CN113913460A

CN113913460A - Method for detecting replication-competent lentivirus and application thereof

Info

Publication number: CN113913460A
Application number: CN202111169943.3A
Authority: CN
Inventors: 张同存; 顾潮江; 吴寒
Original assignee: Wuhan Bio Raid Biotechnology Co ltd
Current assignee: Wuhan Bio Raid Biotechnology Co ltd
Priority date: 2021-10-08
Filing date: 2021-10-08
Publication date: 2022-01-11

Abstract

The invention provides a method for detecting replication-competent lentivirus, a method for preparing HIV low virulent strain production plasmid and an HIV low virulent strain. A preparation method of an HIV low virulent strain expression vector is based on plasmid pUC19-NL4-EGFP, and stop codons are added in genes Vif, VPR, VPU and nef.

Description

Method for detecting replication-competent lentivirus and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a method for detecting replication-competent lentivirus, a low-virulent strain related to the method and application thereof.

Background

In the production of CAR-T cell therapeutic products, a retroviral vector or a lentiviral vector is generally used to efficiently introduce the CAR gene into T cells, and although both γ -retroviral vectors and lentiviral vectors are Replication-defective vectors, Replication-competent lentiviruses (RCLs) are produced during viral vector production due to homologous or non-homologous recombination between the shuttle vector, packaging vector and endogenous reverse transcription elements in the packaging cell, or between the viral vector and endogenous reverse transcription elements in the T cell. RCL, like retroviral vectors, can integrate into the cell genome, creating the risk of secondary tumors induced by integration that activate proto-oncogenes, destroy tumor suppressor genes, or increase the expression of pro-cell growth factors; in addition, due to the replicative nature, viruses with replication capacity can be produced, and the membrane protein VSV-G capable of infecting various cells is adopted by the lentivirus vector, so that the risk of secondary tumor caused by integration is greatly increased.

At present, the RCL detection method mainly includes PCR method or QPCR method for a specific gene (such as VSV-G gene, psi-gag gene or GALV gene) and sensitive cell infection test method. To increase the sensitivity of the assay, the FDA recommends the detection of RCL using a cell culture-based infectivity assay that first amplifies the RCL, if present, on sensitive cells and detects at the end of the culture using a sensitive, rapid detection method.

However, the existing methods have the following problems: 1. the positive control of the current RCL detection method has no protein label and has lower quantitative sensitivity. 2. The positive control strain has low consistency with the transfer vector sequence in the third generation packaging system, and systematic difference exists. 3. No dose-related inhibition test is performed on the sample to be detected, and false negative is easy to occur.

In order to solve the problems, the invention provides a novel RCL detection method and prepares an HIV low virulent strain as a positive control virus.

Disclosure of Invention

In a first aspect, the invention provides a preparation method of an HIV low virulent strain expression vector, which is characterized in that a termination codon is added into genes Vif, VPR, VPU and nef to obtain an HIV low virulent strain expression plasmid on the basis of a plasmid pUC19-NL 4-EGFP.

The addition of a stop codon at the end of a gene is a well-known method known to those skilled in the art and can be achieved in a variety of specific ways, for example, in one embodiment, the specific steps of adding a terminator are as follows:

SphI-HF/XhoI double enzyme digestion pUC19-NL4-EGFP, and recovery of 5771bp fragment 1;

pcr amplify 4 fragments for homologous recombination: amplifying a Vif gene sequence with a termination codon tagtaa by a primer pair gag-F/Vif-R, wherein the termination codon is added after the 20 th amino acid of the Vif gene to be used as a homologous recombination fragment 2(3705 bp); amplifying a fragment 3(514bp) of a vif-F/VPR-R primer pair, and adding two stop codons after a start codon of a VPR gene through amplification; amplifying a fragment 4(555bp) by a primer pair vpr-F/VPU-R, and adding two stop codons after an initiation codon of a VPU gene through amplification; vpu-F/nef-R amplified fragment 5(4203bp), added two stop codons after the 32 nd amino acid of nef gene by amplification;

c. carrying out homologous recombination on the 5 fragments, carrying out TG1 electrotransformation, selecting clones, and sequencing;

d. the clone with correct sequencing is named BRD-pUC19-NL4-TAA-EGFP, NL4-TAA for short.

Further, 5-fragment homologous recombination was achieved by SOE of fragment 2 and fragment 3, fragment 4 and fragment 5, and direct recombination of three fragments of 5-6 Kb ((S))

MultiS One Step Cloning Kit, C113), the recombinant product was electrotransferred with TG 1.

The second aspect of the present invention provides a attenuated lentiviral expression vector prepared by the method of the first aspect; the HIV low virulent strain expression vector can produce virus strains with at least 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% of identity with the nucleotide sequence shown in SEQ ID NO. 1; preferably, the sequence of the virus strain capable of expression of the weak lentiviral expression vector is SEQ ID No. 1.

In a third aspect of the present invention, there is provided a HIV attenuated strain NL4-TAA as a positive control virus for detecting replication-competent lentiviruses, which can be prepared by the expression vector of the second aspect; a schematic structural diagram of the HIV attenuated strain NL4-TAA is shown in FIG. 1; at least 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to SEQ ID No. 1; preferably, the sequence of the HIV low virulent strain NL4-TAA is SEQ ID NO. 1. By a low virulent strain of HIV is meant that the virus retains only the minimum genes required for HIV replication, maintains a minimum level of replication, and also reduces the cytocidal toxicity of HIV.

A fourth aspect of the invention provides a method of detecting replication-competent lentiviruses, comprising the steps of:

taking an HIV low virulent strain NL4-TAA with a certain concentration as a positive control, mixing the HIV low virulent strain NL4-TAA with a sample to be detected with a certain concentration as an inhibition control, and taking an RPMI 1640 complete culture medium as a negative control;

using a sample to be detected, a negative control, a positive control and an inhibition control to respectively transduce human T cell line C8166; after at least 7 days, for example 21 days, the cells are again amplified, and the p24 protein in the cell culture supernatant is qualitatively detected at the end point of the culture, and whether the replication-competent lentivirus is contained in the detection sample is judged by the presence or absence of the p24 protein.

Preferably, the lentivirus is the low virulent strain NL 4-TAA; the concentration of the attenuated strain NL4-TAA in the positive control was 5TCID 50; the concentration of the attenuated strain NL4-TAA in the negative control is 5TCID 50; the sample to be tested comprises terminal cells producing lentivirus, lentivirus supernatant, lentivirus preparations and CAR-T cells.

The fifth aspect of the invention also provides a kit for detecting replication-competent lentiviruses, comprising the HIV low virulent strain NL4-TAA of the invention.

Advantages of the present invention include, but are not limited to:

1. the use of the attenuated strain of HIV NL4-TAA, which retains only the minimum genes required for HIV replication, maintains a minimum level of replication, and also reduces the cytotoxicity of HIV;

2. the NL4 strain is a direct source of third-generation lentiviral vector gene original, compared with the strain used by the prior RCL detection technology, the replication cycle and the characteristics of the NL4 strain are more similar to those of the third-generation lentiviral vector, and the NL4 strain is more suitable for being used as a positive control;

3. human T cell line C8166 cells are used, which have high sensitivity to both HIV and VSV-G enveloped lentiviral vectors and allow for the infection and passage of attenuated strains of HIV on C8166 cells;

4. detecting p24 protein for quantification;

5. in the existing method, if no addition amount experiment is carried out, excessive samples to be detected are added to inhibit cell proliferation and virus infection, the amplification stage in the method comprises growth and infection inhibition tests for guiding the dosage of the test sample, and compared with the existing method, the method can obviously reduce false negative.

