CN111218473A - System and method for rescuing mumps virus - Google Patents

Abstract

The invention provides a system and a method for preparing mumps virus, which prepares the mumps virus by constructing a full-length mumps virus plasmid with a T7 promoter and an auxiliary plasmid and a reverse genetics method. The helper plasmids had 4 types: NP, P, L and T7RNAP plasmids. Wherein the T7RNAP plasmid is a sequence with a CMV promoter and DNA encoding T7 polymerase. The invention can effectively prepare mumps virus with higher immunogenicity, and has good application prospect.

Description

System and method for rescuing mumps virus

Technical Field

The invention relates to the field of reverse genetics of viruses, in particular to a system and a method for rescuing mumps virus.

Background

Mumps virus (MuV) belongs to the Paramyxoviridae (Paramyxoviridae), the genus Mumps virus. The genome is an unsegmented single-stranded negative-strand ribonucleic acid (RNA) of 15384bp in length. Mumps (mumps) is an acute infectious disease caused by mumps virus, which can affect a wide range of organs, and its clinical manifestations are mainly in parotid gland, gonad and central nervous system, such as aseptic meningitis, encephalitis, orchitis, oophoritis and pancreatitis^[1]。

Mumps vaccination has been in recent 50 years and live attenuated mumps vaccine strains used or used domestically and abroad include: china S₇₉Strains, the American Jeryl Lynn strain, the Japanese Urabe Am9 strain, the presubrio Leningrad-Zagreb strain, the Switzerland Rubini strain, and the Belgium RIT4385 strain^[2]. The America Jeryl Lynn vaccine strain has the widest inoculation range and consists of two sub-strains, namely a main component JL1 sub-strain and a secondary component JL2 sub-strain, wherein the ratio is 5: 1^[34]. Mumps vaccine S used in large scale in our country₇₉The strain is obtained by passage from attenuated live vaccine of Jeryl Lynn strain, and the 3 rd generation working seed batch also contains two sub-strains JL1 and JL2 in the ratio of 2: 5^[5]. The GSK company separates the JL1 sub strain which is uniformly purified by a limiting dilution method based on the Jeryl Lynn strain and is used for developing the vaccine, and the vaccine strain is named as RIT 4385. There are studies showing that: the Jeryl-Lynn strain of merck company and the RIT4385 strain of GSK company have the positive rate of antibody for vaccinating children reaching over 90 percent and the immunogenicity superior to that of S₇₉Plant strain^[6-7]。Sueli L^[8]ProQuad, Iso Pair Merck^TMThe main composition JL1 strain of mumps virus in the vaccine and RIT4385 strain of GSK company are subjected to whole genome sequencing comparison to find that the sequences of the two are completely identical.

The JL1 strain purified by the limiting dilution method needs to be serially diluted to be monoclonal, and the diluted monoclonal is subjected to sequencing and other works, which consumes a great deal of labor and time.

Disclosure of Invention

In order to obtain the mumps virus attenuated strain with clear components and ensure the stability of a vaccine product thereof, the invention provides a system and a method for rescuing mumps virus.

First, the present invention provides a mumps virus rescue system, which comprises: full-length, NP, P, L and T7RNAP plasmids;

the full-length plasmid is a plasmid with a T7 promoter sequence and a DNA sequence of a genome or antigenome of mumps virus;

the NP plasmid is a plasmid with DNA capable of coding mumps virus nucleocapsid protein;

the plasmid P is a plasmid with DNA capable of coding mumps virus phosphoprotein;

the L plasmid is a plasmid with DNA capable of coding mumps virus polymerase protein;

the T7RNAP plasmid is a plasmid with DNA encoding T7RNA polymerase;

the NP, P, L, and T7RNAP plasmids also carry CMV promoter sequences, respectively.

Further, in the full-length plasmid, the 3' end of the genome sequence of the mumps virus carries a hepatitis delta virus ribozyme sequence (HdvRZ); the 5' end of the mumps virus antigenome sequence has a reverse complementary sequence of hepatitis delta virus ribozyme sequence, and the hepatitis delta virus ribozyme sequence is shown as SEQ ID NO. 1.

Further, the mumps virus is 8₇₉One of the strains, Jeryl Lynn strain, Urabe Am9 strain, Leningrad-Zagreb strain, Rubini strain and RIT4385 strain.

Further, the mumps virus is a strain of sub JL1 of Jeryl Lynn strain.

The invention also provides a method for rescuing mumps virus, which comprises the following steps:

(1) transfecting or transforming a host cell in a culture medium with the full-length plasmid, the NP plasmid, the P plasmid, the L plasmid and the T7RNAP plasmid of claims 1 to 5; the transfection or transformation is performed under conditions sufficient for the rescue composition to co-express and assemble into an infectious virus;

(2) culturing the cells;

(3) and collecting the virus.

Further, the mass ratio of the full-length plasmid, the NP plasmid, the P plasmid, the L plasmid and the T7RNAP plasmid is as follows: 12:8: 4.

