CN113881798B - Chloroplast genome hypervariable site and detection method and application thereof - Google Patents

Chloroplast genome hypervariable site and detection method and application thereof Download PDF

Info

Publication number
CN113881798B
CN113881798B CN202111185233.XA CN202111185233A CN113881798B CN 113881798 B CN113881798 B CN 113881798B CN 202111185233 A CN202111185233 A CN 202111185233A CN 113881798 B CN113881798 B CN 113881798B
Authority
CN
China
Prior art keywords
citrus
sequence
chloroplast genome
site
hypervariable
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111185233.XA
Other languages
Chinese (zh)
Other versions
CN113881798A (en
Inventor
洪棋斌
龚桂芝
杨程
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Southwest University
Original Assignee
Southwest University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Southwest University filed Critical Southwest University
Priority to CN202111185233.XA priority Critical patent/CN113881798B/en
Publication of CN113881798A publication Critical patent/CN113881798A/en
Application granted granted Critical
Publication of CN113881798B publication Critical patent/CN113881798B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to the technical field of biological information, and discloses a chloroplast genome hypervariable site, a detection method and application thereof, wherein the chloroplast genome hypervariable site is determined by a pair of primer sequences, and the nucleotide sequences of the primers are SEQ ID NO:1 and SEQ ID NO:2; the method for detecting the chloroplast genome hypervariable site comprises the following steps: synthesizing a primer; extracting genome total DNA of citrus materials to be analyzed, and carrying out PCR amplification to obtain a hypervariable site sequence; detecting the amplified product by electrophoresis, and recovering the target DNA fragment; adding tail of target DNA fragment to obtain recombinant T vector; transforming the recombinant T vector into escherichia coli competent cells; screening blue and white spots, picking white single colonies, culturing at constant temperature, and sequencing bacterial liquid. The invention can better judge the cytoplasmic sources of different citrus fruit trees by carrying out genome amplification, cloning, sequencing and comparison analysis on the sequence, thereby realizing the group differentiation of citrus fruit trees.

Description

Chloroplast genome hypervariable site and detection method and application thereof
Technical Field
The invention belongs to the technical field of biological information, and particularly relates to a chloroplast genome hypervariable site, and a detection method and application thereof.
Background
At present, citrus trees form rich species groups due to the effects of apomixis, easy hybridization among species, easy asexual variation, wide cultivation, long history and the like, and the genetic and evolutionary relationship among the multiple species groups are distinguished, so that even students who are subjected to citrus professional researches for a long time are very difficult to carry out, a plurality of citrus classification systems with obvious differences, such as a large classification method of W.T. Swingle in the United states, a small classification method of Sanlang in Japanese fields, and a classification method which is closely combined with gardening classification and is proposed by the domestic barely pioneer, are internationally developed. W.t.swing classifies citrus plants into true citrus groups, including 6, with citrus cultivation being the highest, and 16, 8 varieties. Citrus plants are classified into 4 genera by the chang Sanlang in the field, recognizing 145 species. Mr. has split citrus into 36 species of 5 subgenera 5.
The identification of clusters of citrus trees is generally based on morphological, biochemical and/or genetic material characteristics. The morphological characters are direct, simple and convenient, quick in aging, low in detection cost, low in resolution efficiency and accuracy, greatly influenced by environmental changes, easy to appear in different time places, limited in quantity and types of morphological indexes, difficult to develop in a large quantity for comprehensive, real and accurate test and analysis, and difficult to reflect the genetic differences truly and comprehensively. The characteristic difference of biochemical substances is large, whether bitter oil drops exist in fruits is a common index in traditional citrus classification, the method is simple, convenient and rapid, but the extraction and detection of naringin, citrinin and other components are difficult, the cost is high, the resolution efficiency and accuracy are low, and the method is also greatly influenced by environmental changes. The morphological characters and biochemical material indexes are all determined by inheritance at the end, the inheritance material basis is DNA and is basically not influenced by environmental changes, so that the genetic material indexes are more basic indexes, the accuracy and the resolution efficiency are higher, unambiguous results are easy to obtain, and the detection rapidity of the genetic material indexes is improved, the cost is reduced and the method has been applied more along with the rapid development of polymerase chain amplification technology, sequencing technology and the like.
For higher plants, the genetic material basis includes not only the complete nuclear genomic sequence, but also genomic sequences involving the cytoplasm of mitochondria and chloroplasts. In the sexual propagation process of the flowering plants, a great amount of genetic recombination can occur in the nuclear genome to generate a great amount of genetic variation, and the molecular markers developed for the nuclear genome can detect and track the genetic variation from the parent and the female parent, so that a plurality of development and application are available at present. The chloroplast genome has the characteristics of maternal inheritance, small relative molecular weight, slow evolution, high conservation in gene sequence and gene content and the like, has special value in the aspects of analysis of genetic evolution, high class group and cytoplasmic hybrid identification and the like, but other types of efficient markers are not available except for a small number of general cpSSR markers.
Plant chloroplast genome sequences are typically about 130-150 kb in length, much smaller than nuclear genomes, and complete genomes can be obtained relatively easily by assembly of second generation sequencing fragments, but the length is still difficult to analyze in detail, and chloroplasts of plant bodies are numerous, possibly differential chloroplast genomes, present heterozygosity, and are difficult to complete in a comprehensive analysis by simple assembly. At the same time, chloroplast genomes are relatively conserved, and in closely related species, most sequences of the genomes are very similar or even identical, and analysis of the genome does not contribute to individual identification or contributes only to a limited extent, for example, in 2017, the comparison of genome sequencing of chimpanzees and human genome shows that the DNA sequences of chimpanzees and human genome are 99% similar, and even if DNA sequence insertion or deletion is considered, the similarity of the two is 96%. Sequence difference sites contributing to group or individual difference are found, and then deep analysis is carried out on the sites, so that the interference of a large number of similar sequences is reduced, the research difficulty is greatly reduced, the cost and time for analysis and test are reduced, and the analysis, research and identification of more individuals and materials under different requirements are facilitated. Therefore, a new chloroplast genome hypervariable site and a detection method thereof are needed to fill the blank of the prior art.
Through the above analysis, the problems and defects existing in the prior art are as follows:
(1) In the existing method for identifying the clusters of citrus fruit trees, the morphological resolution efficiency and accuracy are low, the method is greatly influenced by environmental changes, the phenomena of homomorphism and foreign matter homomorphism are easy to occur at different time points, the quantity and the types of morphological indexes are limited, and the comprehensive, real and accurate test and analysis are difficult to develop in a large quantity, so that the genetic difference is difficult to reflect truly and comprehensively.
(2) The existing biochemical substances have large characteristic difference, the extraction and detection of naringin, nobiletin and other components are difficult and high in cost, the resolution efficiency and accuracy are low, and the environmental change is greatly influenced.
(3) In addition to the small number of universal cpSSR markers, other types of high efficiency markers are currently lacking in the existing chloroplast genome.
