CN101463361B - Expression vector of double expression boxes, as well as preparation method and application thereof - Google Patents
Expression vector of double expression boxes, as well as preparation method and application thereof Download PDFInfo
- Publication number
- CN101463361B CN101463361B CN2009100763810A CN200910076381A CN101463361B CN 101463361 B CN101463361 B CN 101463361B CN 2009100763810 A CN2009100763810 A CN 2009100763810A CN 200910076381 A CN200910076381 A CN 200910076381A CN 101463361 B CN101463361 B CN 101463361B
- Authority
- CN
- China
- Prior art keywords
- fragment
- recombinant vectors
- template
- upstream
- vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention discloses an expression vector of two expression cassettes and a preparation method and application thereof. The expression vector is in ring shape, comprising a procaryon replication origin, two eucaryon replication origins and selective marker genes, and two exogenous gene expression cassettes; the two exogenous gene expression cassettes are respectively exogenous gene expression cassette 1 and exogenous gene expression cassette 2; the exogenous gene expression cassette 1, from upstream to downstream, comprises two promoters with the same transcription direction, junction fragment 1 and a polyadenylic acid AATAAA in turn. The junction fragment 1 comprises an EcoRV recognition sequence; the exogenous gene expression cassette 2, from upstream to downstream, comprises two promoters with the same transcription direction, junction fragment 2 and a polyadenylic acid AATAAA in turn. The junction fragment 2 comprises a StuI recognition sequence. The pDP-EX-vector of the invention comprises two exogenous gene expression cassettes and two eucaryon replication origins. The pDP-EX-vector can greatly appreciate in the cell expressing T antigen, thus improving the level of protein expression and having a good application prospect.
Description
Technical field
The present invention relates to expression vector of two expression cassettes and preparation method thereof and application.
Background technology
The mammalian cell carrier for expression of eukaryon is one of modal expression vector in the genetic engineering technique, is widely used in fields such as scientific research, production.Compare with the protokaryon protein expression vector,,, outclass eukaryotic expression systems such as prokaryotic expression system and yeast, insect cell aspect active, more approach natural protein through processing and the modification after the translation by the albumen of mammalian cell translation.The eukaryotic protein expression plasmid is widely used in scientific research at present, as study the location of albumen in mammalian cell, development of dna vaccination etc., and many important protein and glycoprotein utilizes the mammal cell line system to express and produce, and some product has dropped into clinical application or on probation.
The eukaryotic expression albumen plasmid that uses is in the process of construction expression foreign gene plasmid at present, be to connect by traditional method of attachment, at first to select proper restriction site, there is not selected restriction enzyme site in the exogenous genetic fragment that requires to connect, use digestion with restriction enzyme carrier and exogenous genetic fragment then, with the T4DNA ligase enzyme carrier and purpose fragment are connected into a complete plasmid again.The method of attachment that traditional this kind of enzyme is cut exists that step is more loaded down with trivial details, cost is high (needs are bought restriction endonuclease and ligase enzyme), problems such as joint efficiency is lower, PCR product and carrier all will be cut electrophoresis by enzyme repeatedly in building process, steps such as recovery just can further connect
Summary of the invention
The purpose of this invention is to provide a kind of expression vector of two expression cassettes and preparation method thereof and application.
Expression vector of two expression cassettes provided by the present invention, called after pDP-EX-vector is a kind of circular vectors, comprises protokaryon replication orgin, two eucaryon replication orgin, selection markers gene and two exogenous gene expression boxes; Described two exogenous gene expression boxes are respectively exogenous gene expression box 1 and exogenous gene expression box 2; Described exogenous gene expression box 1 contains two promotor, junction fragment 1 and polyadenylic acid tailing signals that transcriptional orientation is identical from the upstream successively to the downstream, and described junction fragment 1 contains the EcoRV recognition sequence; Described exogenous gene expression box 2 contains two promotor, junction fragment 2 and polyadenylic acid tailing signals that transcriptional orientation is identical from the upstream successively to the downstream, and described junction fragment 2 contains the StuI recognition sequence.
Wherein, the transcriptional orientation of described exogenous gene expression box 1 and described exogenous gene expression box 2 can be identical also can be opposite, the transcriptional orientation opposite of preferred described exogenous gene expression box 1 and described exogenous gene expression box 2.
Described two identical promotors of transcriptional orientation can be multiple promotor, specifically can be cytomegalovirus promoter and T7 phage promoter.Described eucaryon replication orgin can be the starting point that any existing known eukaryote carries out dna replication dna, specifically can be SV40 virus replication starting point.Described polyadenylic acid tailing signal can be has all dna fragmentations that stop Transcription, specifically can be the bovine growth hormone gene polyadenylic acid and adds tailer sequence.Described protokaryon replication origin can be the starting point that any existing known prokaryotic organism carry out dna replication dna, specifically can be escherichia coli plasmid CoIE1 replication origin.
The nucleotide sequence of pDP-EX-vector specifically can be the sequence 1 in the sequence table.
Cut the linear carrier that described expression vector of two expression cassettes obtains with EcoRV or StuI enzyme and also belong to protection scope of the present invention.
Another object of the present invention provides the construction process of described expression vector of two expression cassettes.