Further, the host cell is one of CEF, BHK, 293T, BSR, CHO, MRC-5, WI-38, HEK 293, EB66 and Vero cell, and the preferred host cell is Vero cell.

Further, the host cell is a Vero cell within the P150 generation.

Further, every 5 × 10⁵Each host cell requires 12. mu.g of the full-length plasmid.

The method can effectively save a single mumps virus JL1 strain from plasmids and cells, and the sequencing result shows that: rescue virus JL1^RThe sequence of the amplified fragment is consistent with the theoretical sequence of vaccine strain JL 1.

The method can also obtain high-titer mumps virus, and the subculture titer of the mumps virus can reach 6lgCCID from the rescued P2 generation₅₀More than mL.

The mumps virus obtained by the method of the invention also has good immunogenicity, and the immunogenicity and the vaccine strain S₇₉Is close to immunogenicity.

Obviously, many modifications, substitutions, and variations are possible in light of the above teachings of the invention, without departing from the basic technical spirit of the invention, as defined by the following claims.

Drawings

FIG. 1 is a schematic diagram of the transformation of vector pT7-IRESHIs-C DNA.

Fig. 2 is a schematic diagram of full-length segment construction of JL 1.

FIG. 3A shows pT7-MCS3-MUV_JL1(Hdvrz) plasmid cleavage analysis FIG: 1: supecolled Marker; 2: plasmid pT7-MCS3-MUV_JL1(Hdvrz); 3: NheI-NotI double enzyme digestion products; 4: XhoI-SacII double enzyme digestion products; 5: HindIII enzyme digestion products; 6: DNA Marker DL 15000.

FIG. 3B shows pCDIBP-MuV_JL1-NP、pCDIBP-MuV_JL1-graph of plasmid cleavage analysis: 1:SupeiledMarker; 2: plasmid pCDIBP-MuV_JL1-NP; 3: plasmid pCDIBP-MuV_JL1-P；4：

pCDIBP-MuV_JL1NheI-of NP; NotI double digestion products; 5: pCDIBP-MuV_JL1-NheI-NotI double cleavage product of P; 6: DNA Marker DL 15000.

FIG. 3C is pCDIBP-MuV_JL1-L plasmid cleavage analysis diagram: 1: supecolled Marker; 2: plasmid pCDIBP-MuV_JL1-L; 3: NheI-NotI double enzyme digestion product.

FIG. 4 shows the rescued virus JL1^RMap of infected Vero cells.

FIG. 5RT-PCR amplification of Virus JL1^RThe preceding stage of the L gene of (1): 1: DL5000DNA Marker; 2,3,4: mumps virus JL1^RThe PCR product of (1); 5,6: vero cell PCR product (negative control); 7: full-Length plasmid pT7-MCS3-MUV_JL1(Hdvrz) PCR product (positive control).

FIG. 6 mumps virus JL1^RPassage titer of (c): passage, number of passages.

The foregoing aspects of the present invention are explained in further detail below with reference to specific embodiments. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.

Detailed Description

Example 1 mumps Virus rescue System construction

1 materials and methods

1.1 cells and plasmids

P139 generation Vero cell, mumps vaccine strain S₇₉Plasmid pT7-IRES His-CDNA (Takara Co.), plasmid pCDIBP-T7 RNAP. (with CMV promoter sequence and T7RNA polymerase DNA sequence, see appendix 1, SEQ ID NO.2)

1.2 Primary reagents

The high-purity viral RNA extraction kit is purchased from Roche company;

high fidelity DNA polymerase, T4DNA ligase, restriction endonucleasesDicer, etc. were purchased from NEB; random primers, SuperscriptIII reverse transcriptase, were purchased from Invitrogen; the gel recovery kit was purchased from Promega; the plasmid extraction kit was purchased from Omega; agarose, DNAmarker was purchased from Takara; MEM, FBS cultures were purchased from Gibco; other reagents are all made in China.

1.3 construction of full-Length plasmid and helper plasmid

1.3.1 vector pT7-IRES His-C DNA engineering

PCR was carried out using pT7-IRES His-C DNA vector as a template and pT7-MCS3-NotI and pT7-MCS3-NheI (see Table 1 for sequence) as primers to obtain a vector backbone, and PCR fragments were recovered from the gel. Restriction endonuclease multiple cloning sites NheI-AscI-ClaI-HindIII-BsrGI-XhoI-SacII-XmaI-NotI nucleotide sequence MCS3 was synthesized by Jinwei corporation, MCS3 was linked with the vector PCR amplification product through NheI and NotI restriction enzyme sites, and the modified vector was named pT7-MCS 3. A schematic representation of the engineering of vector pT7-IRES His-C DNA is shown in FIG. 1.