(4) The length of the existing plant chloroplast genome sequence is still difficult to analyze in detail, and chloroplasts of plant bodies are numerous, and chloroplast genomes possibly having differences are heterozygous, so that the complete analysis is difficult to complete through simple assembly.
(5) The existing chloroplast genome is relatively conservative, most sequences of the genome are very similar or even identical in species with similar relatedness, and analysis of the genome does not contribute or contributes to individual identification only to a limited extent.
The difficulty of solving the problems and the defects is as follows: the accurate acquisition of the morphological indexes requires arranging the evaluation materials in the same region and under the same management condition, and the technical personnel trained in the profession need to consume a large amount of manpower and material resources for management after at least 3 years of continuous observation, and the morphological indexes are limited in number and type, so that different samples are difficult to accurately distinguish. Genome sequencing assembly is a relatively accurate method, but at present, even if a least expensive second generation sequencing method is adopted, the complete chloroplast genome sequence of an individual of interest is assembled and compared and analyzed, the cost is at least hundreds of thousands of RMB, and due to the huge data obtained, the subsequent analysis is difficult for a general computer and an ordinary person.
The meaning of solving the problems and the defects is as follows: the gene sequence has uniqueness, can accurately obtain the gene sequence of the tested material through genome amplification, cloning, sequencing and comparison analysis, can better judge the cytoplasmic source of the tested material on the basis of the accurate gene sequence, and solves the difficult problems that the prior common molecular marking technology and second generation sequencing are difficult to overcome. Meanwhile, the current gene cloning and sequencing technology is mature, the early cloning and the later analysis can be carried out in a general laboratory, the intermediate sequencing can be selected by a plurality of commercial companies, the overall cost of a single sample is low, and the identification time is quick. The identification is accurate, the cost is low, the identification time is quick, and the technical difficulty is low, so that the method can be widely used for group differentiation of citrus fruit trees, citrus seedling identification and the like, and the recognition, development and utilization of citrus fruit trees are promoted.
Disclosure of Invention
Aiming at the problems existing in the prior art, the invention provides a chloroplast genome hypervariable site, a detection method and application thereof, and aims to solve the problems that the quantity and the type of morphological indexes are limited, the acquisition time period is long, and different samples are difficult to accurately distinguish due to the influence of environmental conditions; the genome of citrus chloroplast is directly obtained and analyzed, and the comparison research of more materials is carried out, so that the problems of high cost and great difficulty are solved.
The invention is realized in such a way that a chloroplast genome hypervariable site is determined by a pair of primer sequences, and the nucleotide sequences of the primers are SEQ ID NO:1 and SEQ ID NO:2.
another object of the present invention is to provide a method for amplifying and detecting a chloroplast genomic hypervariable site using the chloroplast genomic hypervariable site, the method for amplifying and detecting a chloroplast genomic hypervariable site comprising the steps of:
step one, synthesizing a primer for amplifying a chloroplast genome hypervariable site sequence;
extracting genome total DNA of citrus materials to be analyzed, and carrying out PCR amplification by using a DNA polymerase chain reaction to obtain a hypervariable site sequence;
step three, adding the amplified product into agarose gel holes for electrophoresis detection, and recovering target DNA fragments, wherein the sizes of the fragments are 100 bp-500 bp;
step four, adding the tail of the recovered target DNA fragment, and obtaining a recombinant T vector by adopting a cloning vector pGEM-T-easy; transforming E.coli DH5 alpha of competent cells of the E.coli by the recombinant T vector which is connected; screening blue and white spots, picking 5-6 white single colonies, shaking overnight with a LA liquid culture medium at a constant temperature of 37 ℃ for culture, and sending bacterial liquid to a sequencing company for sequencing.
Step 1 of the invention: a specific primer sequence is defined, and the primer enables amplification to be smoothly carried out according to set conditions, so that an amplification product with specific base composition and length is obtained.
Step 2: amplification conditions are specified in order to amplify specific sequences from the vast genome by primers.
Step 3: because the product length of the set primers in different citrus groups is within this range, setting the recovery fragment size ensures that the target fragment is obtained and also avoids interference from other non-target fragments.
Step 4: clone sequencing is a standard procedure for accurately obtaining the base composition of a target sequence, and ensures the consistency of sequencing data and the repeatability of results.
Further, the amplification detection method further comprises:
according to the upstream and downstream primers, intercepting sequencing data of the finishing sample, and comparing and analyzing the sequencing data with the provided sequence length of the chloroplast genome hypermutation site of the main citrus group or the corresponding sequence obtained from the reference sample of the SNP, SSR and Indel combination characteristic table, so as to realize identification of cytoplasmic sources, citrus groups and citrus seedlings of citrus.
Further, in the first step, the purity of the primer sequence is the purity of the acrylamide gel electrophoresis purification grade.
Further, in the second step, the PCR system is as follows: 1 XPCR Buffer,1.5 mmol.L -1 MgCl of (C) 2 ，0.2mmol·L -1 dNTPs of 0.33 nmol.L -1 1U of Taq DNA polymerase, 10ng of DNA template, and a total volume of 50. Mu.L.
Further, in the second step, the amplification procedure of the PCR is: denaturation at 94℃for 45s, annealing at 56℃for 45s, elongation at 72℃for 45s,24 cycles; extending at 72 ℃ for 5min; the PCR product was stored at 4℃for further use.
It is another object of the present invention to provide the use of said chloroplast genome hypervariable site in citrus cytosolic origin, citrus genetic evolution research, variety resource collection, citrus population and citrus seedling identification.
Further, the method of identifying citrus cytoplasmic sources, citrus populations, and citrus seedlings by the chloroplast genome hypervariable sites comprises:
(1) Amplifying citrus genome by a given primer to obtain a target short sequence and carrying out clone sequencing analysis;
(2) The cytoplasmic sources, citrus populations and citrus seedlings of citrus are identified based on the nature of the variation or combination of variation of the hypervariable site sequences SSR, indel and/or SNP.
Further, the method for identifying citrus cytoplasmic sources, citrus populations, and citrus seedlings by the chloroplast genome hypervariable sites further comprises:
and intercepting a target fragment sequence from sequencing data returned by a sequencing company according to the forward and reverse primer sequences, and comparing and analyzing the target fragment sequence with the sequence length of the provided chloroplast genome hypermutation site of the main citrus group or the corresponding sequence obtained from a SNP, SSR and Indel combination characteristic table or a reference sample.
Further, the representative sequence of the citrus group is obtained by summarizing and summarizing the sequencing and cloning analysis of different types of citrus germplasm resource materials collected and stored on the basis of a national fruit tree germplasm-Chongqing citrus resource nursery, and is used for reflecting the difference between different citrus group materials.
Further, in the method for identifying citrus group and citrus seedling by chloroplast genome hypervariable site, chloroplast genome hypervariable site sequences amplified by the primers are used.