The construction process of expression vector of two expression cassettes provided by the present invention comprises the steps:
1) be template with the pEGFP-N1 plasmid, use following primer: 5 ' ACATGTTCTTTCCTGCGCCGCTACAGGG3 ' and 5 ' GAATTCTGCAGATATCCTCGAGCATGCATCTAG 3 ' carry out pcr amplification, obtain Segment A;
2) be template with the pCDNA3.0 plasmid, use following primer: 5 ' CTCGAGGATATCTGCA
GATATCCAGCACAC3 ' and 5 ' CCCTGTAGCGGCGCAGGAAAGAACATGT3 ' carry out pcr amplification, obtain fragment B;
3) Segment A and fragment B are imported in the competent escherichia coli cell, Segment A is connected with fragment B, obtain recombinant vectors I by homologous recombination;
4) be template with recombinant vectors I, use following primer: 5 ' GGAGGCCTAGGCTTTTGGACGTCAGGTGGCAC3 ' and 5 ' GAGTTAGGGGCGGGATACATTGATTATTGACTAG 3 ' carry out pcr amplification, obtain fragment D;
5) be template with the pEGFP-N1 plasmid, use following primer:
5 ' GTGCCACCTGACGTCCAAAAGCCTAGGCCTCC 3 ' or 5 '
CTAGTCAATAATCAATGTATCCCGCCCCTAACTC 3 ' carries out pcr amplification, obtains fragment C;
6) fragment C and fragment D are imported in the competent escherichia coli cell, fragment C is connected with fragment D, obtain recombinant vectors II by homologous recombination;
7) be template with the pEGFP-N1 plasmid, use following primer: 5 '
CGCCCTGTAGCGGCGATCCCGCCCCTAACTC 3 ' and 5 '
CTCACATGTTCTTTCCTGCAAAAGCCTAGGCCTCC 3 ' carries out pcr amplification, obtains fragment F;
8) be template with recombinant vectors II, use following primer: 5 ' GAGTTAGGGGCGGGATCGCCGCTACAGGGCG3 ' and 5 ' GGAGGCCTAGGCTTTTGCAGGAAAGAACATGTGAG 3 ' carry out pcr amplification, obtain fragment E;
9) fragment E and fragment F are imported in the competent escherichia coli cell, fragment E is connected with fragment F, obtain recombinant vectors III by homologous recombination;
10) be the following primer of template with recombinant vectors III: 5 '
CAATAATCAATGTCAACGCCTAGGCTTTTGCAGGA 3 ' and 5 '
GGTGGGCTCTATGGCTTCCCTCCAAAAAAGCCTCCTC3 ' carries out pcr amplification, obtains fragment H;
11) be template with PCDNA3.0, use following primer: 5 ' GAGGAGGCTTTTTTGGAGG
GAAGCCATAGAGCCCACC3 ' and 5 ' TCCTGCAAAAGCCTAGGCGTTGACATTGATTATTG3 ' carry out pcr amplification, obtain fragment G;
12) fragment G and fragment H are imported in the competent escherichia coli cell, fragment G is connected with fragment H, obtain recombinant vectors IV by homologous recombination;
13) be template with recombinant vectors IV, as follows with primer:
5 ' AAAGC
AGGCCTTGTTTCTACTCTCGAGCATGCATCT 3 ' and 5 '
AACA
AGGCCTGCTTTCGCTGATATCTGCAGAATTC carries out pcr amplification, obtains fragment I;
14) fragment I is imported in the competent escherichia coli cell, obtain described carrier by homologous recombination.
PDP-EX-vector of the present invention contains two exogenous gene expression boxes, each expression cassette can both expressing protein, can select one of them expression cassette to make up recombinant expression vector, also can use two expression cassettes to make up recombinant expression vectors simultaneously, the foreign gene in two expression cassettes can be the same or different.
Be the carrier that sets out with pDP-EX-vector of the present invention, utilize the recombinant vectors of homologous recombination construction expression alien gene, avoided traditional enzyme to cut, links such as connection, do not use any restriction endonuclease and ligase enzyme in the whole building process, and omitted 2-3 step than traditional connection procedure, the efficient of connection is also more satisfactory.Use the process of recombinant vectors of pDP-EX-vector construction expression foreign gene of the present invention easy, quick, economical, efficient, can finish the structure of a large amount of expression of exogenous gene carriers fast.PDP-EX-vector of the present invention contains two exogenous gene expression boxes, two eucaryon replication orgin, can rise in value in a large number in expressing the antigenic cell of T, thereby the level of raising protein expression has good application prospects.
Description of drawings
Fig. 1 is the structural representation of pDP-EX-vector.
Fig. 2 observes the expression of results of fluorescin down for fluorescent microscope.
Embodiment
Among the following embodiment if no special instructions method therefor be ordinary method, agents useful for same all can obtain from commercial channels.
The structure of embodiment 1, pDP-EX-vector
1) structure of recombinant vectors I
Design primer recombinant vectors I (1) upstream and recombinant vectors I (1) downstream, recombinant vectors I (2) upstream and recombinant vectors I (2) downstream, the sequence of primer is as follows:
Recombinant vectors I (1) upstream: 5 ' ACATGTTCTTTCCTGCGCCGCTACAGGG 3 ';
Recombinant vectors I (1) downstream: 5 ' GAATTCTGCAGATATCCTCGAGCATGCATCTAG 3 '.
Recombinant vectors I (2) upstream: 5 ' CTCGAGGATATCTGCA
GATATCCAGCACAC 3 ' (the line part is an EcoR V enzyme recognition site);
Recombinant vectors I (2) downstream: 5 ' CCCTGTAGCGGCGCAGGAAAGAACATGT 3 '.
With pEGFP-N1 (Invitrogen) plasmid is template, with primer recombinant vectors I (1) upstream and recombinant vectors I (1) downstream PCR amplified fragments A, with the pCDNA3.0 plasmid is template, with primer recombinant vectors I (2) upstream and recombinant vectors I (2) downstream PCR amplified fragments B.
PCR reaction system: 10 * PCR Buffer, 5 μ L, upstream, each 1 μ L of downstream primer, dna profiling 1 μ L, MgCl
2(25mM) 3 μ L, dNTPs (each 2.5mM) 3 μ L, Pfu-Taq (5U/ μ L) 0.5 μ L, last moisturizing to 50 μ L.
Reaction conditions: 94 ℃ of thermally denature 5min; 94 ℃ of sex change 45s, 53 ℃ of annealing 45s, 72 ℃ are extended 6min, totally 30 circulations; 72 ℃ of last 10min that extend.
The PCR product reclaims test kit with DNA and reclaims, and method is with reference to its specification sheets.