1.3.2 full-Length plasmid cloning construction

Referring to genome sequence of mumps strain JL1 (Genbank: FJ211586), the JL1 full-length cDNA sequence 15384bp is divided into 7 segments of F1-F7 sequence, and the segments are synthesized by Jinzhi corporation, wherein the F7 segment is connected with hepatitis delta virus ribozyme sequence (HdvRZ) at 5' end, and the construction schematic diagram of the JL1 full-length segment is shown in figure 2. The HDvrz sequence is shown as SEQ ID NO.1 in appendix 1. Genes F1-F7 were cloned into vector pT7-MCS3 to obtain 7 recombinant plasmids pT7-MCS3-F1-pT7-MCS 3-F7. The 7 recombinant plasmids sequentially splice the full-length cDNA of the mumps strain according to the restriction enzyme cutting sites, and the construction process is as follows: the F2 fragment in the pT7-MCS3-F2 plasmid was cloned into pT7-MCS3-F3 plasmid through the restriction enzyme sites ClaI-HindIII to obtain plasmid pT7-MCS 3-F23. The F23 fragment in the pT7-MCS3-F23 plasmid was cloned into pT7-MCS3-F1 plasmid through the restriction enzyme site ClaI-BsrGI, and plasmid pT7-MCS3-F123 was obtained. The F123 fragment in the pT7-MCS3-F123 plasmid is cloned to pT7-MCS3-F4 through the AscI-BsrGI enzyme cutting site, and the plasmid pT7-MCS3-F1234 is obtained. The F6 fragment in the pT7-MCS3-F6 plasmid was cloned into pT7-MCS3-F7(HdvRz) plasmid through the SacII-XmaI cleavage site to obtain pT7-MCS3-F67(HdvRz) plasmid. The F67(HdvRz) fragment of the pT7-MCS3-F67(HdvRz) plasmid was cloned into the pT7-MCS3-F5 plasmid through the SacII-NotI cleavage site to obtain the plasmid pT7-MCS3-F567 (HdvRz). Cloning the F1234 fragment of pT7-MCS3-F1234 plasmid to pT7-MCS3-F567(HdvRz) plasmid through the enzyme cutting sites AscI-XhoI, constructing plasmid pT7-MCS3-MUVJL1(HdvRz), and performing enzyme cutting verification on the finally constructed pT7-MCS3-MUVJL1 (HdvRz).

1.3.3 helper plasmid construction

The plasmid pT7-MCS3-F1 is used as a template, pCDIBP-MuVNP-NheI and pCDIBP-MuVNP-NotI are used as primers to amplify NP genes, and the NP genes are cloned to a pCDIBP vector through NheI-NotI enzyme cutting sites to obtain an auxiliary plasmid pCDIBP-MuV_JL1-NP. The L gene was constructed in 2 segments: fragment L1 and fragment F567. Firstly, pT7-MCS3-F4 plasmid is taken as a template, pCDIBP-MuV_L1-NheI、pCDIBP-MuV_L1Amplifying an L1 gene fragment by using XhoI as a primer, and cloning the L1 gene fragment to a pCDIBP vector through a NheI-XhoI enzyme cutting site to obtain a plasmid pCDIBP-MuV_JL1-L₁. Then the F567 fragment in pT7-MCS3-F567 is cloned to a plasmid pCDIBP-MuV after XhoI-NotI double digestion_JL1-L₁Obtaining the helper plasmid pCDIBP-MuV_JL1-L. The mRNA codes V protein after the complete transcription of the mumps virus V/P gene, and the P protein is coded by inserting 2 non-template G residues^[9]. Synthesizing the P gene sequence information of MuV by Jinzhi corporation, cloning the synthesized gene to the vector pCDIBP through NheI-NotI enzyme cutting site to obtain the helper plasmid pCDIBP-MuV_JL1-P. The sequence information of the PCR primers for helper plasmid construction is shown in Table 1.

TABLE 1 PCR primer sequence information

Note: bold: protecting the base; underlining: a restriction enzyme site.

1.4 rescue of recombinant viruses

Will be 5X 10⁵The P141 Vero cells were thoroughly mixed with the electrotransfer buffer solution and suspended, and 12. mu.g pT7-MCS3-MUV were added_JL1(HdvRz)、8μg pCDIBP-MuV_JL1-NP、4μg pCDIBP-MuV_JL1-P、8μg pCDIBP-MuV_JL1L and 4. mu.g of pCDIBP-T7RNAP were mixed well. The mixture is transferred into a mixer with a diameter of 2mmBioRad electric rotor, 1 shock with exponential wave, 140V, 950. mu.F. After electrotransfection, the cells were transferred to T25 flasks, supplemented with 5ml of 10% NBS/MEM, 5% CO₂Culturing at 37 ℃ for 24h, changing the culture solution, continuously culturing until the cell lesion is about 80-90%, repeatedly freezing and thawing the mixture of the transfected cells and the supernatant for 3 times, and harvesting the rescued virus JL1^R. Inoculating P141 Vero cells in monolayer to save virus, culturing at 37 deg.C for 3-4 days, and collecting P2 JL1^RA virus. RT-PCR and gene fragment sequencing identification P2 generation JL1^RA virus.