By combining all the technical schemes, the invention has the advantages and positive effects that: according to the chloroplast genome hypervariable site, the detection method and the application thereof, a section of chloroplast genome hypervariable site sequence containing variable SSR, indel and/or SNP is found in a plurality of analysis tests, the sequence shows certain conservation and variation in different citrus clusters, and the genome amplification, cloning, sequencing and comparison analysis are carried out on the sequence, so that the cytoplasmic sources of different citrus trees can be well judged, and the cluster distinction of citrus trees is realized.
According to the invention, the cloning and sequencing of a chloroplast genome hypervariable site are performed, and the characteristics of SSR, indel and/or SNP of a sequencing sequence are compared, so that the analysis and identification method of different materials of citrus fruit trees is completed.
According to the invention, the citrus genome is amplified by a given primer to obtain the target chloroplast genome hypervariable site sequence, clone sequencing analysis is carried out, and the cytoplasmic sources, citrus clusters and citrus seedlings of citrus can be identified according to the variation characteristics or variation combinations of fragments SSR, indel and/or SNP. The technology provided by the patent technology can identify various citrus groups by only analyzing the sequence composition of a chloroplast genome hypervariable site, has high reliability, high specificity and good repeatability, and has good application prospects in the aspects of correct preservation and reasonable utilization of citrus genetic resources, genetic evolution research, early identification of citrus seedlings and the like. According to the invention, the sequence of a chloroplast genome hypervariable site is subjected to clone sequencing, and the characteristics of the sequencing sequence are compared, so that the analysis and identification method of different materials of citrus trees are completed.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments of the present invention will be briefly described below, and it is obvious that the drawings described below are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 is a flowchart of an amplification detection method for a chloroplast genome hypervariable site provided by an embodiment of the invention.
Detailed Description
The present invention will be described in further detail with reference to the following examples in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.
Aiming at the problems existing in the prior art, the invention provides a chloroplast genome hypervariable site, a detection method and application thereof, and the invention is described in detail below with reference to the accompanying drawings.
The chloroplast genome hypervariable site provided by the embodiment of the invention is determined by a pair of primer sequences, and the nucleotide sequences of the primers are SEQ ID NO:1: CSAAAGAATCGGTTAMAT; SEQ ID NO:2: TGCGAATCCTTTTGTTTA.
As shown in FIG. 1, the amplification detection method of the chloroplast genome hypervariable site provided by the embodiment of the invention comprises the following steps:
s101, synthesizing a primer for amplifying a chloroplast genome hypervariable site sequence;
s102, extracting genome total DNA of citrus materials to be analyzed, and carrying out PCR amplification by a DNA polymerase chain reaction to obtain a hypervariable site sequence;
s103, adding the amplified product into agarose gel holes for electrophoresis detection, and recovering target DNA fragments, wherein the sizes of the fragments are 100 bp-500 bp;
s104, tailing the recovered target DNA fragment, and obtaining a recombinant T vector by adopting a cloning vector pGEM-T-easy; transforming E.coli DH5 alpha of competent cells of the E.coli by the recombinant T vector which is connected; screening blue and white spots, picking 5-6 white single colonies, shaking overnight with a LA liquid culture medium at a constant temperature of 37 ℃ for culture, and sending bacterial liquid to a sequencing company for sequencing.
The invention provides a chloroplast hypervariable site sequence, the length of the sequence in the chloroplast genome hypervariable site of a main citrus group, a SNP, SSR and Indel combination characteristic table and application thereof in citrus seedling identification, variety resource collection, citrus genetic evolution research and citrus group identification. The short sequence is widely distributed in citrus and kindred plants and is defined by a pair of developed primers, the sequences of which are SEQ ID NO:1: CSAAAGAATCGGTTAMAT; SEQ ID NO:2: TGCGAATCCTTTTGTTTA. The length of the sequence is about 100 bp-500 bp, the interior of the hypervariable site sequence contains multiple variable SSRs, indels and/or SNPs, the total length of the sequence, the different repetition and the repeated number of the SSRs, indels insertion site differences, SNPs and heterozygous/homozygous states have regularity differences in citrus and kindred genera. According to the invention, the sequence length of the chloroplast genome hypervariable site of the main citrus group and the combined characteristic table of SNP, SSR and Indel are summarized, and the citrus fruit tree group can be better distinguished from the cytoplasmic source by comparing the clone sequencing data of the hypervariable site sequence with the characteristic table.
TABLE 1 sequence characterization of chloroplast genome hypervariable sites and corresponding major citrus group table
The technical scheme of the invention is further described below with reference to specific embodiments.
Example 1: chloroplast genome hypervariable site sequence analysis of fingered citron
1. Forward and reverse primers for amplifying the hypervariable site sequences were synthesized, requiring acrylamide gel electrophoresis purification grade.
2. Extracting the genome DNA of fingered citron. The genome DNA of fingered citron is extracted by adopting a modified CTAB method. The concentration of the extracted DNA is detected by a micro ultraviolet spectrophotometer, the integrity of the extracted DNA is detected by 1% agarose gel electrophoresis, and the extracted DNA is preserved at 4 ℃ for standby.
3. The target short sequence is obtained by DNA Polymerase Chain Reaction (PCR) amplification. The PCR system is as follows: 1 XPCR Buffer,1.5 mmol.L -1 MgCl of (C) 2 ，0.2mmol·L -1 dNTPs of 0.33 nmol.L -1 1U of Taq DNA polymerase, about 10ng of DNA template. The total volume was 50. Mu.L. The amplification procedure was: denaturation at 94℃for 45s, annealing at 56℃for 45s, elongation at 72℃for 45s,24 cycles; extending at 72 ℃ for 5min; the PCR product was stored at 4℃for further use.
4. Recovering the target DNA fragment. And adding the amplified product into agarose gel holes for electrophoresis detection, and recovering target DNA fragments.
5. Fragment clones were recovered. The recovered target DNA fragment was tailing and recombinant T vector was obtained using the cloning vector pGEM-T-easy. E.coli DH5 alpha is transformed from the recombinant T vector which is connected. Screening blue and white spots, selecting 6 white single colonies, shaking overnight with a LA liquid culture medium at a constant temperature of 37 ℃ for culture, and sending bacterial liquid to a sequencing company for sequencing.
6. Alignment analysis of the target fragment. The sequencing company returns 6 groups of sequencing data, cuts out a target fragment sequence from the sequencing company according to the primer sequence, inputs the sequence into a word document, and analyzes to find that the fragment lengths and the sequence compositions of all the sequences are completely consistent, so that the sequence of the hypervariable site of the fingered citron is in a homozygous state.
The length of the obtained sequence is 104bp, and the sequence composition is SEQ ID NO:3:
CGAAAGAATCGGTTACATTTTTCATATGATCTCCTCTTTTAGATAGACTAAAAAAAAAAGTAAATTGCCCTTCCTATTTCTAGGATTAAACAAAAGGATTCGCA
(underlined base moiety is primer)
Example 2: chloroplast genome hypervariable site sequence analysis of Tarocaceae blood oranges
1. The synthesis of forward and reverse primers for amplification of the present short sequences requires an acrylamide gel electrophoresis purification grade.
