is still difficult, so that the pathogenic mechanism of gastric cancer is not fully elucidated by the current researchers, and many unknown targeted sites and signal paths are urgently needed to be discovered.

Disclosure of Invention

The invention provides application of hsa _ circ _0006470 as a target in preparation of a miR-27b-3p regulator.

The inventor discovers through a dual-luciferase report experiment that miR-27b-3p and hsa _ circ _0006470 have interaction, discovers through an RNAi experiment that silencing hsa _ circ _0006470 can improve the expression of miR-27b-3p, further can affect a downstream channel of miR-27b-3p such as ROR1 to further inhibit the proliferation and migration capacity of gastric cancer cells, and can also inhibit the expression of PIK3CA to further promote autophagy; the phenotype due to silencing hsa _ circ _0006470 can be alleviated by overexpressing PIK3CA in cancer cells that are silenced hsa _ circ _ 0006470. The results show that hsa _ circ _0006470 has close relation with miR-27b-3p, PIK3CA, proliferation and migration of gastric cancer cells, autophagy effect of cells and the like, so that the application of hsa _ circ _0006470 as a target point in preparation of the miR-27b-3p regulator has great potential value.

Further, an inhibitor of hsa _ circ _0006470 was used to down-regulate expression of hsa _ circ _ 0006470. Inhibitors of hsa _ circ _0006470 may be compounds, proteins, polypeptides and the like.

Further, the expression of hsa _ circ _0006470 was down-regulated using genetic engineering methods. Further, genetic engineering methods include gene editing and epigenetic modification. Further, the epigenetic modification comprises RNAi.

The second part of the invention provides the use of hsa _ circ _0006470 as a target for the preparation of modulators of PIK3 CA. Experimental data show that hsa _ circ _0006470 has a close relationship with PIK3CA, and silencing hsa _ circ _0006470 can remarkably reduce the level of PIK3CA, so that a regulator can be prepared by taking hsa _ circ _0006470 as a target and applied to regulation of PIK3 CA.

The third part of the invention provides the application of hsa _ circ _0006470 as a target point in the preparation of drugs for autophagy and autophagy-related diseases. Experimental data show that hsa _ circ _0006470 has close relation with autophagy and autophagy-related diseases, and hsa _ circ _0006470 can regulate the phenotype of autophagy and autophagy-related diseases through a PIK3CA pathway, so that a regulator can be prepared by taking hsa _ circ _0006470 as a target spot and applied to treatment of autophagy and autophagy-related diseases.

The fourth part of the invention provides the application of hsa _ circ _0006470 as a target point in preparing a medicament for treating cancer. Experimental data show that hsa _ circ _0006470 is closely related to proliferation and migration of cancer cells, and silencing hsa _ circ _0006470 can promote proliferation and migration of cancer cells, so that activation of hsa _ circ _0006470 can be expected to inhibit proliferation and migration of cancer cells, and therefore, hsa _ circ _0006470 can be used as a target for preparing a medicine for treating cancer. Further, the cancer may be gastric cancer.

In a fifth aspect, the invention provides the use of hsa _ circ _0006470 as a biomarker for the preparation of a diagnostic reagent for cancer. The experimental data show that hsa _ circ _0006470 is closely related to the proliferation and migration of cancer cells, and therefore, it can be expected to be applied to the preparation of diagnostic reagents for cancer as biomarkers.

Drawings

FIG. 1 is experimental data for a dual luciferase reporter experiment.

FIG. 2 is experimental data for RT-PCR experiments of hsa _ circ _0006470 and miR-27b-3p in the silencing and control groups at 48h post-transfection.

FIG. 3 is experimental data of RT-PCR experiments with ROR1 for the silent and control groups 48h after transfection.

FIG. 4 is experimental data of cell proliferation rates of the silencing group and the control group at 48h after transfection.

FIG. 5 shows the experimental data of apoptosis 48h after transfection in the silencing and control groups.

FIG. 6 is experimental data of tumor cell migration ability of the silencing group and the control group 48h after transfection.

FIG. 7 is experimental data for detecting the expression of autophagy-related genes in the silencing group and the control group 48h after transfection by Western blot assay.

FIG. 8 is experimental data for the detection of PIK3CA expression 48h after transfection in both the silent and control groups by immunofluorescence assay.

FIG. 9 is experimental data of autophagic vesicles in the silencing and control groups at 48h after transfection under electron microscopy.

FIG. 10 is experimental data for testing the expression levels of hsa _ circ _0006470, PIK3CA, and miR-27b-3p 48h after transfection, in the silencing group, PIK3CA overexpression group, and control group by RT-PCR experiment.