Mixing behind adding Segment A and the B in the 50 μ L competent cells, Segment A and B mass ratio are 100ng:500ng.System ice bath 30min behind the mixing.3min is placed in 42 ℃ of water-bath heat shocks 90 seconds then on ice, adds the LB substratum 900 μ L of preheating, place under 37 ℃, 180rpm jolting 90min collects thalline, with the resuspended thalline of LB liquid nutrient medium, get on the resuspended liquid coating of the 200 μ l LB plate (containing penbritin), cultivate 12h for 37 ℃.The picking mono-clonal extracts plasmid, and this plasmid is recombinant vectors I.
2) structure of recombinant vectors II
Design primer SV40 (1) upstream and SV40 (1) downstream, recombinant vectors II upstream and recombinant vectors II downstream, primer SV40 (1) upstream and SV40 (1) downstream, recombinant vectors II upstream and recombinant vectors II downstream sequence are as follows:
SV40 (1) upstream: 5 ' GTGCCACCTGACGTCCAAAAGCCTAGGCCTCC 3 ';
SV40 (1) downstream: 5 ' CTAGTCAATAATCAATGTATCCCGCCCCTAACTC 3 '.
Recombinant vectors II upstream: 5 ' GGAGGCCTAGGCTTTTGGACGTCAGGTGGCAC3 ';
Recombinant vectors II downstream: 5 ' GAGTTAGGGGCGGGATACATTGATTATTGACTAG 3 '.
With the pEGFP-N1 plasmid is template, with primer SV40 (1) upstream and SV40 (1) downstream PCR amplified fragments C; With recombinant vectors I plasmid is template, with primer recombinant vectors II upstream and recombinant vectors II downstream PCR amplified fragments D.
PCR reaction system: 10 * PCR Buffer, 5 μ L, upstream, each 1 μ L of downstream primer, dna profiling 1 μ L, MgCl
2(25mM) 3 μ L, dNTPs (each 2.5mM) 3 μ L, Pfu-Taq (5U/ μ L) 0.5 μ L, last moisturizing to 50 μ L.
Reaction conditions: 94 ℃ of thermally denature 5min; 94 ℃ of sex change 45s, 53 ℃ of annealing 45s, 72 ℃ are extended 6min, totally 30 circulations; 72 ℃ of last 10min that extend.
The PCR product reclaims test kit with DNA and reclaims, and method is with reference to its specification sheets.
Mixing behind adding fragment C and the D in the 50 μ l competent cells, fragment C and D mass ratio are 100ng: 500ng.System ice bath 30min behind the mixing.3min is placed in 42 ℃ of water-bath heat shocks 90 seconds then on ice, adds the LB substratum 900 μ L of preheating, place under 37 ℃, 180rpm jolting 90min collects thalline, with the resuspended thalline of LB liquid nutrient medium, get on the resuspended liquid coating of the 200 μ l LB plate (containing penbritin), cultivate 12h for 37 ℃.The picking mono-clonal extracts plasmid, this plasmid called after recombinant vectors II.
3) structure of recombinant vectors III
Design primer SV40 (2) upstream and SV40 (2) downstream, recombinant vectors III upstream and recombinant vectors III downstream, primer SV40 (2) upstream and SV40 (2) downstream, recombinant vectors III upstream and recombinant vectors III downstream sequence are as follows:
SV40 (2) upstream: 5 ' CGCCCTGTAGCGGCGATCCCGCCCCTAACTC3 ';
SV40 (2) downstream: 5 ' CTCACATGTTCTTTCCTGCAAAAGCCTAGGCCTCC3 '.
Recombinant vectors III upstream: 5 ' GAGTTAGGGGCGGGATCGCCGCTACAGGGCG3 ';
Recombinant vectors III downstream: 5 ' GGAGGCCTAGGCTTTTGCAGGAAAGAACATGTGAG3 '.
With the pEGFP-N1 plasmid is template, with primer SV40 (2) upstream and SV40 (2) downstream PCR amplified fragments F; With recombinant vectors II plasmid is template, with primer recombinant vectors III upstream and recombinant vectors III downstream PCR amplified fragments E.
PCR reaction system: 10 * PCR Buffer, 5 μ L, upstream, each 1 μ L of downstream primer, dna profiling 1 μ L, MgCl
2(25mM) 3 μ L, dNTPs (each 2.5mM) 3 μ L, Pfu-Taq (5U/ μ L) 0.5 μ L, last moisturizing to 50 μ L.
Reaction conditions: 94 ℃ of thermally denature 5min; 94 ℃ of sex change 45s, 53 ℃ of annealing 45s, 72 ℃ are extended 6min, totally 30 circulations; 72 ℃ of last 10min that extend.
The PCR product reclaims test kit with DNA and reclaims, and method is with reference to its specification sheets.
Mixing behind adding fragment E and the F in the 50 μ l competent cells, fragment E and F mass ratio are 100ng: 500ng.System ice bath 30min behind the mixing.3min is placed in 42 ℃ of water-bath heat shocks 90 seconds then on ice, adds the LB substratum 900 μ l of preheating, place under 37 ℃, 180rpm jolting 90min collects thalline, with the resuspended thalline of LB liquid nutrient medium, get on the resuspended liquid coating of the 200 μ l LB plate (containing penbritin), cultivate 12h for 37 ℃.The picking mono-clonal extracts plasmid, and this carrier is recombinant vectors III
4) structure of recombinant vectors IV
Design primer pCDNA upstream and pCDNA downstream, recombinant vectors IV upstream and recombinant vectors IV downstream, primer sequence is as follows:
PCDNA upstream: 5 ' GAGGAGGCTTTTTTGGAGGGAAGCCATAGAGCCCACC 3 ';
PCDNA downstream: 5 ' TCCTGCAAAAGCCTAGGCGTTGACATTGATTATTG 3 '.
Recombinant vectors IV upstream: 5 ' CAATAATCAATGTCAACGCCTAGGCTTTTGCAGGA3 ';
Recombinant vectors IV downstream: 5 ' GGTGGGCTCTATGGCTTCCCTCCAAAAAAGCCTCCTC 3 '.