1.5 Virus Titer assay

The virus titer is detected by adopting an end point dilution method, and the cell half infectious dose (CCID) is calculated by using a Reed-Muench method₅₀). Rescue virus JL1^RSubculturing on Vero cells within 150 generations, taking P1-P10 generation virus, freezing and thawing at-20 ℃ for one time, and collecting virus liquid. The virus solution was serially diluted 10-fold in MEM containing 2% NBS, 100. mu.L/well of each diluted virus solution was inoculated into Vero cells cultured in a 96-well plate, 8 wells were inoculated in each dilution, and the temperature was set at 37 ℃ and 5% CO₂Culturing for 7 days under the condition to judge the result.

2. Results

2.1 full-Length plasmid and helper plasmid restriction assay

DNAman software restriction enzyme site analysis of the constructed plasmid was performed, and then pT7-MCS3-MUV was digested with restriction enzymes NheI-NotI, XhoI-SacII and HindIII, respectively_JL1(Hdvrz), the helper plasmid pCDIBP-MuV was digested with NheI-NotI_JL1-NP、pCDIBP-MuV_JL1-P, and pCDIBP-MuV_JL1And L, the number and the size of the obtained target gene fragment bands are consistent with the expected size, and the plasmid construction result is correct, which is shown in figure 3.

2.2 Virus rescue

full-Length plasmid pT7-MCS3-MUV_JL1(Hdvrz) and corresponding helper plasmid are cotransfected with Vero cells to rescue mumps virus JL1^R. Virus JL1^RAfter infection of Vero cells 3d, intercellular membrane fusion formed large plaque-like lesions consisting of several "vacuoles" of different sizes, as shown in figure 4.

2.3 RT-PCR and Gene sequencing

High purity Virus RN according to RocheExtraction of P2 generation virus JL1 from A extraction kit^RThe genomic RNA of (1), reverse transcribing the RNA into cDNA using a random primer, and using the cDNA as a template and a primer pCDIBP-MuV_JL1-NheI and pCDIBP-MuV_JL1XhoI amplifies the L front segment gene fragment and identifies the virus. Electrophoresis on 1% agarose showed: the PCR product fragment size of the experimental group and the full-length plasmid positive control group is about 460bp, the size is consistent with the theoretical fragment size, and the cell negative control group has no target fragment, which is shown in figure 5. Amplification of Virus JL1 with two pairs of primers JL1-6-S, JL1-6-R, JL1-7-S, JL1-7-R (see Table 1 for primer sequence information)^RGenome SH and HN fragments, and the sequencing result shows that: rescue virus JL1^RThe sequence of the amplified fragment is consistent with the theoretical sequence of vaccine strain JL 1.

2.4 Virus subculture and titer determination

Mumps virus JL1^RSubculturing on Vero cells to P10 generation, and detecting virus JL1 by end point dilution method^RInfectious titer in P1-P10 passages, cell median infectious dose (CCID) was calculated by Reed-Muench method₅₀). P1 generation JL1 obtained by removing rescue^RThe titer was slightly lower at 4.57lgCCID₅₀The titer of other viruses P2-P10 except for/mL is 6lgCCID₅₀above/mL (FIG. 6), the P7-P10 generation virus titers were essentially stable.

To verify the immunogenicity of the rescued viruses of the present invention, the viruses rescued in example 1 were used in the following experimental examples.

Experimental examples immunogenicity assays

1. Method of producing a composite material

1.1 immunization of mice

30 BALB/c mice were randomly divided into 3 groups: rescue virus JL1^RGroup and vaccine strain S₇₉Groups and blank control groups, 10 of each group. JL1^RGroup sum S₇₉The mice were injected intraperitoneally with a virus concentration of 10⁶CCID₅₀mL, 0.5mL per mouse, 2 immunizations, at intervals of 21 d. Collecting blood by cardiac puncture after last immunization for 14d, separating serum, inactivating at 56 deg.C for 30min, and measuring serum neutralizing antibody titer. Control groups were immunized with MEM medium.

1.2 serum Cross-protection neutralization Titers assay

Neutralizing antibody titers were determined using the microcytopathie (CPE) inhibition method. The virus titer is known as JL1^RAnd S₇₉Diluting to 2X 10³CCID₅₀Diluting the serum to be detected in a series of 1: 10, 1: 20, 1: 40, 1: 80, 1: 160 and 1: 320, adding 50 mu L of serum into a 96-well plate, and setting 8 multiple wells for each dilution; the serum to be detected is respectively mixed with JL1 with the same volume^RAnd S₇₉Virus mix, 5% CO at 37 ℃₂And (5) neutralizing in an incubator for 1 h. Add 100. mu.L of cells per well at a concentration of 10⁵Vero cells per mL, 37 ℃, 5% CO₂After 7d incubation, CPE was observed. The highest dilution that can inhibit 50% of CPE is determined as the neutralizing titer of the antibody, which is expressed as the reciprocal of the dilution factor, and the neutralizing antibody titer of the serum to be tested is calculated.