6. More detection points are used, the detection result is more reliable, and the safety is higher.

Drawings

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the principles of the invention and not to limit the invention. In the drawings:

FIG. 1 is a schematic structural diagram of a low virulent strain NL4-TAA of HIV in one embodiment of the present invention;

FIG. 2 is a schematic flow chart of a portion of a replication-competent lentivirus detection method of the present invention;

FIG. 3 shows the results of the study of the inhibition of C8166 cell expansion by lentivirus-producing end cells according to the present invention;

FIG. 4 shows the results of the study of the inhibitory effect of lentivirus-producing terminal cells on lentivirus-infected C8166 cells in the present example;

FIG. 5 shows the results of the study of the inhibitory effect of lentivirus supernatants on the expansion of C8166 cells in the examples of the present invention;

FIG. 6 shows the results of the study of the inhibitory effect of lentivirus supernatants on lentivirus-infected C8166 cells in the examples of the present invention;

FIG. 7 shows the results of a study of the inhibitory effect of a lentiviral preparation on the expansion of C8166 cells in an example of the present invention;

FIG. 8 shows the results of the study of the inhibitory effect of lentivirus preparations on mCD30-01 lentivirus infected C8166 cells in the present example;

FIG. 9 shows the results of the study of the inhibition of C8166 cell expansion by mCD30-01CAR-T cells in the present examples;

FIG. 10 shows the results of the study of the inhibitory effect of mCD30-01CAR-T cells on mCD30-01 lentivirus-infected C8166 cells in the present invention.

Detailed Description

The preferred embodiments of the present invention will be described in conjunction with the accompanying drawings, and it will be understood that they are described herein for the purpose of illustration and explanation and not limitation.

***********************************

Construction of positive low virulent strain NL-TAA in replication-competent lentivirus detection method and virus package

The HIV NL4 strain plasmid pUC19-NL4-EGFP was given by Wuhan university of science. A plasmid for expressing an HIV NL4 low virulent strain is constructed by adding a stop codon in genes Vif, VPR, VPU and nef and weakening the expression of the genes, and the specific construction process is as follows:

pUC19-NL4-EGFP vector double digestion: SphI-HF/XhoI, recovering 5771bp fragment 1.

PCR amplification of 4 fragments for homologous recombination: amplifying a Vif gene sequence with a termination codon tagtaa by using a primer and a pair of gag-F/Vif-R, wherein the termination codon is added after 4bp of interval behind the pol sequence, namely the 20 th amino acid of the Vif gene, and is used as a homologous recombination fragment 2(3705 bp); amplifying a fragment 3(514bp) of a vif-F/VPR-R primer pair, and adding two stop codons after a start codon of a VPR gene through amplification; amplifying a fragment 4(555bp) by a primer pair vpr-F/VPU-R, and adding two stop codons after an initiation codon of a VPU gene through amplification; vpu-F/nef-R amplified fragment 5(4203bp), added two stop codons after the 32 nd amino acid of nef gene by amplification;

the sequences of the primer pairs are as follows:

gag-F TGGGATAGATTGCATCCAGTGCATGCAGGGCCTATTGCACCAGGCCAG(SEQ ID NO.2)

nef-R TGCTCCATGTTTTTCTAGGTCTCGAGATACttactaTGCTCCCACCCCATCTGCTG(SEQ ID NO.3)

vif-F GACAGGATGAGGATTAACACAtagtaaTGGAAAAGATTAGTAAAACAC(SEQ ID NO.4)

vif-R GTGTTTTACTAATCTTTTCCAttactaTGTGTTAATCCTCATCCTGTC(SEQ ID NO.5)

vpr-F GAAACTGACAGAGGACAGATGtagtaaGAACAAGCCCCAGAAGACCA(SEQ ID NO.6)

vpr-R TGGTCTTCTGGGGCTTGTTCttactaCATCTGTCCTCTGTCAGTTTC(SEQ ID NO.7)

vpu-F GCAGTAAGTAGTACATGTAATGtagtaaCAACCTATAATAGTAGCAAT(SEQ ID NO.8)

vpu-R ATTGCTACTATTATAGGTTGttactaCATTACATGTACTACTTACTG(SEQ ID NO.9)

3.5 fragments were homologously recombined, TG1 was electrotransferred, and clones were picked and sequenced.

4. The clone with correct sequencing is named as BRD-pUC19-NL4-TAA-EGFP, abbreviated as NL4-TAA, and the genome structure and the plasmid map are shown in figure 1.

The NL4-TAA plasmid was co-transfected with a BZ3 plasmid (expressing VSV-G) into 293T cells, and after 3 days the attenuated strain of HIV NL4 was harvested and concentrated, and used as a positive control virus in a replication-competent lentivirus assay, designated NL4-TAA virus. Using Lenti-X^TMp24 Rapid Titer Kit (TAKARA), used as per the instructions, tested the p24 protein content and the results were: 2.31X 10⁷pg/mL。

NL4-TAA Virus produced by expression plasmid Via TCID₅₀Determination of concentration

The RCL detection method needs NL4-TAA virus as a positive control virus to infect C8166 cells to judge the effectiveness of the RCL detection result. Before the start of the RCL detection experiment, the activity of the NL4-TAA virus has to be determined in order to determine the amount of positive control virus that actually needs to be added in a subsequent RCL detection experiment. Half the cell culture infectious amount of TCID can be used₅₀(50% tissue culture infectious dose) to characterize NL4-TAA virus activity. Because the NL4-TAA virus genome is inserted with the green fluorescent protein (EGFP) gene, C8166 is successfully infected by the virusAfter the cells are cultured, the infected cells express green fluorescent protein and can be directly observed under a fluorescence microscope, and the hole with the cells carrying green fluorescence in the cultured hole plate is a positive hole.

NL4-TAA Virus TCID₅₀Determining: NL4-TAA virus is diluted in a gradient manner, and the concentration of p24 after the dilution in the gradient manner is 1fg/mL, 10fg/mL, 100fg/mL, 1pg/mL, 10pg/mL and 100pg/mL in sequence; c8166 cells were resuspended in the above-mentioned virus dilutions at a cell density of 2.5X 10⁵Adding polybrene (polybrene) to the solution per mL to a final concentration of 8 μ g/mL, and mixing; inoculating the cell suspension containing virus with different concentrations into 96-well plate, making 10 multiple wells per concentration with 100 μ L per well, placing 96-well plate at 37 deg.C and 5% CO₂The cell culture box of (1); 3 days after infection, 50. mu.L of fresh culture medium was added; after 7 days of infection, 50. mu.L of fresh culture medium was added; after 10 days, the fluorescence of each well, i.e., the number of positive wells per dilution gradient, TCID, was observed one by one₅₀The value of (b) can be calculated according to the calculation formula of Reed-Muench, as follows:

distance ratio ═ (percentage of greater than 50% positivity-50%)/(percentage of greater than 50% positivity-percentage of less than 50% positivity)

lgTCID₅₀Distance ratio x difference between log of dilutions + log of dilutions above 50% positive rate. The results were: 31.62 fg.

2. According to TCID₅₀The NL4-TAA virus concentration was 7.3X 10 in terms of the value of (b) and the content of the virus p24 protein⁸TCID₅₀/mL。

System work flow of RCL detection

The FDA recommended RCL detection method is to amplify RCL that may be present in a viral vector by culture using sensitive cells and detect at the end of the culture, see fig. 2, by first amplifying RCL that may be present on sensitive cells and detecting at the end of the culture using a sensitive, rapid detection method. An effective infection assay requires firstly that the test sample (positive reference) of RCL infects sensitive cells, secondly that infectious viral particles are produced and released in sensitive cells, and that the infection assay has sufficient sensitivity to detect positive control viruses at low MOI.

Study on addition amount of each test sample in RCL test

For the control of RCL, since lentiviral vector production currently cannot use stable transgenic cell lines, RCL checkpoint consists mainly of the production of lentiviral end-cells, lentiviral supernatants, lentiviral transduced cells, lentiviral preparations and CAR-T cells,

(1) the influence of the addition of terminal cells for producing lentivirus, lentivirus supernatant, lentivirus products and CAR-T cells on the proliferation and infection of C8166 is researched, and the addition of each test sample can be obtained by analyzing the result.