2. Extraction of genomic DNA of Tarroidae blood orange. The modified CTAB method is adopted to extract the total DNA of the genome of the Tarroiday blood orange. The concentration of the extracted DNA is detected by a micro ultraviolet spectrophotometer, the integrity of the extracted DNA is detected by 1% agarose gel electrophoresis, and the extracted DNA is preserved at 4 ℃ for standby.
3. The target short sequence is obtained by DNA Polymerase Chain Reaction (PCR) amplification. The PCR system is as follows: 1 XPCR Buffer,1.5 mmol.L -1 MgCl of (C) 2 ，0.2mmol·L -1 dNTPs of 0.33 nmol.L -1 1U of Taq DNA polymerase, about 10ng of DNA template. The total volume was 50. Mu.L. The amplification procedure was: denaturation at 94℃for 45s, annealing at 56℃for 45s, elongation at 72℃for 45s,24 cycles; extending at 72 ℃ for 5min; the PCR product was stored at 4℃for further use.
4. Recovering the target DNA fragment. And adding the amplified product into agarose gel holes for electrophoresis detection, and recovering target DNA fragments.
5. Fragment clones were recovered. The recovered target DNA fragment was tailing and recombinant T vector was obtained using the cloning vector pGEM-T-easy. E.coli DH5 alpha is transformed from the recombinant T vector which is connected. Screening blue and white spots, selecting 6 white single colonies, shaking overnight with a LA liquid culture medium at a constant temperature of 37 ℃ for culture, and sending bacterial liquid to a sequencing company for sequencing.
6. Alignment analysis of the target fragment. The sequencing company returns 6 groups of sequencing data, cuts out a target fragment sequence from the sequencing company according to the primer sequence, inputs the sequence into a word document, analyzes and discovers that the compositions of 5 sequences are consistent, and 1 sequence has 2 SNP differences. Thus the present hypervariable site sequence of taro family blood orange may be heterozygous.
The length of the obtained sequence is 491bp, and the sequence composition is SEQ ID NO:4:
CGAAAGAATCGGTTACATTTTTCATATGATCTCCTCTTTTAGATAGACTAAAAAAAAAAAAAGAACGCAGTTCTTTTTTTTTTTCTACGTAATATATATTTATTTAATTTATTTGTTTTTTTAGTAATTTACCTATTTCGAAACAGGGTCAAAAATTCGATTTCGAAATCCTTTCTTTGAATTGGCAATTGGGGATTCCCGATAAGAGGGATACTTATTAGTATTAGGGGCCGGGACTCCTGTCCATTGCAAAACCCCTCGTTTGTTGCAGCATCACTTAAAAAGAGGGTTTCCTTTAGACTAAGAAAGGGAAAGAAAAAGGCGAACTGGTATGCCTATCCTAATTCCCCATCCTCAAATCAGTCCTTCCAATTGGAGGAGTTAAATCTTGATAGAATTCAAAAAAGCCAGAAACACGGATATAATAAATAAGAGAAAAAAAATAAGTAAATTGCCCTTCCTATTTCTAGGATTAAACAAAAGGATTCGCA
(underlined base moiety is primer)
The length of the obtained sequence is 492bp, and the sequence composition is SEQ ID NO:5:
CGAAAGAATCGGTTACATTTTTCATATGATCTCCTCTTTTAGATAGACTAAAAAAAAAAAAAAGAACGCAGTTCTTTTTTTTTTTCTACGTAATATATATTTATTTAATTTATTTGTTTTTTTAGTAATTTACCTATTTCGAAACAAAGTCAAAAATTCGATTTCGAAATCCTTTCTTTGAATTGGCAATTGGGGATTCCCGATAAGAGGGATACTTATTAGTATTAGGGGCCGGGACTCCTGTCCATTGCAAAACCCCTCGTTTGTTGCAGCATCACTTAAAAAGAGGGTTTCCTTTAGACTAAGAAAGGGAAAGAAAAAGGCGAACTGGTATGCCTATCCTAATTCCCCATCCTCAAATCAGTCCTTCCAATTGGAGGAGTTAAATCTTGATAGAATTCAAAAAAGCCAGAAACACGGATATAATAAATAAGAGAAAAAAAATAAGTAAATTGCCCTTCCTATTTCTAGGATTAAACAAAAGGATTCGCA
(underlined base moiety is primer)
By comparing the chloroplast hypervariable site sequences of fingered citron and talonaceae blood oranges, it can be found that the fingered citron and talonaceae blood orange chloroplast hypervariable site sequences all have primer sequences defining the site, namely SEQ ID NO:1: CSAAAGAATCGGTTAMAT; SEQ ID NO:2: TGCGAATCCTTTTGTTTA. However, the sequence length of the locus and the internal base composition are obviously different, the sequence length of the fingered citron is only 104bp, all the clone sequences which are sent and detected are completely consistent, the sequence is possibly homozygous, the sequence length of Tarroiday blood orange is longer, wherein 5 of the sequences are 491bp, the internal base composition is completely consistent, 1 is 492bp, and the internal base composition is possibly heterozygous with other 5 SNP(s) with 2 positions.
The technical effects of the present invention will be described in detail with reference to the detection of seedlings.
And (3) citrus seedling detection:
detection of grafted seedlings of different stocks of citrus, namely citrus which is a new variety of citrus developed in a large quantity in recent years in China, the accumulated popularization area is over one million mu, and a large number of fruit farmers still use the citrus as an important candidate variety of a newly built orchard at present, so that the seedlings of the citrus are still in great demand. The citrus seedlings consist of scions and stocks, the citrus seedlings have strong tree vigor, good yield and long fruiting time, and the comparison experiments of stocks in some areas show that the citrus seedlings are suitable stocks of the citrus with pit and the citrus with pit, have developed main roots, can better support the rapid growth and a large number of fruits for a long time, are suitable stocks of the citrus without pit, are favorable for matching with fruit-keeping measures, and reduce physiological fruit dropping of the citrus without pit. Therefore, the objective requirement of accurately identifying scions and stocks of citrus seedlings still exists at present, and the identification is beneficial to fruit farmers to select proper seedlings according to the cultivation technical level and regional characteristics of the seedlings, promote seedling breeders to keep the seedlings pure, and provide basis for government supervision of the seedlings.
The stock is selected as two citrus unshiu seedlings of Yangyang citrus and Wangcangdali citrus aurantium.
The experimental procedure and results are as follows.
1. The synthesis of forward and reverse primers for amplification of the present short sequences requires an acrylamide gel electrophoresis purification grade.
2. And extracting genomic DNA of the sample. The improved CTAB method is adopted to extract genome DNA, but leaves are adopted for the scion varieties of the citrus sinensis, and the root barks below the grafting port part are adopted for the two kinds of stocks of citrus sinensis, namely citrus sinensis and citrus grandis. After DNA extraction, the concentration is detected by a micro ultraviolet spectrophotometer, the integrity of the extracted DNA is detected by 1% agarose gel electrophoresis, and the extracted DNA is preserved at 4 ℃ for standby.