Fig. 11 is experimental data for detecting the expression level of PIK3CA at 48h post-transfection by immunofluorescence assay in the silent, PIK3CA over-expressed and control groups.

FIG. 12 is experimental data for detecting the expression of autophagy-related genes in the silencing and control groups by Western blot assay.

FIG. 13 is experimental data of autophagic vesicles in the silencing group, the PIK3CA overexpression group and the control group at 48h after transfection under electron microscopy.

Fig. 14 is experimental data of cell proliferation rates of PIK3CA overexpression, silencing, and control groups 48h after transfection.

Fig. 15 is experimental data of apoptosis 48h after transfection in PIK3CA overexpression, silencing and control groups.

Fig. 16 is experimental data of tumor cell migration ability of PIK3CA overexpression, silencing, and control groups 48h after transfection.

Detailed Description

To better illustrate the objects, technical solutions and advantages of the present invention, the present invention will be further described with reference to specific examples. It should be noted that the following examples are provided to further illustrate the present invention and should not be construed as limiting the present invention. The starting materials in this example are all commercially available.

The relevant experimental materials and experimental methods were as follows:

cell culture and transfection

Human gastric mucosal epithelial cell lines GES-1 and 4 GC cell lines AGS, HGC-27, Hs 746.T and SNU-1 were purchased from Procell (Wuhan, China). Cells were cultured in DMEM medium (Thermo Fishier Scientific) supplemented with 10% bovine serum albumin (BSA; Sigma Aldrich) and 50U/mL penicillin and streptomycin in a humidified environment of 5% CO2 at 37 ℃.

RT-PCR and quantitative RT-PCR

Total RNA samples from each group of cells were prepared using TRIzol Universal Total RNA extraction reagent (# DP 424; TianGen Biotech, Beijing, China) according to the manufacturer's instructions. The concentration of the RNA samples was determined by measurement on a NanoDrop microspectrometer and the synthesis of the cDNA library was performed according to the manufacturer's protocol using FastQuant RT Super Mix (# KR 108; Tiangen Biotech, Beijing, China). Subsequently, a quantitative PCR method was performed using a Talent fluorescent quantitative detection kit (SYBR Green) (# FP 209; Tiangen Biotech, Beijing, China) according to the procedure suggested by the manufacturer. Finally, relative expression of circRNA or microRNA was calculated by the 2- Δ Ct method using U6 or GAPDH as internal controls for normalization.

TABLE 1 primers for RT-PCR experiments

Gene ID	Sequence(5’-3’)
		U6.F	CTCGCTTCGGCAGCACA
U6.R	AACGCTTCACGAATTTGCGT
		GAPDH.F	TGTTCGTCATGGGTGTGAAC
GAPDH.R	ATGGCATGGACTGTGGTCAT
		hsa_circ_0138960.F	TCCTTGCCGACATTACAGATA
hsa_circ_0138960.R	GTGGCAGGTCTATGCTACTTC
		hsa_circ_0001895.F	CATCGTGATAGTACCCAAGGAC
hsa_circ_0001895.R	CTCCCGATCTGCCTCTTTG
		hsa_circ_0006470.F	ACTCATCATGGACTCCCTGC
hsa_circ_0006470.R	TGAGCACCTCCTTAGCAGACA
		hsa-miR-27b-3p.RT	CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCAGAACT
hsa-miR-27b-3p.F	ACACTCCAGCTGGGTTCACAGTGGCTAAGT
		hsa-miR-27b-3p.R	CTCAACTGGTGTCGTGGA
hsa_circ_006470X.F	GGGACCGCATCTTCTTTGT
		hsa_circ_006470X.R	GTGCTGCTCAAACTTGGTCTT

Forward primer, upstream primer; r is reverse primer, downstream primer; RT is reverse transcription primer, reverse transcription primer.

Dual luciferase reporter gene detection

Wild Type (WT) or Mutant (MUT) sequences of hsa _ circ _0006470 and 3' UTR sequences of PIK3CA were ligated to pmirGLO dual luciferase miRNA target expression vector (# E1330; Promega) as instructed by the manufacturer. In addition, miR-27b-3 pmetics (5'-UUCACAGUGGCUAAGUUCUGC-3') and its negative control (NC; 5'-UUUGUACUACACAAAAGUACUG-3') sequence were synthesized by the GenePharma Company (Shanghai, China). Lipofectamine 3000 reagent (Thermo Fishier Scientific) was used and the manufacturer's instructions were followed, along with the designated miR-27b-3p mimics or NC sequences. Finally, luciferase activity in the cells was measured by luminometer to assess the interaction between circRNA and microRNA.