(2) Study of Lentiviral-producing end-cells, Lentiviral supernatants, Lentiviral preparations, and CAR-T cells on inhibition of C8166 cell expansion

(ii) adding terminal cells for producing lentivirus at 1X 10⁶、2.5×10⁶、3×10⁶、3.5×10⁶、4×10⁶To 5X 10⁶In each C8166 cell, after 6 days of co-culture, counting is carried out, and the results of each group are compared with the group without the terminal cell producing lentivirus, so as to analyze whether significant difference exists. The results show that the final cell addition for the production of lentivirus is less than 4X 10⁶There was no inhibition of C8166 cell proliferation, and the results are shown in fig. 3. (ns means no significant difference, p > 0.05).

② every 5 × 10⁶And adding lentivirus supernatant into each C8166 cell, wherein the content of p24 is 250ng, 500ng and 1000ng to the C8166 cell respectively, culturing for 6 days, counting, comparing the results of each group with the group without the lentivirus supernatant, and analyzing whether the difference is significant. The results show that the addition of lentivirus supernatant below 1000ng does not inhibit the proliferation of C8166 cells, and the results are shown in FIG. 5(ns indicates no significant difference, p > 0.05).

③ every 5X 10⁶And respectively adding lentivirus preparations with p24 content of 500ng, 1000ng and 2000ng to the C8166 cells into each C8166 cell, culturing for 6 days, counting, comparing the results of each group with the results of the group without the lentivirus preparations, and analyzing whether the significant difference exists. KnotThe result shows that when the addition amount of the lentivirus preparation is less than 1000ng, the lentivirus preparation does not inhibit the proliferation of C8166 cells, and the result is shown in figure 7: when the final concentration of the added lentivirus preparation p24 is 500ng/mL and 1000ng/mL in sequence, the expansion of C8166 cells is not significantly inhibited (ns represents no significant difference, and p is more than 0.05). When the final concentration of the lentivirus preparation p24 is 2000ng/mL in sequence, the expansion of C8166 cells is remarkably inhibited (p is represented by x)<0.001)。

Fourthly, every 5 multiplied by 10⁶CAR-T cells were added to each of the C8166 cells in an amount of 5 × 10⁶、1×10⁷、2×10⁷To C8166 cells, after 6 days of co-culture, the results were counted and compared with the group without CAR-T cells for each group to analyze whether there was a significant difference. The results show that CAR-T cells are added in an amount of less than 2X 10⁷There was no inhibition of C8166 cell proliferation, and the results are shown in FIG. 9(ns indicates no significant difference, p > 0.05).

(3) Study of Lentiviral-producing end-cells, Lentiviral supernatants, Lentiviral preparations and CAR-T cells on inhibition of Lentiviral-infected C8166 cells

Separately, 1X 10 terminal cells producing lentivirus were added⁶、1.5×10⁶、2.5×10⁶、2.5×10⁶、3×10⁶、3.5×10⁶、4×10⁶And (3) adding the same amount of CAR lentivirus to the C8166 cells, so that the conversion efficiency does not exceed 40%, carrying out flow detection on the proportion of the CAR-C8166 cells after 3 days of co-culture, and comparing the results of each group with the group without the terminal cell for producing lentivirus to analyze whether the difference is significant. The results show that the final cell addition for lentivirus production is less than 2X 10⁶The inhibitor has no inhibition on C8166 cells infected by lentivirus, and the result is shown in figure 4, wherein 1.0 × 10 is added⁶、1.5×10⁶、2.0×10⁶When the terminal cells produce lentivirus, the virus infection of C8166 cells is not obviously inhibited (ns represents no obvious difference, and p is more than 0.05); adding 2.5X 10⁶、3×10⁶、3.5×10⁶、4×10⁶When all the terminal cells produced lentivirus, the virus infection of C8166 cells (p is less than 0.05, and p is inhibited<0.01, represents p<0.001)。。

③ every 5 in a yield10⁶And respectively adding lentivirus supernatants into the C8166 cells, wherein the p24 content of the lentivirus supernatants is 250ng, 500ng and 1000ng to the C8166 cells, simultaneously respectively adding the same amount of CAR lentivirus, so that the conversion efficiency does not exceed 40%, performing flow detection on the proportion of the CAR-C8166 cells after 3 days of co-culture, and comparing the results of each group with the group without the lentivirus supernatant to analyze whether the difference is significant or not. The result shows that when the addition amount of p24 of lentivirus supernatant is less than 500ng, the lentivirus infected C8166 cells are not inhibited, the result is shown in figure 6, the final concentration of p24 is 250ng/mL and 500ng/mL in sequence, and the virus infected C8166 cells are not inhibited significantly (ns indicates that no significant difference exists, and p is more than 0.05); inhibiting virus infection of C8166 cells (p is shown) when p24 is 1000ng/mL<0.01)。

Fourthly, every 5 multiplied by 10⁶And respectively adding lentivirus preparations into the C8166 cells, wherein the p24 content of the lentivirus preparations is 500ng, 1000ng and 2000ng to the C8166 cells, and simultaneously respectively adding the same amount of CAR lentivirus, so that the conversion efficiency does not exceed 40%, performing flow detection on the proportion of the CAR-C8166 cells after 3 days of co-culture, and comparing the results of each group with the results of the group without the lentivirus preparations to analyze whether the significant difference exists. The results show that when the addition amount of the lentivirus preparation is less than 500ng, the lentivirus preparation has no inhibition on the lentivirus infected C8166 cells, and the results are shown in a figure 8: when the final concentration of the added lentivirus preparation p24 is 500ng/mL, the virus is not inhibited to infect C8166 cells (ns represents no significant difference, and p is more than 0.05); the final concentration of p24 is 1000ng/mL or 2000ng/mL, and the virus infection of C8166 cells is inhibited (p is represented by<0.01, represents p<0.001)。

Every 5X 10⁶CAR-T cells were added to each of the C8166 cells in an amount of 5 × 10⁶、1×10⁷、2×10⁷And (3) adding the same amount of CAR lentivirus to the C8166 cells, so that the conversion efficiency does not exceed 40%, carrying out flow detection on the proportion of the CAR-C8166 cells after 3 days of co-culture, and comparing the results of each group with the results of the group without the CAR-T cells to analyze whether the significant difference exists. The results show that CAR-T cells are added in an amount of less than 5X 10⁶There was no inhibition of lentivirus infection of C8166 cells, and the results are shown in FIG. 10 per 5X 10⁶ 5X 10 in C8166 cells⁶The mCD30-01CAR-T cell can not obviously inhibit virus infection of C8166 cell (ns table)Showing no significant difference, p > 0.05); adding 1X 10⁷、2×10⁷The mCD30-01CAR-T cells all inhibited viral infection of C8166 cells (p is<0.01)。

Positive control, inhibition control setting condition research and complete RCL detection method

(1) Summary of the experiments

(1) Using NL4-TAA Virus (1 TCID) at 3 concentrations₅₀、5TCID₅₀、10TCID₅₀) C8166 cells were infected individually, 3 replicates were made for each concentration, and the amount of NL4-TAA virus added was investigated as a positive control.

② 2 concentrations of NL4-TAA virus (5 TCID)₅₀、10TCID₅₀) C8166 cells are infected respectively, samples to be detected (terminal cells for producing lentivirus, lentivirus supernatant, lentivirus products and CAR-T cells are added respectively and simultaneously, the adding amount of each sample to be detected is according to the research result of the adding amount of each sample to be detected in RCL detection), 3 times of each concentration is carried out, and the adding amount of NL4-TAA virus in an inhibition control group is groped.