3. The target short sequence is obtained by DNA Polymerase Chain Reaction (PCR) amplification. The PCR system is as follows: 1×PCR Buffer，1.5mmol·L -1 MgCl of (C) 2 ，0.2mmol·L -1 dNTPs of 0.33 nmol.L -1 1U of Taq DNA polymerase, about 10ng of DNA template. The total volume was 50. Mu.L. The amplification procedure was: denaturation at 94℃for 45s, annealing at 56℃for 45s, elongation at 72℃for 45s,24 cycles; extending at 72 ℃ for 5min; the PCR product was stored at 4℃for further use.
4. Recovering the target DNA fragment. And adding the amplified product into agarose gel holes for electrophoresis detection, and recovering target DNA fragments.
5. Fragment clones were recovered. The recovered target DNA fragment was tailing and recombinant T vector was obtained using the cloning vector pGEM-T-easy. E.coli DH5 alpha is transformed from the recombinant T vector which is connected. Screening blue and white spots, picking 6 white single colonies from each material, shaking overnight with a LA liquid culture medium at a constant temperature of 37 ℃ for culture, and sending bacterial liquid to a sequencing company for sequencing.
6. Alignment analysis of the target fragment. The sequencing company returns 6 groups of sequencing data of 3 materials respectively, cuts out a target fragment sequence from the sequencing company according to the primer sequence, inputs the sequence into a word document, compares the sequence characteristics of the chloroplast genome hypervariable sites of the table 1 and the corresponding main citrus group table, converts the sequence corresponding to the combined characteristics into a capitalized state, and compares and analyzes the sequence.
7. The Vortica obtained two types of sequences, 4 SEQ ID NOs of 503 bp: 6 and 2 SEQ ID NOs of 503 bp: 7. both have a primer sequence defining the present site, i.e. SEQ ID NO:1: c (G/C) AAAGAATCGGTTACAT; SEQ ID NO:2: TGCGAATCCTTTTGTTTA, but the difference in G/C between the two forward primers. On the combined sequence features: the front ends are all TGAACTGC, the back ends have GTAAATT repeats, are all GTAAATTGTAAAT, should be classified as broad-skin citrus type, and may be heterozygous.
SEQ ID NO：6：503bp
CCAAAGAATCGGTTACATTTTTCATATGATCTCCTCTTTTAGATAGACTAAAAAAAAAAAATGAACTGCGTTCTTTTTTTTTTTTTTTCTACGTAATATATATTTATTTAATTTATTTGTTTTTTTAGTAATTTACCTATTTCGAAACAGGGTCAAAAATTCGATTTCGAAATCCTTTCTTTGAATTGGCAATTGGGGATTCCCGATAAGAGGGATACTTATTAGTATTAGGGGCCGGGACTCCTGTCAATTGCAAAACCCCTCGTTTGTTGCAGCATCACTTAAAAAGAGGGTTTCCTTTAGACTAAGAAAGGGAAAGAAAAAGGCGAACTGGTATGCCTATCCTAATTCCCCATCCTCAAATCAGTCCTTCCAATTGGAGGAGTTAAATCTTGATAGAATTCAAAAAAGCCAGAAACACAGATATAATAAATAAGAGAAAAAAAAATAAGTAAATTGTAAATTGCCCTTCCTATTTCTAGGATTAAACAAAAGGATTCGCA
(underlined base moiety is primer)
SEQ ID NO：7：503bp
CGAAAGAATCGGTTACATTTTTCATATGATCTCCTCTTTTAGATAGACTAAAAAAAAAAAATGAACTGCGTTCTTTTTTTTTTTTTTTCTACGTAATATATATTTATTTAATTTATTTGTTTTTTTAGTAATTTACCTATTTCGAAACAGGGTCAAAAATTCGATTTCGAAATCCTTTCTTTGAATTGGCAATTGGGGATTCCCGATAAGAGGGATACTTATTAGTATTAGGGGCCGGGACTCCTGTCAATTGCAAAACCCCTCGTTTGTTGCAGCATCACTTAAAAAGAGGGTTTCCTTTAGACTAAGAAAGGGAAAGAAAAAGGCGAACTGGTATGCCTATCCTAATTCCCCATCCTCAAATCAGTCCTTCCAATTGGAGGAGTTAAATCTTGATAGAATTCAAAAAAGCCAGAAACACAGATATAATAAATAAGAGAAAAAAAAATAAGTAAATTGTAAATTGCCCTTCCTATTTCTAGGATTAAACAAAAGGATTCGCA
(underlined base moiety is primer)
8. The senium citrus sinensis can obtain three types of sequences, 489bp SEQ ID NO: 8. 490bp SEQ ID NO: SEQ ID NOs of 9 and 492 bp: 10. all three have primer sequences defining the site, except for the sequence of SEQ ID NO:9 repeat the sequence in front a as compared to SEQ ID NO:8 more than 1 a, SEQ ID NO:10 repeat the sequence in front a as compared to SEQ ID NO:8 more than 3 a. On the combined sequence features: the front ends are all agagca, should be classified as pomelo type, and are heterozygous.
SEQ ID NO：8：/489bp
CGAAAGAATCGGTTACATTTTTCATATGATCTCCTCTTTTAGATAGACTAAAAAAAAAAA--GAACGCAGTTCTTTTTTTTTTTCTACGTAATATATATTTATTTAATTTATTTGTTTTTTTAGTAATTTACCTATTTCGAAACAGGGTCAAAAATTCGATTTCGAAATCCTTTCTTTGAATTGGCAATTGGGGATTCCCGATAAGAGGGATACTTATTAGTATTAGGGGCCGGGACTCCTGTCCATTGCAAAACCCCTCGTTTGTTGCAGCATCACTTAAAAAGAGGGTTTCCTTTAGACTAAGAAAGGGAAAGAAAAAGGCGAACTGGTATGCCTATCCTAATTCCCCATCCTCAAATCAGTCCTTCCAATTGGAGGAGTTAAATCTTGATAGAATTCAAAAAAGCCAGAAACACGGATATAATAAATAAGAGAAAAAAAATAAGTAAATTGCCCTTCCTATTTCTAGGATTAAACAAAAGGATTCGCA
(underlined base moiety is primer)
SEQ ID NO：9：/490bp
CGAAAGAATCGGTTACATTTTTCATATGATCTCCTCTTTTAGATAGACTAAAAAAAAAAAA-GAACGCAGTTCTTTTTTTTTTTCTACGTAATATATATTTATTTAATTTATTTGTTTTTTTAGTAATTTACCTATTTCGAAACAGGGTCAAAAATTCGATTTCGAAATCCTTTCTTTGAATTGGCAATTGGGGATTCCCGATAAGAGGGATACTTATTAGTATTAGGGGCCGGGACTCCTGTCCATTGCAAAACCCCTCGTTTGTTGCAGCATCACTTAAAAAGAGGGTTTCCTTTAGACTAAGAAAGGGAAAGAAAAAGGCGAACTGGTATGCCTATCCTAATTCCCCATCCTCAAATCAGTCCTTCCAATTGGAGGAGTTAAATCTTGATAGAATTCAAAAAAGCCAGAAACACGGATATAATAAATAAGAGAAAAAAAATAAGTAAATTGCCCTTCCTATTTCTAGGATTAAACAAAAGGATTCGCA
(underlined base moiety is primer)
SEQ ID NO：10：/492bp
CGAAAGAATCGGTTACATTTTTCATATGATCTCCTCTTTTAGATAGACTAAAAAAAAAAAAAAGAACGCAGTTCTTTTTTTTTTTCTACGTAATATATATTTATTTAATTTATTTGTTTTTTTAGTAATTTACCTATTTCGAAACAGGGTCAAAAATTCGATTTCGAAATCCTTTCTTTGAATTGGCAATTGGGGATTCCCGATAAGAGGGATACTTATTAGTATTAGGGGCCGGGACTCCTGTCCATTGCAAAACCCCTCGTTTGTTGCAGCATCACTTAAAAAGAGGGTTTCCTTTAGACTAAGAAAGGGAAAGAAAAAGGCGAACTGGTATGCCTATCCTAATTCCCCATCCTCAAATCAGTCCTTCCAATTGGAGGAGTTAAATCTTGATAGAATTCAAAAAAGCCAGAAACACGGATATAATAAATAAGAGAAAAAAAATAAGTAAATTGCCCTTCCTATTTCTAGGATTAAACAAAAGGATTCGCA
(underlined base moiety is primer)
9. Three types of sequences are obtained from Hovenia dulcis Thunb, 508bp SEQ ID NO: 11. 509bp SEQ ID NO:11 and 510bp SEQ ID NOs: 12. all three have primer sequences defining the site, except for the sequence of SEQ ID NO:9 repeat the sequence in front a as compared to SEQ ID NO:8 more than 1 a, SEQ ID NO:10 repeat the sequence in front a as compared to SEQ ID NO:8 more than 3 a. On the combined sequence features: the front ends are all AGAACTGC, and TAATTAATTTGTTTTTT base repeats appear, which should be classified as Zhi type and heterozygous.