2. Results

JL1^RImmune serogroup against virus JL1^RHas a neutralizing antibody titer of 144.54 and is directed against vaccine strain S₇₉Has a neutralizing antibody titer of 99.77; s₇₉Immune serum against virus JL1^RHas a neutralizing antibody titer of 181.97 and is directed against vaccine strain S₇₉The neutralizing antibody titer of (a) is 169.82; rescue virus JL1^RCan induce mumps vaccine strain S in mice₇₉And rescued virus JL1^RNeutralizing antibody of (1), and rescues virus JL1^RAnd vaccine strain S₇₉The immunogenicity of the mumps virus induced by the two antibodies was close (see table 2).

TABLE 2 Virus JL1^RVaccine strain S₇₉Induced neutralizing antibody titer

In conclusion, the invention can successfully save the parotitis virus, and the saved virus has higher titer and good immunogenicity. The invention has good application prospect.

Appendix 1 correlation sequence

HDvRz(SEQ ID NO.1)：

pCDIBP-T7RNAP(SEQ ID NO.2)：

Appendix 2 list of references

[1]Rubin S，Eckhaus M，Rennick L J，et al.Molecular biology，pathogenesisand pathology of mumps virus[J].J Pathol，2015，235(2)：242-252.

[2]Hviid A，Rubin S，Muhlemann K.Mumps[J].Lancet，2008，371(9616)：932-944.

[3]Afzal MA，Pickford AR，Forsey T，et al.Heterogeneous mumps vaccine[J].Lancet，1992，340(8825)：980-981.

[4]Afzal MA，Pickford AR，Forsey T，et al.The Jeryl Lynn vaccine strainof mumps virus is a mixture of two distinct isolates[J].J Gen Virol，1993，74(Pt5)：917-920.

[5] Zhangjing, longyu, chengshi, et al, mumps vaccine strain S79 whole gene sequence determination and analysis [ J ]. journal of china microbiology and immunology, 2010, 30 (12): 1105-1109.

[6] Immunological effect analysis of mumps vaccine prepared from different strains [ J ]. south China preventive medicine, 2005, 31 (3): 39-42.

[7] Xuhaiming, Thangoing, partial nucleotide sequence analysis of mumps vaccine strains and wild strains [ J ]. J.China journal of microbiology and immunology, 1999, 19 (3): 215-218.

[8]Tillieux S L，Halsey W S，Sathe G M，et al.Comparative analysis ofthe complete nucleotide sequences of measles，mumps，and rubellastrain genomescontained in Priorix-Tetra and ProQuad live attenuated combined vaccines[J].Vaccine，2009，27(16)：2265-2273.