And thirdly, the RCL detection process is divided into an amplification stage and an indication stage, cell culture supernatant is collected at the end point of culture, p24 detection is carried out, and a group with the lowest NL4-TAA virus concentration in a group with the positive rate of 3/3 is selected and set as the conditions of a positive control group and an inhibition control group in the lentivirus product replication lentivirus (RCL) detection.

(2) Experimental methods

(ii) initiation of the experiment

a. Stock NL4-TAA Virus was removed from the freezer at-80 ℃ and the virus TCID was determined₅₀Value, gradient dilution of the virus with RPMI 1640 complete Medium to give 1TCID₅₀/mL、5TCID₅₀/mL、10TCID₅₀Viral dilutions per mL.

b. Positive control group: taking C8166 cells, re-suspending the cells into 12-well plates by using a virus diluent, arranging 3 multiple wells in each group, and setting the cell density of each well to be 5 multiplied by 10⁶/mL，polybrene 8μg/mL。

Inhibition control: taking C8166 cells, re-suspending the cells into a 12-well plate by using a virus diluent, adding a sample to be detected, and setting 3 multiple wells in each group, wherein each multiple well isCell density of 5X 10⁶/mL，polybrene 8μg/mL。

Negative control: taking C8166 cells, using RPMI 1640 complete culture medium to be suspended into 12-well plates, setting 3 multiple wells, wherein the cell density of each well is 5 multiplied by 10⁶/mL，polybrene 8μg/mL。

And (3) sample groups to be detected: taking C8166 cells, using RPMI 1640 complete culture medium to resuspend the cells into a 12-well plate, adding a sample to be detected, setting 3 multiple wells, wherein the cell density of each well is 5 multiplied by 10⁶/mL，polybrene 8μg/mL。

c. Placing at 37 ℃ with 5% CO₂After the cell incubator is incubated for 4 hours, the cell suspensions in the wells are respectively transferred to T75 culture bottles and marked, 12mL of RPMI 1640 complete culture medium is added into each T75 culture bottle, and the mixture is uniformly mixed.

Amplification stage

after a.3 days, each flask was supplemented with fresh RPMI 1640 complete medium.

b. After that, the cells were passaged every 2 days at a ratio of 1:4 for a total of 5 passages (three weeks).

c. On day 21, each flask of cell suspension was transferred to a centrifuge tube, centrifuged at 400g for 5min, the supernatant was discarded, RPMI 1640 was added to each tube to resuspend the cells in full culture medium, and the cells were returned to the incubator for further culture.

After d.48 hours, the cell suspension in each vial was collected into a centrifuge tube, centrifuged at 400g for 5 minutes, the supernatant was filtered through a 0.45 μm filter and collected, which was used in the indicated phase of the experiment on the same day.

Indication stage

a. During the last week of the expansion and expansion phase, new untreated C8166 cells were prepared and expanded, providing cells for the upcoming indicator phase.

C8166 cells were counted and the cell suspension was transferred to a 50mL centrifuge tube, 1X 10⁶cells/tube, 400g centrifuge for 5min, discard supernatant, resuspend cells in 4mL RPMI 1640 complete medium, insert 6 wellsPlates, 12 wells total, were placed in a CO2 cell incubator at 37 ℃ for overnight culture at 5% CO2, centrifuged for 5min at 400g, the supernatant discarded, and the cells in each well were resuspended in 1mL of filtered cell culture supernatant collected from the amplification stage (containing 8. mu.g/mL polybrene), labeled, and placed in a CO2 cell incubator at 37 ℃ at 5% CO 2. After 4 hours, 400g of each was centrifuged for 5min, the supernatant was discarded, and the cells in each tube were resuspended in 4mL of RPMI 1640 complete medium and cultured in 6-well plates. After 72 hours, the cell suspensions in each well were transferred to a culture flask separately and fresh RPMI 1640 complete medium was added each. Culturing in 5% CO2, 37 deg.C CO2 cell culture box.

c. After 6 days of inoculation of the cell culture supernatant in the amplification stage, the cells were centrifuged at 400g for 5min, the supernatant was discarded, and the cells were resuspended in fresh RPMI 1640 medium for complete culture. After 48 hours of fluid exchange, 400g were centrifuged for 5min and the cell culture supernatant was collected and filtered through a 0.45 μm filter for subsequent detection of p 24.

P24 detection

a. Lenti-X^TMAll reagents in the p24 Rapid Titer Kit were incubated at room temperature.

b. Each sample to be detected, the blank control and the positive quality control are provided with 2 multiple holes, and a proper amount of 8-hole strips are taken according to the number of the samples and are arranged in an ELISA frame to be marked.

c. To each well was added 20. mu.L of lysis buffer (lysis buffer).

d. Positive quality control (p24 content: 100 pg/mL): a100-fold dilution of p24 standard (10ng/mL) was performed in RPMI 1640 complete medium, i.e., 5. mu. L p24 standard (10ng/mL) was added to 495. mu.L of RPMI 1640 complete medium and mixed well.

e. Blank control: RPMI 1640 complete medium. 200 μ L of each cell culture supernatant collected at the end of the indicated period was taken and added to the corresponding well.

f. The reaction plate was sealed with a sealing plate and incubated at 37 ℃ for 60 min.

g. The membrane of the well plate was removed, the liquid in the well plate was discarded, 300. mu.L of 1 xwash buffer was added to each well, the well plate was held horizontally by the left hand, the edge of the well plate was tapped with a high frequency finger of the right hand, and washed thoroughly for 30 sec.

h. Discard wash buffer, and flip-chip on absorbent paper, and gently blot dry.

i. Repeating the steps g to h, and washing for 5 times.

j. mu.L of biotin-labeled anti-p24 antibody was added to each well, the reaction plate was sealed with a sealing plate, and incubated at 37 ℃ for 60 min.

k. Removing the sealing plate membrane, discarding the antibody of each hole, repeating the operation of g-h, and washing the hole plate for 5 times.

Add 100. mu.L of Streptavidin-HRP to each well and incubate for 30min at room temperature.

m. discarding Streptavidin-HRP in each hole, repeating g-h operation, and washing the hole plate for 5 times.

n. add 100 μ L of Substrate Solution to each well immediately, incubate at room temperature for 30min in the dark.

o. add 100 μ L of Stop Solution to each well, immediately place under a microplate reader, and read the absorbance at 450 nm.

p.Lenti-X^TMThe cut-off value of the p24 Rapid tip Kit is 0.203, the judgment that the OD450 value is greater than or equal to the cut-off value is positive, and the judgment that the OD value is less than the cut-off value is negative.

Taking the concentration of NL4-TAA virus in the group with the positive rate of 3/3 as the setting condition of the positive control group and the inhibition control group according to the results of the positive control group and the inhibition control group.

According to the determined adding amount of the sample to be detected, the positive control and the research result of the setting conditions of the inhibition control group, the RCL detection of the test sample is carried out, and the effectiveness of the method is verified

Table 1: research experiment result of terminal cell RCL detection positive control and inhibition control setting conditions for producing lentivirus

Table 1: according to the results of the positive control and the inhibition control, the lowest concentration group of NL4-TAA virus in the group with the positive rate of 3/3 was used as the setting condition for the positive control and the inhibition control. Therefore, 5TCID was added to the RCL assay of end-cells producing lentivirus₅₀NL4-TAA Virus as a positive control, 5TCID₅₀NL4-TAA virus plus the sample to be tested served as an inhibition control.

Table 2: research experiment result of positive control and inhibition control setting conditions for RCL detection of CAR-T cells

Table 2: according to the results of the positive control and the inhibition control, the lowest concentration group of NL4-TAA virus in the group with the positive rate of 3/3 was used as the setting condition for the positive control and the inhibition control. Therefore, 5TCID was added in the RCL assay of CAR-T cells₅₀NL4-TAA virus as a positive control and 5TCID50 NL4-TAA virus plus the sample to be tested as an inhibition control.