With the PCDNA3.0 plasmid is template, with primer pCDNA upstream and pCDNA downstream PCR amplified fragments G; With recombinant vectors III plasmid is template, with primer recombinant vectors IV upstream and recombinant vectors IV downstream PCR amplified fragments H.
PCR reaction system: 10 * PCR Buffer, 5 μ L, upstream, each 1 μ L of downstream primer, dna profiling 1 μ L, MgCl
2(25mM) 3 μ L, dNTPs (each 2.5mM) 3 μ L, Pfu-Taq (5U/ μ L) 0.5 μ L, last moisturizing to 50 μ L.
Reaction conditions: 94 ℃ of thermally denature 5min; 94 ℃ of sex change 45s, 53 ℃ of annealing 45s, 72 ℃ are extended 6min, totally 30 circulations; 72 ℃ of last 10min that extend.
The PCR product reclaims test kit with DNA and reclaims, and method is with reference to its specification sheets.
Mixing behind adding fragment G and the H in the 50 μ l competent cells, fragment G and H mass ratio are 100ng: 500ng.System ice bath 30min behind the mixing.3min is placed in 42 ℃ of water-bath heat shocks 90 seconds then on ice, adds the LB substratum 900 μ l of preheating, place under 37 ℃, 180rpm jolting 90min collects thalline, with the resuspended thalline of LB liquid nutrient medium, get on the resuspended liquid coating of the 200 μ l LB plate (containing penbritin), cultivate 12h for 37 ℃.The picking mono-clonal extracts plasmid, and this carrier is recombinant vectors IV
5) structure of pDP-EX-vector
Design primer pDP-EX-vector upstream and pDP-EX-vecto downstream, primer sequence is as follows:
PDP-EX-vector upstream: AAAGC
AGGCCTTGTTTCTACTCTCGAGCATGCATCT;
PDP-EX-vector downstream: AACA
AGGCCTGCTTTCGCTGATATCTGCAGAATTC.
With recombinant vectors IV plasmid is template, with primer pDP-EX-vector upstream and pDP-EX-vector downstream PCR amplified fragments I.
PCR reaction system: 10 * PCR Buffer, 5 μ L, upstream, each 1 μ L of downstream primer, dna profiling 1 μ L, MgCl
2(25mM) 3 μ L, dNTPs (each 2.5mM) 3 μ L, Pfu-Taq (5U/ μ L) 0.5 μ L, last moisturizing to 50 μ L.
Reaction conditions: 94 ℃ of thermally denature 5min; 94 ℃ of sex change 45s, 53 ℃ of annealing 45s, 72 ℃ are extended 6min, totally 30 circulations; 72 ℃ of last 10min that extend.
The PCR product reclaims test kit with DNA and reclaims, and method is with reference to its specification sheets.
Mixing behind the adding fragment I in the 50 μ l competent cells.System ice bath 30min behind the mixing.3min is placed in 42 ℃ of water-bath heat shocks 90 seconds then on ice, adds the LB substratum 900 μ l of preheating, place under 37 ℃, 180rpm jolting 90min collects thalline, with the resuspended thalline of LB liquid nutrient medium, get on the resuspended liquid coating of the 200 μ l LB plate (containing penbritin), cultivate 12h for 37 ℃.The picking mono-clonal extracts plasmid, and this carrier is pDP-EX-vector, and the pDP-EX-vector collection of illustrative plates as shown in Figure 1.
PDP-EX-vector is checked order, sequencing result shows, the nucleotide sequence of pDP-EX-vector such as the sequence in the sequence table 1, sequence 1 is the CMV promotor from 5 ' terminal 1-629 position, from 5 ' terminal 630-648 position is the T7 promotor, from 5 ' terminal 713-718 position is the recognition sequence of EcoR V enzyme, from 5 ' terminal 719-1071 position is BGH Ploy A, from 5 ' terminal 1072-1223 position is SV40 Origin, from 5 ' terminal 1224-1515 is BGH Ploy A, from 5 ' terminal 1516-1521 position is the StuI restriction enzyme site, from 5 ' terminal 1522-1539 position is the T7 promotor, from 5 ' terminal 1540-2261 is the CMV promotor, from 5 ' terminal 2262-2880 position is COIE1 Origin, is ampicillin resistance gene from 5 ' terminal 2881-4071 position, is SV40 Origin from 5 ' terminal 4072-4239 position.Sequence 1 from 5 ' nucleotide sequence of end 700-715 position and the nucleotides sequence from 5 ' end 716-730 position of sequence 1 classify as can with the sequence of pcr amplification product generation homologous sequence reorganization on the foreign gene.Sequence 1 from 5 ' end 1504-1519 and sequence 1 from 5 ' end 1520-1534 can with the sequence of pcr amplification product generation homologous sequence reorganization on the foreign gene.
The ability of embodiment 2, pDP-EX-vector expressing protein
1) structure of the pDP-EX-EGFP1 of expressing green fluorescent protein
Design primer EGFP (1) upstream and EGFP (1) downstream, primer EGFP (1) upstream and EGFP (1) downstream sequence are as follows:
EGFP (1) upstream: GGAATTCTGCAGAT TCGCCACCATGGTGAG;
EGFP (1) downstream: ATGCATGCTCGAGGAT TTACTTGTACAGCTCG.
In the primer GGAATTCTGCAGAT and ATGCATGCTCGAGGAT sequence be can with sequence 1 from 5 ' sequence from the nucleotide sequence generation homologous recombination of 5 ' end 716-730 position of the nucleotide sequence of end 700-715 position and sequence 1.
With the pEGFP-N1 plasmid is template, with primer EGFP (1) upstream and EGFP (1) downstream PCR amplification EGFP1 gene fragment.
Reaction system: 10 * PCR Buffer, 5 μ L, upstream, each 1 μ L of downstream primer, dna profiling 1 μ L, MgCl
2(25mM) 3 μ L, dNTPs (each 2.5mM) 3 μ L, Pfu-Taq (5U/ μ L) 0.5 μ L, last moisturizing to 50 μ L.