SEQUENCE LISTING

<110> Chengdu biological products institute Limited liability company

<120> a system and method for rescuing mumps virus

<130>GY014-18P1708

<160>12

<170>PatentIn version 3.5

<210>1

<211>295

<212>DNA

<213>artificial sequence

<220>

<223>HDvRz

<400>1

accctaatcc tgccctaggt ggttaggcat tatttgcaat atattaaaga aaactttgaa 60

aatacgaagt ttctattccc agctttgtct ggtggccggc atggtcccag cctcctcgct 120

ggcgccggct gggcaacatt ccgaggggac cgtcccctcg gtaatggcga atgggacgcg 180

gccgatccgg ctgctaacaa agcccgaaag gaagctgagt tggctgctgc caccgctgag 240

caataactag cataacccct tggggcctct aaacgggtct tgaggggttt tttgc 295

<210>2

<211>7381

<212>DNA

<213>artificial sequence

<220>

<223>pCDIBP-T7RNAP

<400>2

actagttatt aatagtaatc aattacgggg tcattagttc atagcccata tatggagttc 60

cgcgttacat aacttacggt aaatggcccg cctggctgac cgcccaacga cccccgccca 120

ttgacgtcaa taatgacgta tgttcccata gtaacgccaa tagggacttt ccattgacgt 180

caatgggtgg agtatttacg gtaaactgcc cacttggcag tacatcaagt gtatcatatg 240

ccaagtacgc cccctattga cgtcaatgac ggtaaatggc ccgcctggca ttatgcccag 300

tacatgacct tatgggactt tcctacttgg cagtacatct acgtattagt catcgctatt 360

accatggtcg aggtgagccc cacgttctgc ttcactctcc ccatctcccc cccctcccca 420

cccccaattt tgtatttatt tattttttaa ttattttgtg cagcgatggg ggcggggggg 480

gggggggggc gcgcgccagg cggggcgggg cggggcgagg ggcggggcgg ggcgaggcgg 540

agaggtgcgg cggcagccaa tcagagcggc gcgctccgaa agtttccttt tatggcgagg 600

cggcggcggc ggcggcccta taaaaagcga agcgcgcggc gggcggggag tcgctgcgac 660

gctgccttcg ccccgtgccc cgctccgccg ccgcctcgcg ccgcccgccc cggctctgac 720

tgaccgcgtt actcccacag gtgagcgggc gggacggccc ttctcctccg ggctgtaatt 780

agcgcttggt ttaatgacgg cttgtttctt ttctgtggct gcgtgaaagc cttgaggggc 840

tccgggaggg ccctttgtgc ggggggagcg gctcgggggg tgcgtgcgtg tgtgtgtgcg 900

tggggagcgc cgcgtgcggc tccgcgctgc ccggcggctg tgagcgctgc gggcgcggcg 960

cggggctttg tgcgctccgc agtgtgcgcg aggggagcgc ggccgggggc ggtgccccgc 1020

ggtgcggggg gggctgcgag gggaacaaag gctgcgtgcg gggtgtgtgc gtgggggggt 1080

gagcaggggg tgtgggcgcg tcggtcgggc tgcaaccccc cctgcacccc cctccccgag 1140

ttgctgagca cggcccggct tcgggtgcgg ggctccgtac ggggcgtggc gcggggctcg 1200

ccgtgccggg cggggggtgg cggcaggtgg gggtgccggg cggggcgggg ccgcctcggg 1260

ccggggaggg ctcgggggag gggcgcggcg gcccccggag cgccggcggc tgtcgaggcg 1320

cggcgagccg cagccattgc cttttatggt aatcgtgcga gagggcgcag ggacttcctt 1380

tgtcccaaat ctgtgcggag ccgaaatctg ggaggcgccg ccgcaccccc tctagcgggc 1440

gcggggcgaa gcggtgcggc gccggcagga aggaaatggg cggggagggc cttcgtgcgt 1500

cgccgcgccg ccgtcccctt ctccctctcc agcctcgggg ctgtccgcgg ggggacggct 1560

gccttcgggg gggacggggc agggcggggt tcggcttctg gcgtgtgacc ggcggctcta 1620

gagcctctgc taaccatgtt catgccttct tctttttcct acagctcctg ggcaacgtgc 1680

tggttattgt gctgtctcat cattttggca aagaattcgc caccatgaac accatcaata 1740

ttgccaagaa cgacttttct gatatcgagc tggccgctat tccattcaat acactggctg 1800

accactacgg agagcggctg gcccgcgaac agctggctct ggagcatgaa agctatgaga 1860

tgggagaagc ccgattcagg aagatgtttg agaggcagct gaaagctggg gaagtggcag 1920

acaacgcagc cgctaagcca ctgattacca cactgctgcc caaaatgatc gccagaatta 1980

atgattggtt cgaggaagtg aaggcaaaac gaggaaagag gcctaccgcc ttccagtttc 2040

tgcaggagat caagccagaa gctgtggcat acatcaccat caagactacc ctggcatgcc 2100

tgacaagcgc cgacaacaca actgtgcagg cagtcgcttc cgcaatcgga cgagctattg 2160

aggacgaagc acgctttggg agaatccggg atctggaggc caagcacttc aagaaaaacg 2220

tggaggaaca gctgaacaag agggtggggc atgtctataa gaaggccttc atgcaggtgg 2280

tcgaggccga catgctgtca aagggactgc tgggaggaga ggcctggagc tcctggcaca 2340

aagaagatag catccatgtg ggagtccgct gcatcgagat gctgattgaa tctactggga 2400

tggtgagtct gcaccgacag aacgccggcg tggtcggaca ggactctgag acaatcgaac 2460

tggctcccga gtatgccgaa gctattgcaa ctagagccgg agctctggca gggatcagtc 2520

caatgttcca gccctgcgtg gtccccccta agccttggac tggcatcacc gggggcggat 2580

actgggctaa tggaaggaga ccactggcac tggtgcgaac acactctaag aaagccctga 2640

tgagatacga ggatgtctat atgcccgaag tgtataaggc catcaacatt gctcagaata 2700

cagcatggaa aattaacaag aaagtgctgg ccgtcgctaa tgtgatcact aagtggaaac 2760

attgtcccgt ggaggacatc cctgccattg aacgggagga actgcctatg aagccagagg 2820

acatcgatat gaaccctgaa gctctgaccg catggaagcg cgcagccgct gcagtgtaca 2880

gaaaggataa agcccggaag tcccggcgca tttctctgga gttcatgctg gaacaggcca 2940

acaagtttgc taatcacaaa gcaatctggt tcccctacaa catggactgg cgcggacgag 3000

tctatgccgt gagcatgttc aaccctcagg ggaatgatat gacaaagggc ctgctgactc 3060

tggctaaggg gaaaccaatt gggaaggagg gctactattg gctgaaaatc cacggggcca 3120