Table 3: research experiment result of positive control and inhibition control setting conditions for RCL detection of lentivirus supernatant

Table 3: according to the results of the positive control and the inhibition control, the lowest concentration group of NL4-TAA virus in the group with the positive rate of 3/3 was used as the setting condition for the positive control and the inhibition control. Thus, 5TCID was added to the RCL assay of lentivirus supernatants₅₀NL4-TAA Virus as a positive control, 10TCID₅₀NL4-TAA virus plus the sample to be tested served as an inhibition control.

Table 5: research experiment result of RCL detection positive control and inhibition control setting conditions of lentivirus product

Table 5: according to the results of the positive control and the inhibition control, the lowest concentration group of NL4-TAA virus in the group with the positive rate of 3/3 was used as the setting condition for the positive control and the inhibition control. Therefore, 5TCID was added to the RCL detection of lentivirus preparations₅₀NL4-TAA Virus as a positive control, 5TCID₅₀NL4-TAA virus plus the sample to be tested served as an inhibition control.

Table 6: end cell RCL assay for lentivirus production

Table 6: the RCL detection results of the terminal cells of 3 batches for producing the lentiviruses show that the positive control positive rate is 3/3, the inhibition control positive rate is 3/3, and the negative control positive rate is 0/3 (namely all the cells are negative), the detection result is effective, and the RCL of the samples to be detected of each batch is negative.

Table 8: large-scale pilot-scale production of three batches of CAR-T cell RCL detection results

8: the CAR-T cell RCL test results of 3 batches show that the positive control positive rate is 3/3, the inhibition control positive rate is 3/3, and the negative control positive rate is 0/3 (all negative), the test result is valid, and the RCL of the sample to be tested of each batch is negative. .

Table 9: RCL detection results of lentivirus supernatants of three batches produced in large-scale pilot scale test

Table 9: the RCL detection results of the lentivirus supernatants of the 3 batches show that the positive control positive rate is 3/3, the inhibition control positive rate is 3/3, and the negative control positive rate is 0/3 (namely all negative), the detection result is effective, and the RCL of the samples to be detected of each batch is negative. .

Table 10: pilot-scale three-batch lentivirus preparation RCL detection

Table 10: the RCL detection results of 3 batches of lentivirus products show that the positive rate of the positive control is 3/3, the positive rate of the inhibition control is 3/3, and the positive rate of the negative control is 0/3 (namely all the negative), the detection result is effective, and RCL of the samples to be detected in each batch is negative. .

In conclusion, the method is safe, effective and efficient under both laboratory conditions and pilot plant conditions; the safety of the lentivirus commodity is ensured.

It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.

Sequence listing

<110> Wuhan Borui Rui Da Biotech Co., Ltd

<120> method for detecting replication-competent lentivirus and application thereof