Reaction conditions: 94 ℃ of thermally denature 5min; 94 ℃ of sex change 45s, 50 ℃ of annealing 45s, 72 ℃ are extended 1min, totally 30 circulations; 72 ℃ of last 10min that extend.
The PCR product reclaims test kit with DNA and reclaims, and method is with reference to its specification sheets.
PDP-EX-vector reclaims linearizing pDP-EX-vector with the linearizing of EcorV endonuclease digestion.
It is as follows that enzyme is cut system:
10 * D buffer10 μ l, BSA 1 μ l, EcoR V 2 μ l (20U PROMEGA company), pDP-EX-vector50 μ l, moisturizing to 100 μ l, 37 ℃ of enzymes are cut and are spent the night.
Enzyme is cut product electrophoresis in the sepharose of 1 * TAE preparation, 120v, and electrophoresis 30 minutes, DNA reclaims test kit and reclaims the purpose fragment.
Mixing after linearizing pDP-EX-vector of adding and the EGFP1 gene fragment in the 50 μ L competent cells, linearizing pDP-EX-vector and EGFP1 gene fragment mass ratio are 100ng: 500ng.System ice bath 30min behind the mixing.3min is placed in 42 ℃ of water-bath heat shocks 90 seconds then on ice, adds the LB substratum 900 μ l of preheating, place under 37 ℃, 180rpm jolting 90min collects thalline, with the resuspended thalline of LB liquid nutrient medium, get on the resuspended liquid coating of the 200 μ l LB plate (containing penbritin), cultivate 12h for 37 ℃.The picking mono-clonal extracts plasmid, called after pDP-EX-EGFP1.
2) structure of the pDP-EX-2EGFP of expressing green fluorescent protein
Design primer EGFP (2) upstream and EGFP (2) downstream, primer EGFP (2) upstream and EGFP (2) downstream sequence are as follows:
EGFP (2) upstream: TGAGTAGAAACAAGG TCGCCACCATGGTGAG;
EGFP (2) downstream: GAGAGCGAAAGCAGG TTACTTGTACAGCTCG.
In the primer TGAGTAGAAACAAGG and GAGAGCGAAAGCAGG sequence be can with sequence 1 from 5 ' sequence from the nucleotide sequence generation homologous recombination of 5 ' end 1520-1534 position of the nucleotide sequence of end 1504-1519 position and sequence 1.
With the pEGFP-N1 plasmid is template, with primer EGFP (2) upstream and EGFP (2) downstream PCR amplification EGFP2 gene fragment.
Reaction system: 10 * PCR Buffer, 5 μ L, upstream, each 1 μ L of downstream primer, dna profiling 1 μ L, MgCl
2(25mM) 3 μ L, dNTPs (each 2.5mM) 3 μ L, Pfu-Taq (5U/ μ L) 0.5 μ L, last moisturizing to 50 μ L.
Reaction conditions: 94 ℃ of thermally denature 5min; 94 ℃ of sex change 45s, 50 ℃ of annealing 45s, 72 ℃ are extended 1min, totally 30 circulations; 72 ℃ of last 10min that extend.
The PCR product reclaims test kit with DNA and reclaims, and method is with reference to its specification sheets.
PDP-EX-EGFP reclaims linearizing pDP-EX-EGFP with the linearizing of StuI endonuclease digestion.
It is as follows that enzyme is cut system:
10 * D buffer10 μ l, BSA 1 μ l, StuI 2 μ l (20U PROMEGA company), pDP-EX-vector50 μ l, moisturizing to 100 μ l, 37 ℃ of enzymes are cut and are spent the night.
Enzyme is cut product electrophoresis in the sepharose of 1 * TAE preparation, 120v, and electrophoresis 30 minutes, DNA reclaims test kit and reclaims the purpose fragment.
Mixing after linearizing pDP-EX-EGFP of adding and the EGFP2 gene fragment in the 50 μ l competent cells, linearizing pDP-EX-EGFP and EGFP2 gene fragment mass ratio are 100ng: 500ng.System ice bath 30min behind the mixing.3min is placed in 42 ℃ of water-bath heat shocks 90 seconds then on ice, adds the LB substratum 900 μ l of preheating, place under 37 ℃, 180rpm jolting 90min collects thalline, with the resuspended thalline of LB liquid nutrient medium, get on the resuspended liquid coating of the 200 μ l LB plate (containing penbritin), cultivate 12h for 37 ℃.The picking mono-clonal extracts plasmid, called after pDP-EX-2EGFP.
3) green fluorescent protein detection
Get in the OPTI-MEMI substratum (Invitrogen company) that 10ul lipofectamine 2000 (Invitrogen company) joins 250ul, room temperature was placed 5 minutes, obtained solution 1; With 5ug pDP-EX-EGFP1, the pDP-EX-2EGFP plasmid joins respectively in the OPTI-MEMI substratum of 250ul, obtains solution 2 and solution 3; Solution 1 and 2 is mixed, and incubated at room 20 minutes adds the OPTI-MEMI substratum of 500ul again, obtains solution 4; Solution 1 and 3 is mixed, and incubated at room 20 minutes adds the OPTI-MEMI substratum of 500ul again, obtains solution 5.
Place 6 porocyte plates to cultivate in the 293T cell, wait for that cell grows at 60% o'clock with cell PBS washed twice, add solution 4 and solution 5 then respectively, hatched 5 hours for 37 ℃, sucking-off solution 4 and solution 5 add fresh OPTI-MEMI substratum respectively, continue to cultivate.After cultivating 24h, under fluorescent microscope, observe the expression of fluorescin.
With the 293T cell of pEGFP-N1 plasmid transfection as positive control, with the 293T cell of transfection pDP-EX-vector as negative control.