SEQ ID NO：11：/508bp(AGAACTGC，A11T13！)
CGAAAGAATCGGTTACATTTTTCATATGATTTCCTCTTTTAGATAGACTAAAAAAAAAAA--GAACTGCGTTCTTTTTTTTTTTTTCTACGTAATATATATTTATTTAATTAATTTGTTTTTTTAATTAATTTGTTTTTTTAGTAATTTACCTATTTCGAAACAGGGTCAAAAATTCGATTTCGAAATCCTTTCTTTGAATTGTCAATTGGGGATTCCCGATAAGAGGGATACTTATTAGTATTAGGGGCCGGGACTCCTGTCAATTGCAAAACCCCTCGTTTGTTGCAGCATCACTTAAAAAGAGGGTTTCCTTGAGACTAAGAAAGGGAAAGAAAAAGGCGAACTGGTATGCCTATCCTAATTCCCCATCCTCAAATCAGTCCTTCCAATTGGAGGAGTTAAATCTTGATAGAATTCAAAAAAGCCAGAAACACAGATATAATAAATAAGAGAAAAAAAAAAAGTAAATTGCCCTTCCTATTTCTAGGATTAAACAAAAGGATTCGCA
(underlined base moiety is primer)
SEQ ID NO:12:509bp (TAATTAATTTGTTTTTT bases repeated) (AGAACTGC, A10T 14-
CGAAAGAATCGGTTACATTTTTCATATGATCTCCTCTTTTAGATAGACTAAAAAAAAAA---GAACTGCGTTCTTTTTTTTTTTTTTCTACGTAATATATATTTATTTAATTAATTTGTTTTTTTAATTAATTTGTTTTTTTAGTAATTTACCTATTTCGAAACAGGGTCAAAAATTCGATTTCGAAATCCTTTCTTTGAATTGTCAATTGGGGATTCCCGATAAGAGGGATACTTATTAGTATTAGGGGCCGGGACTCCTGTCAATTGCAAAACCCCTCGTTTGTTGCAGCATCACTTAAAAAGAGGGTTTCCTTGAGACTAAGAAAGGGAAAGAAAAAGGCGAACTGGTATGCCTATCCTAATTCCCCATCCTCAAATCAGTCCTTCCAATTGGAGGAGTTAAATCTTGATAGAATTCAAAAAAGCCAGAAACACAGATATAATAAATAAGAGAAAAAAAAAAAAGTAAATTGCCCTTCCTATTTCTAGGATTAAACAAAAGGATTCGCA
(underlined base moiety is primer)
SEQ ID NO：13：/510bp(AGAACTGC，A12T14！)
CGAAAGAATCGGTTACATTTTTCATATGATCTCCTCTTTTAGATAGACTAAAAAAAAAAAAGAACTGCGTTCTTTTTTTTTTTTTTCTACGTAATATATATTTATTTAATTAATTTGTTTTTTTAATTAATTTGTTTTTTTAGTAATTTACCTATTTCGAAACAGGGTCAAAAATTCGATTTCGAAATCCTTTCTTTGAATTGTCAATTGGGGATTCCCGATAAGAGGGATACTTATTAGTATTAGGGGCCGGGACTCCTGTCAATTGCAAAACCCCTCGTTTGTTGCAGCATCACTTAAAAAGAGGGTTTCCTTGAGACTAAGAAAGGGAAAGAAAAAGGCGAACTGGTATGCCTATCCTAATTCCCCATCCTCAAATCAGTCCTTCCAATTGGAGGAGTTAAATCTTGATAGAATTCAAAAAAGCCAGAAACACAGATATAATAAATAAGAGAAAAAAAAAAAGTAAATTGCCCTTCCTATTTCTAGGATTAAACAAAAGGATTCGCA
(underlined base moiety is primer)
10. From the sequence analysis result, although the citrus and the two stocks are heterozygous, the size or the site difference of the heterozygous fragments is obvious, and meanwhile, the difference of the representative sequences is obvious in the combined characteristics of SNP, SSR and Indel, so that the short-sequence clone sequencing of the technology can realize the distinction between stock strains and between scions and stocks without objection.
According to the invention, only a section of short sequence is subjected to clone sequencing, and then citrus groups and citrus seedlings can be identified according to the length of the short sequence and the variation characteristics or variation combination of SSR, indel and/or SNP. The technology provided by the patent technology can identify various citrus groups only by means of sequence composition analysis of a short sequence, has high specificity and good repeatability, and has good application prospects in correct preservation and reasonable utilization of citrus genetic resources, genetic evolution research, early identification of citrus seedlings and the like.
Demonstration part (specific examples/experiments/simulations/front experimental data capable of proving the inventive aspects of the present invention, etc.)
The foregoing is merely illustrative of specific embodiments of the present invention, and the scope of the invention is not limited thereto, but any modifications, equivalents, improvements and alternatives falling within the spirit and principles of the present invention will be apparent to those skilled in the art within the scope of the present invention.