<130> CP20737

<141> 2021-10-08

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 14554

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt 60

tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg 120

cttcattcag ctccggttcc caacgatcaa ggcgagttac atgatccccc atgttgtgca 180

aaaaagcggt tagctccttc ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt 240

tatcactcat ggttatggca gcactgcata attctcttac tgtcatgcca tccgtaagat 300

gcttttctgt atttttttag tctctactgt gcctaacttg taagttaaat ttgatcagag 360

gtgtgttccc agaggggaaa acagtatata cagggttcag tactatcgca tttcaggcct 420

ccacctgggt cttggaatgt gtcccccgag gggtgatgac tacctcagtt ggatctccac 480

aggtcacagt gacacaagat aaccaagaca cctcccaagg ctaccacaat gggccgccct 540

ccacgtgcac atggccggag gaactgccat gtcggaggtg caagcacacc tgcgcatcag 600

agtccttggt gtggagggag ggaccagcgc agcttccagc catccacctg atgaacagaa 660

cctagggaaa gccccagttc tacttacacc aggaaaggct ggaagggcta atttggtccc 720

aaaaaagaca agagatcctt gatctgtgga tctaccacac acaaggctac ttccctgatt 780

ggcagaacta cacaccaggg ccagggatca gatatccact gacctttgga tggtgcttca 840

agttagtacc agttgaacca gagcaagtag aagaggccaa tgaaggagag aacaacagct 900

tgttacaccc tatgagccag catgggatgg aggacccgga gggagaagta ttagtgtgga 960

agtttgacag cctcctagca tttcgtcaca tggcccgaga gctgcatccg gagtactaca 1020

aagactgctg acatcgagct ttctacaagg gactttccgc tggggacttt ccagggaggt 1080

gtggcctggg cgggactggg gagtggcgag ccctcagatg ctacatataa gcagctgctt 1140

tttgcctgta ctgggtctct ctggttagac cagatctgag cctgggagct ctctggctaa 1200

ctagggaacc cactgcttaa gcctcaataa agcttgcctt gagtgctcaa agtagtgtgt 1260

gcccgtctgt tgtgtgactc tggtaactag agatccctca gaccctttta gtcagtgtgg 1320

aaaatctcta gcagtggcgc ccgaacaggg acttgaaagc gaaagtaaag ccagaggaga 1380

tctctcgacg caggactcgg cttgctgaag cgcgcacggc aagaggcgag gggcggcgac 1440

tggtgagtac gccaaaaatt ttgactagcg gaggctagaa ggagagagat gggtgcgaga 1500

gcgtcggtat taagcggggg agaattagat aaatgggaaa aaattcggtt aaggccaggg 1560

ggaaagaaac aatataaact aaaacatata gtatgggcaa gcagggagct agaacgattc 1620

gcagttaatc ctggcctttt agagacatca gaaggctgta gacaaatact gggacagcta 1680

caaccatccc ttcagacagg atcagaagaa cttagatcat tatataatac aatagcagtc 1740

ctctattgtg tgcatcaaag gatagatgta aaagacacca aggaagcctt agataagata 1800

gaggaagagc aaaacaaaag taagaaaaag gcacagcaag cagcagctga cacaggaaac 1860

aacagccagg tcagccaaaa ttaccctata gtgcagaacc tccaggggca aatggtacat 1920

caggccatat cacctagaac tttaaatgca tgggtaaaag tagtagaaga gaaggctttc 1980

agcccagaag taatacccat gttttcagca ttatcagaag gagccacccc acaagattta 2040

aataccatgc taaacacagt ggggggacat caagcagcca tgcaaatgtt aaaagagacc 2100

atcaatgagg aagctgcaga atgggataga ttgcatccag tgcatgcagg gcctattgca 2160

ccaggccaga tgagagaacc aaggggaagt gacatagcag gaactactag tacccttcag 2220

gaacaaatag gatggatgac acataatcca cctatcccag taggagaaat ctataaaaga 2280

tggataatcc tgggattaaa taaaatagta agaatgtata gccctaccag cattctggac 2340

ataagacaag gaccaaagga accctttaga gactatgtag accgattcta taaaactcta 2400

agagccgagc aagcttcaca agaggtaaaa aattggatga cagaaacctt gttggtccaa 2460

aatgcgaacc cagattgtaa gactatttta aaagcattgg gaccaggagc gacactagaa 2520

gaaatgatga cagcatgtca gggagtgggg ggacccggcc ataaagcaag agttttggct 2580

gaagcaatga gccaagtaac aaatccagct accataatga tacagaaagg caattttagg 2640

aaccaaagaa agactgttaa gtgtttcaat tgtggcaaag aagggcacat agccaaaaat 2700

tgcagggccc ctaggaaaaa gggctgttgg aaatgtggaa aggaaggaca ccaaatgaaa 2760

gattgtactg agagacaggc taatttttta gggaagatct ggccttccca caagggaagg 2820

ccagggaatt ttcttcagag cagaccagag ccaacagccc caccagaaga gagcttcagg 2880

tttggggaag agacaacaac tccctctcag aagcaggagc cgatagacaa ggaactgtat 2940

cctttagctt ccctcagatc actctttggc agcgacccct cgtcacaata aagatagggg 3000

ggcaattaaa ggaagctcta ttagatacag gagcagatga tacagtatta gaagaaatga 3060

atttgccagg aagatggaaa ccaaaaatga tagggggaat tggaggtttt atcaaagtaa 3120

gacagtatga tcagatactc atagaaatct gcggacataa agctataggt acagtattag 3180

taggacctac acctgtcaac ataattggaa gaaatctgtt gactcagatt ggctgcactt 3240

taaattttcc cattagtcct attgagactg taccagtaaa attaaagcca ggaatggatg 3300

gcccaaaagt taaacaatgg ccattgacag aagaaaaaat aaaagcatta gtagaaattt 3360

gtacagaaat ggaaaaggaa ggaaaaattt caaaaattgg gcctgaaaat ccatacaata 3420

ctccagtatt tgccataaag aaaaaagaca gtactaaatg gagaaaatta gtagatttca 3480

gagaacttaa taagagaact caagatttct gggaagttca attaggaata ccacatcctg 3540

cagggttaaa acagaaaaaa tcagtaacag tactggatgt gggcgatgca tatttttcag 3600

ttcccttaga taaagacttc aggaagtata ctgcatttac catacctagt ataaacaatg 3660

agacaccagg gattagatat cagtacaatg tgcttccaca gggatggaaa ggatcaccag 3720

caatattcca gtgtagcatg acaaaaatct tagagccttt tagaaaacaa aatccagaca 3780

tagtcatcta tcaatacatg gatgatttgt atgtaggatc tgacttagaa atagggcagc 3840

atagaacaaa aatagaggaa ctgagacaac atctgttgag gtggggattt accacaccag 3900

acaaaaaaca tcagaaagaa cctccattcc tttggatggg ttatgaactc catcctgata 3960

aatggacagt acagcctata gtgctgccag aaaaggacag ctggactgtc aatgacatac 4020

agaaattagt gggaaaattg aattgggcaa gtcagattta tgcagggatt aaagtaaggc 4080

aattatgtaa acttcttagg ggaaccaaag cactaacaga agtagtacca ctaacagaag 4140

aagcagagct agaactggca gaaaacaggg agattctaaa agaaccggta catggagtgt 4200

attatgaccc atcaaaagac ttaatagcag aaatacagaa gcaggggcaa ggccaatgga 4260

catatcaaat ttatcaagag ccatttaaaa atctgaaaac aggaaagtat gcaagaatga 4320

agggtgccca cactaatgat gtgaaacaat taacagaggc agtacaaaaa atagccacag 4380

aaagcatagt aatatgggga aagactccta aatttaaatt acccatacaa aaggaaacat 4440

gggaagcatg gtggacagag tattggcaag ccacctggat tcctgagtgg gagtttgtca 4500

atacccctcc cttagtgaag ttatggtacc agttagagaa agaacccata ataggagcag 4560

aaactttcta tgtagatggg gcagccaata gggaaactaa attaggaaaa gcaggatatg 4620

taactgacag aggaagacaa aaagttgtcc ccctaacgga cacaacaaat cagaagactg 4680

agttacaagc aattcatcta gctttgcagg attcgggatt agaagtaaac atagtgacag 4740

actcacaata tgcattggga atcattcaag cacaaccaga taagagtgaa tcagagttag 4800

tcagtcaaat aatagagcag ttaataaaaa aggaaaaagt ctacctggca tgggtaccag 4860

cacacaaagg aattggagga aatgaacaag tagataaatt ggtcagtgct ggaatcagga 4920

aagtactatt tttagatgga atagataagg cccaagaaga acatgagaaa tatcacagta 4980

attggagagc aatggctagt gattttaacc taccacctgt agtagcaaaa gaaatagtag 5040

ccagctgtga taaatgtcag ctaaaagggg aagccatgca tggacaagta gactgtagcc 5100

caggaatatg gcagctagat tgtacacatt tagaaggaaa agttatcttg gtagcagttc 5160

atgtagccag tggatatata gaagcagaag taattccagc agagacaggg caagaaacag 5220

catacttcct cttaaaatta gcaggaagat ggccagtaaa aacagtacat acagacaatg 5280

gcagcaattt caccagtact acagttaagg ccgcctgttg gtgggcgggg atcaagcagg 5340

aatttggcat tccctacaat ccccaaagtc aaggagtaat agaatctatg aataaagaat 5400

taaagaaaat tataggacag gtaagagatc aggctgaaca tcttaagaca gcagtacaaa 5460

tggcagtatt catccacaat tttaaaagaa aaggggggat tggggggtac agtgcagggg 5520

aaagaatagt agacataata gcaacagaca tacaaactaa agaattacaa aaacaaatta 5580

caaaaattca aaattttcgg gtttattaca gggacagcag agatccagtt tggaaaggac 5640

cagcaaagct cctctggaaa ggtgaagggg cagtagtaat acaagataat agtgacataa 5700

aagtagtgcc aagaagaaaa gcaaagatca tcagggatta tggaaaacag atggcaggtg 5760

atgattgtgt ggcaagtaga caggatgagg attaacacat agtaatggaa aagattagta 5820

aaacaccata tgtatatttc aaggaaagct aaggactggt tttatagaca tcactatgaa 5880

agtactaatc caaaaataag ttcagaagta cacatcccac taggggatgc taaattagta 5940