Cell proliferation and migration

The proliferation of GC cells was measured by the CCK-8 method using the cell counting kit (# CK 04; Dojindo, Japan) according to the manufacturer's instructions. AGS cells were collected by centrifugation at 800g for 5min and seeded in 96-well plates (4000 cells/well). After incubation at 37 ℃ for 24h, 48h and 72h under normal culture conditions, the cells were incubated with 10. mu.l of CCK-8 reagent for a further 3h at 37 ℃ and finally the absorbance at 450nm (OD450) was measured on a microplate reader. The proliferation of GC cells was assessed by the change in OD450 values.

The migration of GC cells was analyzed using the Transwell system (Corning). Cells in serum-free DMEM were seeded in the upper chamber of a Transwell plate and cultured at 37 ℃ for 24 h. The cells migrated into the lower chamber filled with DMEM containing 10% FBS were then stained with 1% crystal violet and observed under a microscope.

Western blot

Total protein was extracted from cultured GC cells using RIPA lysis and extraction buffer (# 89900; Thermo Fishier Scientific) according to the manufacturer's instructions. Protein concentrations were determined by Pierce BCA protein detection kit (# 23227; Thermo Fishier Scientific) according to the manufacturer's instructions. Subsequently, the proteins were boiled in protein loading buffer at 100 ℃ for 5min, separated by SDS-PAGE and transferred onto PVDF membrane (Millipore). After blocking with 5% non-fat milk solution for 2h at room temperature, the proteins on the PVDF membrane were then incubated with the diluted primary antibody overnight at 4 ℃ or for 2h at room temperature, followed by incubation of the secondary antibody for 1-2 h at room temperature and final development using Pierce ECL Plus Western Blotting substrate (# 32134; Thermo Fisher Scientific). Meanwhile, GAPDH protein is used as an internal reference. Antibodies used for protein quantification include LC3B (# ab 51520; Abcam), p62(# 88588; CST), Beclin-1(# ab 210498; Abcam), ROR1(# ab 91187; Abcam), PIK3CA (# ab 40776); abcam) and anti-GAPDH (# ab 181602; abcam).

Transmission electron microscope

Autophagy progression in AGS cells was assessed by observing autophagosome formation with a Transmission Electron Microscope (TEM). GC cells were grown on slides, washed twice with PBS solution, fixed in 2.5% glutaraldehyde solution (in PBS solution) at room temperature for 1.5h, and then incubated with 1.2% tetroxide os solution at room temperature for 20 min. And (3) temperature. Finally, the formation of autophagosomes in the GC cells was observed under a transmission electron microscope.

Statistical analysis method

The present study analyzed quantitative data using SPSS 20.0 software, expressed as mean ± standard deviation. Differences between two or more groups were assessed by Student T-test or ANOVA (analysis of variance) method. Significant differences were considered to exist at P values < 0.05.

Example 1 demonstration of the interaction of hsa _ circ _0006470 with miR-27b-3p by the Dual luciferase reporter method

First, the wild-type gene sequence (WT, synthetic primers hsa _ circ _ 0006470. F: ACTCATCATGGACTCCCTGC, hsa _ circ _ 0006470. R: TGAGCACCTCCTTAGCAGACA) and the mutant gene sequence (MUT, synthetic primers hsa _ circ _006470 X.F: GGGACCGCATCTTCTTTGT, hsa _ circ _006470 X.R: GTGCTGCTCAAACTTGGTCTT) of hsa _ circ _0006470 were synthesized, and the ends of its 3' UTR were ligated to the rear of the reporter gene Luciferase of the pmilGLO vector, respectively, to construct a Luciferase plasmid (pmirGLO-circ _006470 WT vectors or pmirGLO-circ _ 006470T vectors). RNA sequences of miR-27b-3p mimics (5'-UUCACAGUGGCUAAGUUCUGC-3') and a control group (NC: 5'-UUUGUACUACACAAAAGUACUG-3') were then synthesized by GenePharma Company. Dual luciferase reporting experiments were performed using gastric cancer cells (AGS) and divided into four groups in table 2, and the experimental data are shown in fig. 1.