attgcgctggcgtcgacaag gtgccattcc ccgagaggat caagttcatc gaggaaaacc 3180

atgaaaatat tatggcatgt gccaagtctc ccctggagaa cacatggtgg gccgaacagg 3240

atagtccttt ctgctttctg gccttctgtt ttgagtacgc tggagtgcag caccatgggc 3300

tgagttataa ttgctccctg ccactggcct ttgacggctc ttgtagtgga atccagcact 3360

tctccgcaat gctgagggat gaggtcggag gaagagcagt gaacctgctg ccatctgaga 3420

cagtgcagga catctacggc attgtcgcca agaaagtgaa tgagatcctg caggctgacg 3480

caattaacgg gactgataat gaggtggtca ccgtcacaga tgaaaacact ggcgagatca 3540

gcgaaaaggt gaaactggga accaaggccc tggctggaca gtggctggca tacggagtca 3600

cccgctcagt gacaaagcga agcgtgatga ccctggctta tggcagcaaa gagttcggct 3660

tcaggcagca ggtgctggaa gacaccatcc agccagccat tgattccgga aaggggctga 3720

tgtttacaca gcccaaccag gccgctggct acatggccaa gctgatctgg gagtcagtga 3780

gcgtcacagt ggtcgcagcc gtggaagcta tgaattggct gaagtccgct gcaaaactgc 3840

tggccgctga ggtgaaggac aagaaaactg gcgaaattct gaggaaaaga tgcgccgtcc 3900

actgggtgac ccctgatgga ttcccagtgt ggcaggagta taagaaaccc atccagacca 3960

gactgaacct gatgttcctg ggccagtttc ggctgcagcc tacaatcaac actaataagg 4020

acagtgagat tgatgctcat aaacaggaat cagggattgc acctaatttt gtgcacagcc 4080

aggacggctc ccatctgcgg aagactgtgg tctgggctca cgagaaatac ggcatcgaat 4140

ccttcgcact gattcatgac tcttttggaa ccatcccagc cgatgcagcc aacctgttca 4200

aggctgtccg cgagactatg gtggacacct acgaaagttg tgatgtgctg gccgacttct 4260

atgatcagtt tgctgaccag ctgcacgagt cacagctgga taagatgccc gcactgcctg 4320

ccaaaggcaa cctgaatctg agagacatcc tggagtccga tttcgcattt gcctgactcg 4380

aggatctttt tccctctgcc aaaaattatg gggacatcat gaagcccctt gagcatctga 4440

cttctggcta ataaaggaaa tttattttca ttgcaatagt gtgttggaat tttttgtgtc 4500

tctcactcgg aaggacatat gggagggcaa atcatttaaa acatcagaat gagtatttgg 4560

tttagagttt ggcaacatat gcccatatgc tggctgccat gaacaaaggt tggctataaa 4620

gaggtcatca gtatatgaaa cagccccctg ctgtccattc cttattccat agaaaagcct 4680

tgacttgagg ttagattttt tttatatttt gttttgtgtt atttttttct ttaacatccc 4740

taaaattttc cttacatgtt ttactagcca gatttttcct cctctcctga ctactcccag 4800

tcatagctgt ccctcttctc ttatggagat ccctcgacct gcagcccaag cttggcgtaa 4860

tcatggtcat agctgtttcc tgtgtgaaat tgttatccgc tcacaattcc acacaacata 4920

cgagccggaa gcataaagtg taaagcctgg ggtgcctaat gagtgagcta actcacatta 4980

attgcgttgc gctcactgcc cgctttccag tcgggaaacc tgtcgtgcca gcggatccgc 5040

atctcaatta gtcagcaacc atagtcccgc ccctaactcc gcccatcccg cccctaactc 5100

cgcccagttc cgcccattct ccgccccatg gctgactaat tttttttatt tatgcagagg 5160

ccgaggccgc ctcggcctct gagctattcc agaagtagtg aggaggcttt tttggaggcc 5220

taggcttttg caaaaagcta acttgtttat tgcagcttat aatggttaca aataaagcaa 5280

tagcatcaca aatttcacaa ataaagcatt tttttcactg cattctagtt gtggtttgtc 5340

caaactcatc aatgtatctt atcatgtctg gatccgctgc attaatgaat cggccaacgc 5400

gcggggagag gcggtttgcg tattgggcgc tcttccgctt cctcgctcac tgactcgctg 5460

cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta 5520

tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc 5580

aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc ccctgacgag 5640

catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac 5700

caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc 5760

ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag ctcacgctgt 5820

aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc 5880

gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga 5940

cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta 6000

ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag aagaacagta 6060

tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga 6120

tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg 6180

cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag 6240

tggaacgaaa actcacgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc 6300

tagatccttt taaattaaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact 6360

tggtctgaca gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt 6420

cgttcatcca tagttgcctg actccccgtc gtgtagataa ctacgatacg ggagggctta 6480

ccatctggcc ccagtgctgc aatgataccg cgagacccac gctcaccggc tccagattta 6540

tcagcaataa accagccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc 6600

gcctccatcc agtctattaa ttgttgccgg gaagctagag taagtagttc gccagttaat 6660

agtttgcgca acgttgttgc cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt 6720

atggcttcat tcagctccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg 6780

tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg tcagaagtaa gttggccgca 6840