ataacaacat attggggtct gcatacagga gaaagagact ggcatttggg tcagggagtc 6000

tccatagaat ggaggaaaaa gagatatagc acacaagtag accctgacct agcagaccaa 6060

ctaattcatc tgcactattt tgattgtttt tcagaatctg ctataagaaa taccatatta 6120

ggacgtatag ttagtcctag gtgtgaatat caagcaggac ataacaaggt aggatctcta 6180

cagtacttgg cactagcagc attaataaaa ccaaaacaga taaagccacc tttgcctagt 6240

gttaggaaac tgacagagga cagatgtagt aagaacaagc cccagaagac caagggccac 6300

agagggagcc atacaatgaa tggacactag agcttttaga ggaacttaag agtgaagctg 6360

ttagacattt tcctaggata tggctccata acttaggaca acatatctat gaaacttacg 6420

gggatacttg ggcaggagtg gaagccataa taagaattct gcaacaactg ctgtttatcc 6480

atttcagaat tgggtgtcga catagcagaa taggcgttac tcgacagagg agagcaagaa 6540

atggagccag tagatcctag actagagccc tggaagcatc caggaagtca gcctaaaact 6600

gcttgtacca attgctattg taaaaagtgt tgctttcatt gccaagtttg tttcatgaca 6660

aaagccttag gcatctccta tggcaggaag aagcggagac agcgacgaag agctcatcag 6720

aacagtcaga ctcatcaagc ttctctatca aagcagtaag tagtacatgt aatgtagtaa 6780

caacctataa tagtagcaat agtagcatta gtagtagcaa taataatagc aatagttgtg 6840

tggtccatag taatcataga atataggaaa atattaagac aaagaaaaat agacaggtta 6900

attgatagac taatagaaag agcagaagac agtggcaatg agagtgaagg agaagtatca 6960

gcacttgtgg agatgggggt ggaaatgggg caccatgctc cttgggatat tgatgatctg 7020

tagtgctaca gaaaaattgt gggtcacagt ctattatggg gtacctgtgt ggaaggaagc 7080

aaccaccact ctattttgtg catcagatgc taaagcatat gatacagagg tacataatgt 7140

ttgggccaca catgcctgtg tacccacaga ccccaaccca caagaagtag tattggtaaa 7200

tgtgacagaa aattttaaca tgtggaaaaa tgacatggta gaacagatgc atgaggatat 7260

aatcagttta tgggatcaaa gcctaaagcc atgtgtaaaa ttaaccccac tctgtgttag 7320

tttaaagtgc actgatttga agaatgatac taataccaat agtagtagcg ggagaatgat 7380

aatggagaaa ggagagataa aaaactgctc tttcaatatc agcacaagca taagagataa 7440

ggtgcagaaa gaatatgcat tcttttataa acttgatata gtaccaatag ataataccag 7500

ctataggttg ataagttgta acacctcagt cattacacag gcctgtccaa aggtatcctt 7560

tgagccaatt cccatacatt attgtgcccc ggctggtttt gcgattctaa aatgtaataa 7620

taagacgttc aatggaacag gaccatgtac aaatgtcagc acagtacaat gtacacatgg 7680

aatcaggcca gtagtatcaa ctcaactgct gttaaatggc agtctagcag aagaagatgt 7740

agtaattaga tctgccaatt tcacagacaa tgctaaaacc ataatagtac agctgaacac 7800

atctgtagaa attaattgta caagacccaa caacaataca agaaaaagta tccgtatcca 7860

gaggggacca gggagagcat ttgttacaat aggaaaaata ggaaatatga gacaagcaca 7920

ttgtaacatt agtagagcaa aatggaatgc cactttaaaa cagatagcta gcaaattaag 7980

agaacaattt ggaaataata aaacaataat ctttaagcaa tcctcaggag gggacccaga 8040

aattgtaacg cacagtttta attgtggagg ggaatttttc tactgtaatt caacacaact 8100

gtttaatagt acttggttta atagtacttg gagtactgaa gggtcaaata acactgaagg 8160

aagtgacaca atcacactcc catgcagaat aaaacaattt ataaacatgt ggcaggaagt 8220

aggaaaagca atgtatgccc ctcccatcag tggacaaatt agatgttcat caaatattac 8280

tgggctgcta ttaacaagag atggtggtaa taacaacaat gggtccgaga tcttcagacc 8340

tggaggaggc gatatgaggg acaattggag aagtgaatta tataaatata aagtagtaaa 8400

aattgaacca ttaggagtag cacccaccaa ggcaaagaga agagtggtgc agagagaaaa 8460

aagagcagtg ggaataggag ctttgttcct tgggttcttg ggagcagcag gaagcactat 8520

gggcgcagcg tcaatgacgc tgacggtaca ggccagacaa ttattgtctg atatagtgca 8580

gcagcagaac aatttgctga gggctattga ggcgcaacag catctgttgc aactcacagt 8640

ctggggcatc aaacagctcc aggcaagaat cctggctgtg gaaagatacc taaaggatca 8700

acagctcctg gggatttggg gttgctctgg aaaactcatt tgcaccactg ctgtgccttg 8760

gaatgctagt tggagtaata aatctctgga acagatttgg aataacatga cctggatgga 8820

gtgggacaga gaaattaaca attacacaag cttaatacac tccttaattg aagaatcgca 8880

aaaccagcaa gaaaagaatg aacaagaatt attggaatta gataaatggg caagtttgtg 8940

gaattggttt aacataacaa attggctgtg gtatataaaa ttattcataa tgatagtagg 9000

aggcttggta ggtttaagaa tagtttttgc tgtactttct atagtgaata gagttaggca 9060

gggatattca ccattatcgt ttcagaccca cctcccaatc ccgaggggac ccgacaggcc 9120

cgaaggaata gaagaagaag gtggagagag agacagagac agatccattc gattagtgaa 9180

cggatcctta gcacttatct gggacgatct gcggagcctg tgcctcttca gctaccaccg 9240

cttgagagac ttactcttga ttgtaacgag gattgtggaa cttctgggac gcagggggtg 9300

ggaagccctc aaatattggt ggaatctcct acagtattgg agtcaggaac taaagaatag 9360

tgctgttaac ttgctcaatg ccacagccat agcagtagct gaggggacag atagggttat 9420

agaagtatta caagcagctt atagagctat tcgccacata cctagaagaa taagacaggg 9480

cttggaaagg attttgctat aagatggtga gcaagggcga ggagctgttc accggggtgg 9540

tgcccatcct ggtcgagctg gacggcgacg taaacggcca caagttcagc gtgtccggcg 9600

agggcgaggg cgatgccacc tacggcaagc tgaccctgaa gttcatctgc accaccggca 9660

agctgcccgt gccctggccc accctcgtga ccaccctgac ctacggcgtg cagtgcttca 9720

gccgctaccc cgaccacatg aagcagcacg acttcttcaa gtccgccatg cccgaaggct 9780

acgtccagga gcgcaccatc ttcttcaagg acgacggcaa ctacaagacc cgcgccgagg 9840

tgaagttcga gggcgacacc ctggtgaacc gcatcgagct gaagggcatc gacttcaagg 9900

aggacggcaa catcctgggg cacaagctgg agtacaacta caacagccac aacgtctata 9960

tcatggccga caagcagaag aacggcatca aggtgaactt caagatccgc cacaacatcg 10020

aggacggcag cgtgcagctc gccgaccact accagcagaa cacccccatc ggcgacggcc 10080

ccgtgctgct gcccgacaac cactacctga gcacccagtc cgccctgagc aaagacccca 10140

acgagaagcg cgatcacatg gtcctgctgg agttcgtgac cgccgccggg atcactctcg 10200

gcatggacga gctgtacaag taaagcggcc gcactagtga taattccgcc cctctccctc 10260

ccccccccct aacgttactg gccgaagccg cttggaataa ggccggtgtg cgtttgtcta 10320

tatgttattt tccaccatat tgccgtcttt tggcaatgtg agggcccgga aacctggccc 10380

tgtcttcttg acgagcattc ctaggggtct ttcccctctc gccaaaggaa tgcaaggtct 10440

gttgaatgtc gtgaaggaag cagttcctct ggaagcttct tgaagacaaa caacgtctgt 10500

agcgaccctt tgcaggcagc ggaacccccc acctggcgac aggtgcctct gcggccaaaa 10560

gccacgtgta taagatacac ctgcaaaggc ggcacaaccc cagtgccacg ttgtgagttg 10620

gatagttgtg gaaagagtca aatggctctc ctcaagcgta ttcaacaagg ggctgaagga 10680

tgcccagaag gtaccccatt gtatgggatc tgatctgggg cctcggtgca catgctttac 10740

atgtgtttag tcgaggttaa aaaaacgtct aggccccccg aaccacgggg acgtggtttt 10800

cctttgaaaa acacgatgat aatatgggtg gcaagtggtc aaaaagtagt gtgattggat 10860

ggcctgctgt aagggaaaga atgagacgag ctgagccagc agcagatggg gtgggagcat 10920

agtaagtatc tcgagaccta gaaaaacatg gagcaatcac aagtagcaat acagcagcta 10980

acaatgctgc ttgtgcctgg ctagaagcac aagaggagga agaggtgggt tttccagtca 11040

cacctcaggt acctttaaga ccaatgactt acaaggcagc tgtagatctt agccactttt 11100

taaaagaaaa ggggggactg gaagggctaa ttcactccca aagaagacaa gatatccttg 11160

atctgtggat ctaccacaca caaggctact tccctgattg gcagaactac acaccagggc 11220

caggggtcag atatccactg acctttggat ggtgctacaa gctagtacca gttgagccag 11280

ataaggtaga agaggccaat aaaggagaga acaccagctt gttacaccct gtgagcctgc 11340

atggaatgga tgaccctgag agagaagtgt tagagtggag gtttgacagc cgcctagcat 11400

ttcatcacgt ggcccgagag ctgcatccgg agtacttcaa gaactgctga catcgagctt 11460

gctacaaggg actttccgct ggggactttc cagggaggcg tggcctgggc gggactgggg 11520

agtggcgagc cctcagatgc tgcatataag cagctgcttt ttgcctgtac tgggtctctc 11580

tggttagacc agatctgagc ctgggagctc tctggctaac tagggaaccc actgcttaag 11640

cctcaataaa gcttgccttg agtgcttcaa gtagtgtgtg cccgtctgtt gtgtgactct 11700

ggtaactaga gatccctcag acccttttag tcagtgtgga aaatctctag cacccaggag 11760

gtagaggttg cagtgagcca agatcgcgcc actgcattcc agcctgggca agaaaacaag 11820

actgtctaaa ataataataa taagttaagg gtattaaata tatttataca tggaggtcat 11880