The fluorescent microscope result as shown in Figure 2, after the pDP-EX-EGFP1 transfection 24 hours the 293T cell (Fig. 2 C) fluorescent signal is arranged, after the pDP-EX-2EGFP transfection fluorescent signal of 24 hours 293T cells than pDP-EX-EGFP1 transfection after the fluorescent signal strong (Fig. 2 C) of 24 hours 293T cells, positive control also has fluorescence (Fig. 2 B) to occur, and negative control (Fig. 2 A) does not have fluorescence.
Above-mentioned experimental result explanation with the recombinant expression vector of pDP-EX-vector as the vector construction that sets out, has good protein expression ability.
Sequence table
＜110〉China Agricultural University
＜120〉expression vector of two expression cassettes and preparation method thereof and application
<130>CGGNARW92031
<160>1
<210>1
<211>4239
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>1
acattgatta?ttgactagtt?attaatagta?atcaattacg?gggtcattag?ttcatagccc 60
atatatggag?ttccgcgtta?cataacttac?ggtaaatggc?ccgcctggct?gaccgcccaa 120
cgacccccgc?ccattgacgt?caataatgac?gtatgttccc?atagtaacgc?caatagggac 180
tttccattga?cgtcaatggg?tggactattt?acggtaaact?gcccacttgg?cagtacatca 240
agtgtatcat?atgccaagta?cgccccctat?tgacgtcaat?gacggtaaat?ggcccgcctg 300
gcattatgcc?cagtacatga?ccttatggga?ctttcctact?tggcagtaca?tctacgtatt 360
agtcatcgct?attaccatgg?tgatgcggtt?ttggcagtac?atcaatgggc?gtggatagcg 420
gtttgactca?cggggatttc?caagtctcca?ccccattgac?gtcaatggga?gtttgttttg 480
gcaccaaaat?caacgggact?ttccaaaatg?tcgtaacaac?tccgccccat?tgacgcaaat 540
gggcggtagg?cgtgtacggt?gggaggtcta?tataagcaga?gctctctggc?taactagaga 600
acccactgct?tactggctta?tcgaaattaa?tacgactcac?tatagggaga?cccaagcttg 660
gtaccgagct?cggatccact?agtaacggcc?gccagtgtgc?tggaattctg?cagatatcct 720
cgagcatgca?tctagagggc?cctattctat?agtgtcacct?aaatgctaga?gctcgctgat 780
cagcctcgac?tgtgccttct?agttgccagc?catctgttgt?ttgcccctcc?cccgtgcctt 840
ccttgaccct?ggaaggtgcc?actcccactg?tcctttccta?ataaaatgag?gaaattgcat 900
cgcattgtct?gagtaggtgt?cattctattc?tggggggtgg?ggtggggcag?gacagcaagg 960
gggaggattg?ggaagacaat?agcaggcatg?ctggggatgc?ggtgggctct?atggcttctg 1020
aggcggaaag?aaccagctgg?ggctctaggg?ggtatcccca?cgcgccctgt?agcggcgatc 1080
ccgcccctaa?ctccgcccag?ttccgcccat?tctccgcccc?atggctgact?aatttttttt 1140
atttatgcag?aggccgaggc?cgcctcggcc?tctgagctat?tccagaagta?gtgaggaggc 1200
ttttttggag?ggaagccata?gagcccaccg?catccccagc?atgcctgcta?ttgtcttccc 1260
aatcctcccc?cttgctgtcc?tgccccaccc?caccccccag?aatagaatga?cacctactca 1320
gacaatgcga?tgcaatttcc?tcattttatt?aggaaaggac?agtgggagtg?gcaccttcca 1380
gggtcaagga?aggcacgggg?gaggggcaaa?caacagatgg?ctggcaacta?gaaggcacag 1440
tcgaggctga?tcagcgagct?ctagcattta?ggtgacacta?tagaataggg?ccctctagat 1500
gcatgagtag?aaacaaggcc?tgctttcgct?ctcgagggat?atctgcagaa?ttccagcaca 1560
ctggcggccg?ttactagtgg?atccgagctc?ggtaccaagc?ttgggtctcc?ctatagtgag 1620
tcgtattaat?ttcgataagc?cagtaagcag?tgggttctct?agttagccag?agagctctgc 1680
ttatatagac?ctcccaccgt?acacgcctac?cgcccatttg?cgtcaatggg?gcggagttgt 1740
tacgacattt?tggaaagtcc?cgttgatttt?ggtgccaaaa?caaactccca?ttgacgtcaa 1800
tggggtggag?acttggaaat?ccccgtgagt?caaaccgcta?tccacgccca?ttgatgtact 1860
gccaaaaccg?catcaccatg?gtaatagcga?tgactaatac?gtagatgtac?tgccaagtag 1920
gaaagtccca?taaggtcatg?tactgggcat?aatgccaggc?gggccattta?ccgtcattga 1980
cgtcaatagg?gggcgtactt?ggcatatgat?acacttgatg?tactgccaag?tgggcagttt 2040
accgtaaata?gtccacccat?tgacgtcaat?ggaaagtccc?tattggcgtt?actatgggaa 2100
catacgtcat?tattgacgtc?aatgggcggg?ggtcgttggg?cggtcagcca?ggcgggccat 2160
ttaccgtaag?ttatgtaacg?cggaactcca?tatatgggct?atgaactaat?gaccccgtaa 2220
ttgattacta?ttaataacta?gtcaataatc?aatgtcaacg?cctaggcttt?tgcaggaaag 2280
aacatgtgag?caaaaggcca?gcaaaaggcc?aggaaccgta?aaaaggccgc?gttgctggcg 2340
tttttccata?ggctccgccc?ccctgacgag?catcacaaaa?atcgacgctc?aagtcagagg 2400
tggcgaaacc?cgacaggact?ataaagatac?caggcgtttc?cccctggaag?ctccctcgtg 2460
cgctctcctg?ttccgaccct?gccgcttacc?ggatacctgt?ccgcctttct?cccttcggga 2520
agcgtggcgc?tttctcaatg?ctcacgctgt?aggtatctca?gttcggtgta?ggtcgttcgc 2580
tccaagctgg?gctgtgtgca?cgaacccccc?gttcagcccg?accgctgcgc?cttatccggt 2640
aactatcgtc?ttgagtccaa?cccggtaaga?cacgacttat?cgccactggc?agcagccact 2700
ggtaacagga?ttagcagagc?gaggtatgta?ggcggtgcta?cagagttctt?gaagtggtgg 2760
cctaactacg?gctacactag?aaggacagta?tttggtatct?gcgctctgct?gaagccagtt 2820
accttcggaa?aaagagttgg?tagctcttga?tccggcaaac?aaaccaccgc?tggtagcggt 2880
ggtttttttg?tttgcaagca?gcagattacg?cgcagaaaaa?aaggatctca?agaagatcct 2940
ttgatctttt?ctacggggtc?tgacgctcag?tggaacgaaa?actcacgtta?agggattttg 3000
gtcatgagat?tatcaaaaag?gatcttcacc?tagatccttt?taaattaaaa?atgaagtttt 3060
aaatcaatct?aaagtatata?tgagtaaact?tggtctgaca?gttaccaatg?cttaatcagt 3120
gaggcaccta?tctcagcgat?ctgtctattt?cgttcatcca?tagttgcctg?actccccgtc 3180