Sequence listing
<110> university of southwest
<120> a chloroplast genome hypervariable site, and detection method and application thereof
<160> 13
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
csaaagaatc ggttamat 18
<210> 2
<211> 18
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
tgcgaatcct tttgttta 18
<210> 3
<211> 104
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
cgaaagaatc ggttacattt ttcatatgat ctcctctttt agatagacta aaaaaaaaag 60
taaattgccc ttcctatttc taggattaaa caaaaggatt cgca 104
<210> 4
<211> 491
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
cgaaagaatc ggttacattt ttcatatgat ctcctctttt agatagacta aaaaaaaaaa 60
aagaacgcag ttcttttttt ttttctacgt aatatatatt tatttaattt atttgttttt 120
ttagtaattt acctatttcg aaacagggtc aaaaattcga tttcgaaatc ctttctttga 180
attggcaatt ggggattccc gataagaggg atacttatta gtattagggg ccgggactcc 240
tgtccattgc aaaacccctc gtttgttgca gcatcactta aaaagagggt ttcctttaga 300
ctaagaaagg gaaagaaaaa ggcgaactgg tatgcctatc ctaattcccc atcctcaaat 360
cagtccttcc aattggagga gttaaatctt gatagaattc aaaaaagcca gaaacacgga 420
tataataaat aagagaaaaa aaataagtaa attgcccttc ctatttctag gattaaacaa 480
aaggattcgc a 491
<210> 5
<211> 492
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
cgaaagaatc ggttacattt ttcatatgat ctcctctttt agatagacta aaaaaaaaaa 60
aaagaacgca gttctttttt tttttctacg taatatatat ttatttaatt tatttgtttt 120
tttagtaatt tacctatttc gaaacaaagt caaaaattcg atttcgaaat cctttctttg 180
aattggcaat tggggattcc cgataagagg gatacttatt agtattaggg gccgggactc 240
ctgtccattg caaaacccct cgtttgttgc agcatcactt aaaaagaggg tttcctttag 300
actaagaaag ggaaagaaaa aggcgaactg gtatgcctat cctaattccc catcctcaaa 360
tcagtccttc caattggagg agttaaatct tgatagaatt caaaaaagcc agaaacacgg 420
atataataaa taagagaaaa aaaataagta aattgccctt cctatttcta ggattaaaca 480
aaaggattcg ca 492
<210> 6
<211> 503
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
ccaaagaatc ggttacattt ttcatatgat ctcctctttt agatagacta aaaaaaaaaa 60
atgaactgcg ttcttttttt ttttttttct acgtaatata tatttattta atttatttgt 120
ttttttagta atttacctat ttcgaaacag ggtcaaaaat tcgatttcga aatcctttct 180
ttgaattggc aattggggat tcccgataag agggatactt attagtatta ggggccggga 240
ctcctgtcaa ttgcaaaacc cctcgtttgt tgcagcatca cttaaaaaga gggtttcctt 300
tagactaaga aagggaaaga aaaaggcgaa ctggtatgcc tatcctaatt ccccatcctc 360
aaatcagtcc ttccaattgg aggagttaaa tcttgataga attcaaaaaa gccagaaaca 420
cagatataat aaataagaga aaaaaaaata agtaaattgt aaattgccct tcctatttct 480
aggattaaac aaaaggattc gca 503
<210> 7
<211> 503
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
cgaaagaatc ggttacattt ttcatatgat ctcctctttt agatagacta aaaaaaaaaa 60
atgaactgcg ttcttttttt ttttttttct acgtaatata tatttattta atttatttgt 120
ttttttagta atttacctat ttcgaaacag ggtcaaaaat tcgatttcga aatcctttct 180
ttgaattggc aattggggat tcccgataag agggatactt attagtatta ggggccggga 240
ctcctgtcaa ttgcaaaacc cctcgtttgt tgcagcatca cttaaaaaga gggtttcctt 300
tagactaaga aagggaaaga aaaaggcgaa ctggtatgcc tatcctaatt ccccatcctc 360
aaatcagtcc ttccaattgg aggagttaaa tcttgataga attcaaaaaa gccagaaaca 420
cagatataat aaataagaga aaaaaaaata agtaaattgt aaattgccct tcctatttct 480
aggattaaac aaaaggattc gca 503
<210> 8
<211> 489
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
cgaaagaatc ggttacattt ttcatatgat ctcctctttt agatagacta aaaaaaaaaa 60
gaacgcagtt cttttttttt ttctacgtaa tatatattta tttaatttat ttgttttttt 120
agtaatttac ctatttcgaa acagggtcaa aaattcgatt tcgaaatcct ttctttgaat 180
tggcaattgg ggattcccga taagagggat acttattagt attaggggcc gggactcctg 240
tccattgcaa aacccctcgt ttgttgcagc atcacttaaa aagagggttt cctttagact 300
aagaaaggga aagaaaaagg cgaactggta tgcctatcct aattccccat cctcaaatca 360
gtccttccaa ttggaggagt taaatcttga tagaattcaa aaaagccaga aacacggata 420
taataaataa gagaaaaaaa ataagtaaat tgcccttcct atttctagga ttaaacaaaa 480
ggattcgca 489
<210> 9
<211> 490
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
cgaaagaatc ggttacattt ttcatatgat ctcctctttt agatagacta aaaaaaaaaa 60
agaacgcagt tctttttttt tttctacgta atatatattt atttaattta tttgtttttt 120
tagtaattta cctatttcga aacagggtca aaaattcgat ttcgaaatcc tttctttgaa 180
ttggcaattg gggattcccg ataagaggga tacttattag tattaggggc cgggactcct 240
gtccattgca aaacccctcg tttgttgcag catcacttaa aaagagggtt tcctttagac 300
taagaaaggg aaagaaaaag gcgaactggt atgcctatcc taattcccca tcctcaaatc 360
agtccttcca attggaggag ttaaatcttg atagaattca aaaaagccag aaacacggat 420
ataataaata agagaaaaaa aataagtaaa ttgcccttcc tatttctagg attaaacaaa 480
aggattcgca 490
<210> 10
<211> 492
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
cgaaagaatc ggttacattt ttcatatgat ctcctctttt agatagacta aaaaaaaaaa 60
aaagaacgca gttctttttt tttttctacg taatatatat ttatttaatt tatttgtttt 120
tttagtaatt tacctatttc gaaacagggt caaaaattcg atttcgaaat cctttctttg 180
aattggcaat tggggattcc cgataagagg gatacttatt agtattaggg gccgggactc 240
ctgtccattg caaaacccct cgtttgttgc agcatcactt aaaaagaggg tttcctttag 300
actaagaaag ggaaagaaaa aggcgaactg gtatgcctat cctaattccc catcctcaaa 360
tcagtccttc caattggagg agttaaatct tgatagaatt caaaaaagcc agaaacacgg 420
atataataaa taagagaaaa aaaataagta aattgccctt cctatttcta ggattaaaca 480
aaaggattcg ca 492
<210> 11
<211> 508
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
cgaaagaatc ggttacattt ttcatatgat ttcctctttt agatagacta aaaaaaaaaa 60
gaactgcgtt cttttttttt ttttctacgt aatatatatt tatttaatta atttgttttt 120
ttaattaatt tgttttttta gtaatttacc tatttcgaaa cagggtcaaa aattcgattt 180
cgaaatcctt tctttgaatt gtcaattggg gattcccgat aagagggata cttattagta 240
ttaggggccg ggactcctgt caattgcaaa acccctcgtt tgttgcagca tcacttaaaa 300
agagggtttc cttgagacta agaaagggaa agaaaaaggc gaactggtat gcctatccta 360
attccccatc ctcaaatcag tccttccaat tggaggagtt aaatcttgat agaattcaaa 420
aaagccagaa acacagatat aataaataag agaaaaaaaa aaagtaaatt gcccttccta 480
tttctaggat taaacaaaag gattcgca 508
<210> 12
<211> 509
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
cgaaagaatc ggttacattt ttcatatgat ctcctctttt agatagacta aaaaaaaaag 60
aactgcgttc tttttttttt ttttctacgt aatatatatt tatttaatta atttgttttt 120
ttaattaatt tgttttttta gtaatttacc tatttcgaaa cagggtcaaa aattcgattt 180