As can be seen from the data in FIG. 1, the fluorescence intensity of panel 2 co-transfected with miR-27b-3p mics + pmirGLO-circ _006470 WT vectors was lower relative to that of panel 1 co-transfected with NC + pmirGLO-circ _006470 WT vectors, whereas the difference in fluorescence between panel 4 co-transfected with miR-27b-3p mics + pmirGLO-circ _006470 MUT vectors and panel 3 co-transfected with NC + pmirGLO-circ _006470 WT vectors was smaller, indicating that the over-expression of miR-27b-3p could inhibit the expression of hsa _ circ _0006470, which had an interaction.

TABLE 2 Dual luciferase report Experimental groups

Example 2 RNAi experiment of hsa _ circ _0006470

Synthesis of siRNAs for hsa _ circ _0006470, well-established AGS cells from the same source were divided into two groups, one transfected with siRNAs for hsa _ circ _0006470 as silencing (si-sirc-RNA) and the other transfected using the same transfection protocol but without addition of siRNAs as Control (Control).

The expression levels of hsa _ circ _0006470 and miR-27b-3p in the two groups were determined by RT-PCR experiments, and the experimental data are shown in FIG. 2.

The expression level of the target gene ROR1 of miR-27b-3p in the two groups is detected by RT-PCR experiments, and the experimental data are shown in figure 3.

From the data in FIGS. 2-3, it can be seen that the expression level of hsa _ circ _0006470 was significantly reduced in the silencing group of siRNAs transfected with hsa _ circ _0006470 relative to the control group, indicating that the silencing group successfully silenced hsa _ circ _ 0006470. The expression quantity of miR-27b-3p in the silencing group of the siRNAs transfected with hsa _ circ _0006470 is remarkably improved relative to that in the control group, which indicates that the silencing hsa _ circ _0006470 can improve the expression of miR-27b-3p and indicates the inhibition effect of hsa _ circ _0006470 on miR-27b-3 p. The expression level of ROR1 in the silencing group of the siRNAs transfected with hsa _ circ _0006470 is obviously reduced relative to the control group, which shows that silencing of the hsa _ circ _0006470 gene can affect the genes downstream of miR-27b-3 p.

Cell proliferation rates were measured 48h after transfection in the silent and control groups and the experimental data are shown in FIG. 4.

From the results in FIG. 4, it can be seen that 48h after transfection, the proliferation rate of cells in the silent group was significantly reduced compared to the control group, indicating that reducing the expression of hsa _ circ _0006470 could inhibit AGS cell proliferation.

Apoptosis was detected in the silent and control groups 48h after transfection, and the experimental data are shown in FIG. 5.

From the results in FIG. 5, it can be seen that 48h after transfection, the apoptosis rate in the silent group was significantly increased compared to the control group, indicating that reduction of expression of hsa _ circ _0006470 could promote AGS apoptosis.

The tumor cell migration capacity of the silencing group and the control group at 48h after transfection was tested, and the experimental data are shown in FIG. 6.

From the data in figure 6, it can be seen that 48h post-transfection, the cell migration rate in the silenced group was significantly reduced relative to the control group, indicating that reducing expression of hsa _ circ _0006470 can inhibit AGS cell migration.

The expression conditions of autophagy-related genes in the silencing group and the control group are detected by Western blot experiments, and the experimental data are shown in FIG. 7.

The expression of PIK3CA was detected in the silent and control groups by immunofluorescence assay, and the experimental data are shown in fig. 8.

The status of autophagic vesicles in the silencing group and the control group was observed by electron microscopy, and the experimental data are shown in fig. 9.

As can be seen from the data in FIG. 7, protein amounts of PIK3CA and p62 were decreased in the silencing group 48h after transfection, and the ratio of Beclin-1 and LC3B II/LC3B I was increased, indicating that the level of autophagy was higher in the silencing group. As can be seen from the data in FIG. 8, the fluorescence intensity of PIK3CA was lower in the silenced group compared to the control group, indicating that silencing hsa _ circ _0006470 results in down-regulation of PIK3CA expression. From the data in figure 9, the number of autophagy vesicles in the silencing group was significantly increased, indicating that the level of autophagy was higher in the silencing group, and that silencing hsa _ circ _0006470 could promote autophagy of AGS cells.

Example 3 Effect of overexpression of PIK3CA on hsa _ circ _0006470 silenced AGS cells

An overexpression plasmid of PIK3CA was synthesized, and siRNAs of PIK3CA and hsa _ circ _0006470 were transfected into AGS cells according to the same host and transfection conditions of the silent group and the control group, to obtain PIK3CA overexpression group (si-circRNA + PIK3 CA).