gtgtagataa?ctacgatacg?ggagggctta?ccatctggcc?ccagtgctgc?aatgataccg 3240
cgagacccac?gctcaccggc?tccagattta?tcagcaataa?accagccagc?cggaagggcc 3300
gagcgcagaa?gtggtcctgc?aactttatcc?gcctccatcc?agtctattaa?ttgttgccgg 3360
gaagctagag?taagtagttc?gccagttaat?agtttgcgca?acgttgttgc?cattgctaca 3420
ggcatcgtgg?tgtcacgctc?gtcgtttggt?atggcttcat?tcagctccgg?ttcccaacga 3480
tcaaggcgag?ttacatgatc?ccccatgttg?tgcaaaaaag?cggttagctc?cttcggtcct 3540
ccgatcgttg?tcagaagtaa?gttggccgca?gtgttatcac?tcatggttat?ggcagcactg 3600
cataattctc?ttactgtcat?gccatccgta?agatgctttt?ctgtgactgg?tgagtactca 3660
accaagtcat?tctgagaata?gtgtatgcgg?cgaccgagtt?gctcttgccc?ggcgtcaata 3720
cgggataata?ccgcgccaca?tagcagaact?ttaaaagtgc?tcatcattgg?aaaacgttct 3780
tcggggcgaa?aactctcaag?gatcttaccg?ctgttgagat?ccagttcgat?gtaacccact 3840
cgtgcaccca?actgatcttc?agcatctttt?actttcacca?gcgtttctgg?gtgagcaaaa 3900
acaggaaggc?aaaatgccgc?aaaaaaggga?ataagggcga?cacggaaatg?ttgaatactc 3960
atactcttcc?tttttcaata?ttattgaagc?atttatcagg?gttattgtct?catgagcgga 4020
tacatatttg?aatgtattta?gaaaaataaa?caaatagggg?ttccgcgcac?atttccccga 4080
aaagtgccac?ctgacgtcca?aaagcctagg?cctccaaaaa?agcctcctca?ctacttctgg 4140
aatagctcag?aggccgaggc?ggcctcggcc?tctgcataaa?taaaaaaaat?tagtcagcca 4200
tggggcggag?aatgggcgga?actgggcgga?gttaggggc 4239
Claims (3)
1. circular vectors, its nucleotides sequence is classified the sequence 1 in the sequence table as.
2. the carrier of a linearity is to cut the linear carrier that the described carrier of claim 1 obtains with EcoRV or StuI enzyme.
3. the described construction of carrier of claim 1 comprises the steps:
1) be template with the pEGFP-N1 plasmid, use following primer: 5 ' ACATGTTCTTTCCTGCGCCGCTACAGGG3 ' and 5 ' GAATTCTGCAGATATCCTCGAGCATGCATCTAG 3 ' carry out pcr amplification, obtain Segment A;
2) be template with the pCDNA3.0 plasmid, use following primer: 5 ' CTCGAGGATATCTGCA
GATATCCAGCACAC3 ' and 5 ' CCCTGTAGCGGCGCAGGAAAGAACATGT 3 ' carry out pcr amplification, obtain fragment B;
3) Segment A and fragment B are imported in the competent escherichia coli cell, Segment A is connected with fragment B, obtain recombinant vectors I by homologous recombination;
4) be template with recombinant vectors I, use following primer: 5 ' GGAGGCCTAGGCTTTTGGACGTCAGGTGGCAC 3 ' and 5 ' GAGTTAGGGGCGGGATACATTGATTATTGACTAG 3 ' carry out pcr amplification, obtain fragment D;
5) be template with the pEGFP-N1 plasmid, use following primer:
5 ' GTGCCACCTGACGTCCAAAAGCCTAGGCCTCC 3 ' or 5 '
CTAGTCAATAATCAATGTATCCCGCCCCTAACTC 3 ' carries out pcr amplification, obtains fragment C;
6) fragment C and fragment D are imported in the competent escherichia coli cell, fragment C is connected with fragment D, obtain recombinant vectors II by homologous recombination;
7) be template with the pEGFP-N1 plasmid, use following primer: 5 ' CGCCCTGTAGCGGCGATCCCGCCCCTAACTC3 ' and 5 ' CTCACATGTTCTTTCCTGCAAAAGCCTAGGCCTCC 3 ' carry out pcr amplification, obtain fragment F;
8) be template with recombinant vectors II, use following primer: 5 ' GAGTTAGGGGCGGGATCGCCGCTACAGGGCG3 ' and 5 ' GGAGGCCTAGGCTTTTGCAGGAAAGAACATGTGAG 3 ' carry out pcr amplification, obtain fragment E;
9) fragment E and fragment F are imported in the competent escherichia coli cell, fragment E is connected with fragment F, obtain recombinant vectors III by homologous recombination;
10) be the following primer of template with recombinant vectors III: 5 ' CAATAATCAATGTCAACGCCTAGGCTTTTGCAGGA3 ' and 5 ' GGTGGGCTCTATGGCTTCCCTCCAAAAAAGCCTCCTC 3 ' carry out pcr amplification, obtain fragment H;
11) be template with PCDNA3.0, use following primer: 5 ' GAGGAGGCTTTTTTGGAGGGAAGCCATAGAGCCCACC 3 ' and 5 ' TCCTGCAAAAGCCTAGGCGTTGACATTGATTATTG3 ' carry out pcr amplification, obtain fragment G;
12) fragment G and fragment H are imported in the competent escherichia coli cell, fragment G is connected with fragment H, obtain recombinant vectors IV by homologous recombination;
13) be template with recombinant vectors IV, as follows with primer:
5 ' AAAGC
AGGCCTTGTTTCTACTCTCGAGCATGCATCT 3 ' and 5 '
AACA
AGGCCTGCTTTCGCTGATATCTGCAGAATTC carries out pcr amplification, obtains fragment I;
14) fragment I is imported in the competent escherichia coli cell, obtain the described carrier of claim 1 by homologous recombination.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100763810A CN101463361B (en) | 2009-01-14 | 2009-01-14 | Expression vector of double expression boxes, as well as preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100763810A CN101463361B (en) | 2009-01-14 | 2009-01-14 | Expression vector of double expression boxes, as well as preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101463361A CN101463361A (en) | 2009-06-24 |