gtgttatcac tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta 6900

agatgctttt ctgtgactgg tgagtactca accaagtcat tctgagaata gtgtatgcgg 6960

cgaccgagtt gctcttgccc ggcgtcaata cgggataata ccgcgccaca tagcagaact 7020

ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa aactctcaag gatcttaccg 7080

ctgttgagat ccagttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt 7140

actttcacca gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga 7200

ataagggcga cacggaaatg ttgaatactc atactcttcc tttttcaata ttattgaagc 7260

atttatcagg gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa 7320

caaatagggg ttccgcgcac atttccccga aaagtgccac ctgggtcgac attgattatt 7380

g 7381

<210>3

<211>20

<212>DNA

<213>artificial sequence

<220>

<223>pT7-MCS3-NotI

<400>3

atccgcggcc gctaattcac 20

<210>4

<211>20

<212>DNA

<213>artificial sequence

<220>

<223>pT7-MCS3-NheI

<400>4

tagctagcgg cgtaatcatg 20

<210>5

<211>34

<212>DNA

<213>artificial sequence

<220>

<223>pCDIBP-MuVNP-NheI

<400>5

ctagctagca tgtcatctgt gctcaaggca tttg 34

<210>6

<211>35

<212>DNA

<213>artificial sequence

<220>

<223>pCDIBP-MuVNP-NotI

<400>6

ttgcggccgc ttactcatcc cagtctccca cttgc 35

<210>7

<211>32

<212>DNA

<213>artificial sequence

<220>

<223>pCDIBP-MuVL1-NheI

<400>7

ctagctagca tggcgggcct aaatgagata ct 32

<210>8

<211>25

<212>DNA

<213>artificial sequence

<220>

<223>pCDIBP-MuVL1-XhoI

<400>8

ctcgagatct ggtaaacaag ttagg 25

<210>9

<211>18

<212>DNA

<213>artificial sequence

<220>

<223>JL1-6-S

<400>9

accctgccgt cgcactat 18

<210>10

<211>22

<212>DNA

<213>artificial sequence

<220>

<223>JL1-6-R

<400>10

cacgctgatc taactcttgt tg 22

<210>11

<211>21

<212>DNA

<213>artificial sequence

<220>

<223>JL1-7-S

<400>11

taggagttaa attagcaaga g 21

<210>12

<211>21

<212>DNA

<213>artificial sequence

<220>

<223>JL1-7-R

<400>12

gcatagagtg gacctagtat c 21

Claims (10)

1. A mumps virus rescue system comprising: full-length, NP, P, L and T7RNAP plasmids;

the full-length plasmid is a plasmid with a T7 promoter sequence and a DNA sequence of a genome or antigenome of mumps virus;

the NP plasmid is a plasmid with DNA capable of coding mumps virus nucleocapsid protein;

the plasmid P is a plasmid with DNA capable of coding mumps virus phosphoprotein;

the L plasmid is a plasmid with DNA capable of coding mumps virus polymerase protein;

the T7RNAP plasmid is a plasmid with DNA encoding T7RNA polymerase;

the NP, P, L, and T7RNAP plasmids also carry CMV promoter sequences, respectively.

2. The viral rescue system of claim 1, wherein the full-length plasmid carries a hepatitis delta virus ribozyme sequence (HdvRZ) at the 3' end of the mumps genome sequence; the 5' end of the mumps virus antigenome sequence has a reverse complementary sequence of hepatitis delta virus ribozyme sequence, and the hepatitis delta virus ribozyme sequence is shown as SEQ ID NO. 1.

3. The viral rescue system of claim 2, wherein the mumps virus is S₇₉One of the strains, JerylLynn strain, Urabe Am9 strain, Leningrad-Zagreb strain, Rubini strain and RIT4385 strain.

4. The viral rescue system of claim 3, wherein the mumps virus is JL1 sub-strain of Jeryl Lynn strain.

5. A method of mumps virus rescue, comprising:

(1) transfecting or transforming a host cell in a culture medium with the full-length plasmid, the NP plasmid, the P plasmid, the L plasmid and the T7RNAP plasmid of claims 1 to 4; the transfection or transformation is performed under conditions sufficient for the rescue composition to co-express and assemble into an infectious virus;

(2) culturing the cells;

(3) and collecting the virus.

6. The method of claim 5, wherein the mass ratio of the full-length plasmid, the NP plasmid, the P plasmid, the L plasmid, and the T7RNAP plasmid is: 12:8:4:8:4.

7. The method of claim 6, wherein the host cell is one of a CEF, BHK, 293T, BSR, CHO, MRC-5, WI-38, HEK 293, EB66, and Vero cell.

8. The method of claim 7, wherein the host cell is a Vero cell.

9. The method of claim 8, wherein the host cell is a Vero cell within the P150 generation.

10. The method of claim 9, wherein each 5 x 10 is used⁵Each host cell requires 12. mu.g of the full-length plasmid.

Images