aaaaatatat atatttgggc tgggcgcagt ggctcacacc tgcgcccggc cctttgggag 11940

gccgaggcag gtggatcacc tgagtttggg agttccagac cagcctgacc aacatggaga 12000

aaccccttct ctgtgtattt ttagtagatt ttattttatg tgtattttat tcacaggtat 12060

ttctggaaaa ctgaaactgt ttttcctcta ctctgatacc acaagaatca tcagcacaga 12120

ggaagacttc tgtgatcaaa tgtggtggga gagggaggtt ttcaccagca catgagcagt 12180

cagttctgcc gcagactcgg cgggtgtcct tcggttcagt tccaacaccg cctgcctgga 12240

gagaggtcag accacagggt gagggctcag tccccaagac ataaacaccc aagacataaa 12300

cacccaacag gtccaccccg cctgctgccc aggcagagcc gattcaccaa gacgggaatt 12360

aggatagaga aagagtaagt cacacagagc cggctgtgcg ggagaacgga gttctattat 12420

gactcaaatc agtctcccca agcattcggg gatcagagtt tttaaggata acttagtgtg 12480

tagggggcca gtgagttgga gatgaaagcg tagggagtcg aaggtgtcct tttgcgccga 12540

gtcagttcct gggtgggggc cacaagatcg gatgagccag tttatcaatc cgggggtgcc 12600

agctgatcca tggagtgcag ggtctgcaaa atatctcaag cactgattga tcttaggttt 12660

tacaatagtg atgttacccc aggaacaatt tggggaaggt cagaatcttg tagcctgtag 12720

ctgcatgact cctaaaccat aatttctttt ttgttttttt ttttttattt ttgagacagg 12780

gtctcactct gtcacctagg ctggagtgca gtggtgcaat cacagctcac tgcagcctca 12840

acgtcgtaag ctcaagcgat cctcccacct cagcctgcct ggtagctgag actacaagcg 12900

acgccccagt taatttttgt atttttggta gaggcagcgt tttgccgtgt ggccctggct 12960

ggtctcgaac tcctgggctc aagtgatcca gcctcagcct cccaaagtgc tgggacaacc 13020

ggggccagtc actgcacctg gccctaaacc ataatttcta atcttttggc taatttgtta 13080

gtcctacaaa ggcagtctag tccccaggca aaaagggggt ttgtttcggg aaagggctgt 13140

tactgtcttt gtttcaaact ataaactaag ttcctcctaa acttagttcg gcctacaccc 13200

aggaatgaac aaggagagct tggaggttag aagcacgatg gaattggtta ggtcagatct 13260

ctttcactgt ctgagttata attttgcaat ggtggttcaa agactgcccg cttctgacac 13320

cagtcgctgc attaatgaat cggccaacgc gcggggagag gcggtttgcg tattgggcgc 13380

tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta 13440

tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag 13500

aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg 13560

tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg 13620

tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg 13680

cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga 13740

agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc 13800

tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt 13860

aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact 13920

ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg 13980

cctaactacg gctacactag aagaacagta tttggtatct gcgctctgct gaagccagtt 14040

accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt 14100

ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct 14160

ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg 14220

gtcatgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa atgaagtttt 14280

aaatcaatct aaagtatata tgagtaaact tggtctgaca gttaccaatg cttaatcagt 14340

gaggcaccta tctcagcgat ctgtctattt cgttcatcca tagttgcctg actccccgtc 14400

gtgtagataa ctacgatacg ggagggctta ccatctggcc ccagtgctgc aatgataccg 14460

cgagacccac gctcaccggc tccagattta tcagcaataa accagccagc cggaagggcc 14520

gagcgcagaa gtggtcctgc aactttatcc gcct 14554

<210> 2

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgggatagat tgcatccagt gcatgcaggg cctattgcac caggccag 48

<210> 3

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tgctccatgt ttttctaggt ctcgagatac ttactatgct cccaccccat ctgctg 56

<210> 4

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gacaggatga ggattaacac atagtaatgg aaaagattag taaaacac 48

<210> 5

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gtgttttact aatcttttcc attactatgt gttaatcctc atcctgtc 48

<210> 6

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gaaactgaca gaggacagat gtagtaagaa caagccccag aagacca 47

<210> 7

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tggtcttctg gggcttgttc ttactacatc tgtcctctgt cagtttc 47

<210> 8

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gcagtaagta gtacatgtaa tgtagtaaca acctataata gtagcaat 48

<210> 9

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

attgctacta ttataggttg ttactacatt acatgtacta cttactg 47

Claims

1. A preparation method of an HIV low virulent strain expression vector is characterized in that a termination codon is added into genes Vif, VPR, VPU and nef on the basis of a plasmid pUC19-NL 4-EGFP.

2. The method of claim 1, wherein the adding of the stop codon comprises the steps of:

SphI-HF/XhoI double-enzyme digestion pUC19-NL4-EGFP, and recovery of fragment 1;

pcr amplify 4 fragments for homologous recombination: amplifying a Vif gene sequence with a termination codon tagtaa by a primer pair gag-F/Vif-R, wherein the termination codon is added after the 20 th amino acid of the Vif gene to be used as a homologous recombination fragment segment 2; amplifying a fragment 3 by a primer pair vif-F/VPR-R, and adding two stop codons after the start codon of the VPR gene through amplification; amplifying a segment 4 by a primer pair vpr-F/VPU-R, and adding two stop codons after the start codon of the VPU gene through amplification; vpu-F/nef-R amplified fragment 5, by amplification of the 32 nd amino acid of the nef gene followed by the addition of two stop codons;

c. homologous recombination is carried out on 5 fragments, TG1 electrotransformation is carried out, and cloning is selected and sequenced;

3. An HIV attenuated strain expression vector prepared using the method of claim 1 or 2.

4. The HIV attenuated strain expression vector according to claim 3, which is capable of being used to produce a strain having at least 99% identity to the nucleotide sequence set forth in SEQ ID No. 1.

5. A positive control virus HIV attenuated strain NL4-TAA for detecting replication-competent lentivirus, prepared from the expression vector of claim 3 or 4, the structural schematic of which is shown in FIG. 1.

6. The attenuated strain of HIV NL4-TAA according to claim 5, which is characterized by at least 99% identity with SEQ ID No. 1.

7. A method for detecting replication-competent lentiviruses, comprising the steps of:

taking an HIV low virulent strain with a certain concentration as a positive control, mixing the HIV low virulent strain with a certain concentration with a sample to be detected as an inhibition control, and taking a culture medium as a negative control;

respectively transducing T cell line C8166 cells by using a sample to be detected, a negative control, a positive control and an inhibition control; and after 7 days of culture, amplifying again, and judging whether the sample to be detected contains replication-competent lentivirus or not by qualitatively detecting p24 protein in the cell culture supernatant at the end point of culture.

8. The method according to claim 7, wherein the attenuated strain of HIV is attenuated strain NL4-TAA of HIV.

9. The method of claim 7, wherein the sample to be tested comprises one or more of: end cells of lentivirus, lentivirus supernatant, lentivirus preparations, CAR-T cells are produced.

10. A kit for detecting replication-competent lentiviruses, comprising the low virulent strain of HIV NL4-TAA according to claim 6 or 7.