| CN101463361B true CN101463361B (en) | 2011-07-20 |
Family
ID=40804152
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100763810A Expired - Fee Related CN101463361B (en) | 2009-01-14 | 2009-01-14 | Expression vector of double expression boxes, as well as preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101463361B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104131021A (en) * | 2014-08-01 | 2014-11-05 | 中国农业科学院兰州兽医研究所 | Antibacterial peptide coexpression vector, construction and expression method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1427079A (en) * | 2002-09-30 | 2003-07-02 | 华南农业大学 | Construction method of multigene carrier and its application |
| WO2006077101A3 (en) * | 2005-01-18 | 2006-09-28 | Abbott Gmbh & Co Kg | Ager-peptides and use thereof |
-
2009
- 2009-01-14 CN CN2009100763810A patent/CN101463361B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1427079A (en) * | 2002-09-30 | 2003-07-02 | 华南农业大学 | Construction method of multigene carrier and its application |
| WO2006077101A3 (en) * | 2005-01-18 | 2006-09-28 | Abbott Gmbh & Co Kg | Ager-peptides and use thereof |
Non-Patent Citations (1)
| Title |
|---|
| 张文峰 等.人TCA-12-2/TCB-7.1真核双表达载体的构建与表达.《中国病理生理杂志》.2008,第24卷(第3期),第527-531页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101463361A (en) | 2009-06-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103937836A (en) | Detection method of aquaporin-4 autoantibody, fusion expression virus vector and application thereof | |
| CN114736893B (en) | Method for realizing A/T to G/C editing on mitochondrial DNA | |
| CN103224955A (en) | Vector for efficiently labeling zebra fish PGC, and preparation method and use of transgenic fish | |
| CN110093277B (en) | Construction method and application of gene knock-out strain of Toxoplasma gondii adenylate succinate lyase | |
| CN108676848B (en) | Mixed gene, standard plasmid and kit for detecting fusion gene and preparation method thereof | |
| CN101463361B (en) | Expression vector of double expression boxes, as well as preparation method and application thereof | |
| CN101481703A (en) | Avian origin promoter expression vector, construction method and use thereof | |
| CA3009471A1 (en) | Methods and compositions of insect control | |
| CN102703474A (en) | New bunyavirus NP protein coding sequence and application thereof | |
| CN114874927B (en) | Yeast genetic engineering bacterium for high-yield recombinant protein, construction method and application thereof | |
| CN109468338A (en) | A kind of method of purpose pU6-sgRNA plasmid needed for rapid build caenorhabditis elegan gene editing | |
| CN101597622A (en) | The series miRNA or the shRNA expression vector of tumor-specific promoters regulation and control | |
| CN101659967B (en) | PiggyBac transposon vector for producing transgenic pig and construction method thereof | |
| CN112553098B (en) | Biological preparation method of caffeic acid | |
| CN106754756B (en) | Simplex forest virus replicon for rapidly marking nerve cells of non-human primate and application thereof | |
| CN114957448B (en) | Yeast strain for efficiently expressing alpha-lactalbumin, alpha-lactalbumin and application thereof | |
| CN108085371B (en) | Method for judging whether PCR result is false positive | |
| CN106754755B (en) | Simplicin forest virus replicon and application thereof in sparse or fine neuron marking | |
| CN111218475A (en) | System and method for rescuing measles Schwarz/Moraten vaccine strain | |
| CN114350657B (en) | Reverse complementary short flanking sequence for promoting generation of circular RNA and application thereof | |
| CN114149975B (en) | Cell model with specific HBV sequence inserted into specific gene region, construction method and application thereof | |
| CN113493855B (en) | Kit for detecting HBV cccDNA based on RAA-CRISPR-cas13a | |
| CN114959110A (en) | Kit for detecting hepatitis B virus pregenomic RNA based on PCR-CRISPR-Cas13a | |
| CN113736790B (en) | sgRNA (ribonucleic acid) for knocking out duck hnRNPA3 gene, cell line, construction method and application thereof | |
| KR101146335B1 (en) | TRANSGENIC MOUSE EXPRESSING REPORTER PROTEIN UNDER REGULATION OF α-FETOPROTEIN ENHANCER AND PROMOTER, METHOD FOR PREPARATION THEREOF AND METHOD FOR SCREENING COMPOUNDS INDUCING INCREASE OR DECREASE OF Α-FETOPROTEIN EXPRESSION USING THE SAME |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110720 Termination date: 20150114 |
|
| EXPY | Termination of patent right or utility model |