Expression levels of hsa _ circ _0006470, PIK3CA and miR-27b-3p were examined 48h after transfection, in the silent group, the PIK3CA overexpression group and the control group by RT-PCR experiments, and the experimental data are shown in FIG. 10.

The expression level of PIK3CA in the silent group, PIK3CA overexpression group and control group was measured 48h after transfection by immunofluorescence assay, and the experimental data are shown in fig. 11.

As can be seen from the results of fig. 10 and 11, PIK3CA expression in the PIK3CA overexpression group was significantly up-regulated 48h after transfection, indicating that PIK3CA overexpression was successful. The miR-27b-3p expression levels of the PIK3CA overexpression group and the silencing group are not obviously different, which indicates that the expression of the miR-27b-3p is not influenced by the overexpression of PIK3 CA.

The expression conditions of autophagy-related genes in the silencing group and the control group are detected by Western blot experiments, and the experimental data are shown in figure 12.

The autophagic vacuoles in the silencing group, the PIK3CA overexpression group and the control group were observed by electron microscopy, and the experimental data are shown in fig. 13.

According to the results in fig. 12, the protein amounts of PIK3CA and p62 in the PIK3CA overexpression group are increased, the ratio of the protein amounts of LC3B II/LC3B I and the protein amount of Beclin-1 are significantly reduced, and according to the results in fig. 13, the number of autophagy vesicles in the PIK3CA overexpression group is less than that in the silencing group, which indicates that the autophagy level in the PIK3CA overexpression group is lower than that in the silencing group, indicating that the overexpression of PIK3CA can relieve the increase of autophagy level of AGS caused by hsa _ circ _0006470 silencing.

The cell proliferation rate of PIK3CA overexpression group, silencing group and control group at 48h after transfection was measured, and the experimental data are shown in FIG. 14. Apoptosis of PIK3CA overexpression group, silencing group and control group at 48h after transfection was detected, and experimental data are shown in FIG. 15. The tumor cell migration capacity of the PIK3CA overexpression group, the silencing group and the control group at 48h after transfection is detected, and the experimental data are shown in the figure 16.

As can be seen from the results in fig. 14, 48h after transfection, the cell proliferation rate of PIK3CA overexpression group was significantly increased compared to the silencing group. From the results in fig. 15, it can be seen that the apoptosis rate of PIK3CA overexpression group was significantly decreased compared to the silencing group 48h after transfection. As can be seen from the data in fig. 16, the cell mobility of PIK3CA overexpression group was significantly up-regulated 48h after transfection relative to the silencing group. The above results demonstrate that overexpression of PIK3CA can mitigate the reduction in cell proliferation rate, increased apoptosis, and reduced cell mobility that result from silencing hsa _ circ _0006470 in AGS.

Finally, it should be noted that the above embodiments are only used for illustrating the technical solutions of the present invention and not for limiting the protection scope of the present invention, and although the present invention is described in detail with reference to the preferred embodiments, it is not limited to the embodiments, and those skilled in the art should understand that the technical solutions of the present invention can be modified or substituted with equivalents without departing from the spirit and scope of the technical solutions of the present invention.

Claims

Application of hsa _ circ _0006470 as a target in preparation of miR-27b-3p regulator.
2. The use of hsa _ circ _0006470 as a target for the preparation of modulators of miR-27b-3p according to claim 1, wherein the expression of hsa _ circ _0006470 is down-regulated using an inhibitor of hsa _ circ _ 0006470.
3. The use of hsa _ circ _0006470 as a target for the preparation of modulators of miR-27b-3p according to claim 1, wherein the expression of hsa _ circ _0006470 is down-regulated using genetic engineering methods.
4. The use of hsa _ circ _0006470 as a target for the preparation of modulators of miR-27b-3p according to claim 3, wherein the genetic engineering process comprises gene editing and epigenetic modification.
5. The use of hsa _ circ _0006470 as a target according to claim 4 for the preparation of a modulator of miR-27b-3p, wherein the epigenetic modification comprises RNAi.
Use of hsa _ circ _0006470 as a target in the preparation of a modulator of PIK3 CA.
Application of hsa _ circ _0006470 as a target point in preparation of drugs for autophagy and autophagy-related diseases.
Use of hsa _ circ _0006470 as a target for the preparation of a medicament for the treatment of cancer.
9. The use of hsa _ circ _0006470 as a target in the manufacture of a medicament for the treatment of cancer according to claim 8, wherein the cancer is gastric cancer.
Use of hsa _ circ _0006470 as a biomarker for the preparation of a diagnostic reagent for cancer.