cgaaatcctt tctttgaatt gtcaattggg gattcccgat aagagggata cttattagta 240
ttaggggccg ggactcctgt caattgcaaa acccctcgtt tgttgcagca tcacttaaaa 300
agagggtttc cttgagacta agaaagggaa agaaaaaggc gaactggtat gcctatccta 360
attccccatc ctcaaatcag tccttccaat tggaggagtt aaatcttgat agaattcaaa 420
aaagccagaa acacagatat aataaataag agaaaaaaaa aaaagtaaat tgcccttcct 480
atttctagga ttaaacaaaa ggattcgca 509
<210> 13
<211> 510
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
cgaaagaatc ggttacattt ttcatatgat ctcctctttt agatagacta aaaaaaaaaa 60
agaactgcgt tctttttttt ttttttctac gtaatatata tttatttaat taatttgttt 120
ttttaattaa tttgtttttt tagtaattta cctatttcga aacagggtca aaaattcgat 180
ttcgaaatcc tttctttgaa ttgtcaattg gggattcccg ataagaggga tacttattag 240
tattaggggc cgggactcct gtcaattgca aaacccctcg tttgttgcag catcacttaa 300
aaagagggtt tccttgagac taagaaaggg aaagaaaaag gcgaactggt atgcctatcc 360
taattcccca tcctcaaatc agtccttcca attggaggag ttaaatcttg atagaattca 420
aaaaagccag aaacacagat ataataaata agagaaaaaa aaaaagtaaa ttgcccttcc 480
tatttctagg attaaacaaa aggattcgca 510

Claims (9)

1. The amplification detection method of the chloroplast genome hypervariable site is characterized by comprising the following steps of:
step one, synthesizing a primer for amplifying a chloroplast genome hypervariable site sequence, wherein the nucleotide sequence of the primer is SEQ ID NO:1 and SEQ ID NO:2;
extracting genome total DNA of citrus materials to be analyzed, and carrying out PCR amplification by using a DNA polymerase chain reaction to obtain a hypervariable site sequence;
step three, adding the amplified product into agarose gel holes for electrophoresis detection, and recovering target DNA fragments, wherein the sizes of the fragments are 100 bp-500 bp;
step four, adding the tail of the recovered target DNA fragment, and obtaining a recombinant T vector by adopting a cloning vector pGEM-T-easy; transforming E.coli competent cells E.coli DH5α with the ligated recombinant T vector; screening blue and white spots, picking 5-6 white single colonies, shaking overnight with a LA liquid culture medium at a constant temperature of 37 ℃ for culture, and sending bacterial liquid to a sequencing company for sequencing.
2. The method for detecting amplification of a hypervariable site of a chloroplast genome of claim 1, further comprising:
according to the upstream and downstream primers, intercepting sequencing data of the finishing sample, comparing and analyzing the sequencing data with the sequence length of the chloroplast genome hypermutation site of the main citrus group or corresponding sequences obtained from a SNP, SSR and Indel combination characteristic table or reference sample, and identifying cytoplasmic sources, citrus groups and citrus seedlings of citrus.
3. The method for detecting amplification of a chloroplast genome hypervariable site according to claim 1, wherein in the first step, the primer sequence purity is of the order of purification by acrylamide gel electrophoresis;
in the second step, the PCR amplification system is as follows: 1 XPCR Buffer,1.5 mmol.L -1 MgCl2,0.2 mmol.L -1 dNTPs of 0.33 nmol.L -1 1U of Taq DNA polymerase, 10ng of DNA template, and a total volume of 50. Mu.L.
4. The method for detecting amplification of a hypervariable site of chloroplast genome according to claim 1, wherein in the second step, the PCR amplification procedure comprises: denaturation at 94℃for 45s, annealing at 56℃for 45s, elongation at 72℃for 45s,24 cycles; extending at 72 ℃ for 5min; the PCR product was stored at 4℃for further use.
5. An application of a chloroplast genome hypervariable site in citrus cytoplasmic source, citrus genetic evolution research, variety resource collection, citrus group and citrus seedling identification, wherein a detection primer of the chloroplast genome hypervariable site is SEQ ID NO:1 and SEQ ID NO:2.
6. the use of the chloroplast genome hypervariable site in citrus cytoplasmic sources, citrus genetic evolution research, variety resource collection, citrus population and citrus seedling identification of claim 5, wherein the method of chloroplast genome hypervariable site identification of citrus cytoplasmic sources, citrus population and citrus seedlings comprises:
(1) Amplifying citrus genome by a given primer to obtain a target short sequence and carrying out clone sequencing analysis;
(2) The cytoplasmic sources, citrus populations and citrus seedlings of citrus are identified based on the nature of the variation or combination of variation of the hypervariable site sequences SSR, indel and/or SNP.
7. The use of the chloroplast genome hypervariable site in citrus cytoplasmic sources, citrus genetic evolution research, variety resource collection, citrus population and citrus seedling identification of claim 6, wherein the method of chloroplast genome hypervariable site identification of citrus cytoplasmic sources, citrus population and citrus seedlings further comprises:
and intercepting a target fragment sequence from sequencing data returned by a sequencing company according to the forward and reverse primer sequences, and comparing and analyzing the target fragment sequence with the sequence length of the provided chloroplast genome hypermutation site of the main citrus group or the corresponding sequence obtained from a SNP, SSR and Indel combination characteristic table or a reference sample.
8. The use of the chloroplast genome hypervariable site of claim 7 in citrus cytoplasmic sources, citrus genetic evolution research, variety resource collection, citrus clusters, and citrus seedling identification, wherein the representative sequence of citrus clusters is summarized based on sequencing and cloning analysis of different types of citrus germplasm resource materials collected and maintained by the national fruit tree germplasm-Chongqing citrus resource nursery, for reflecting differences between different citrus cluster materials.
9. The use of the chloroplast genomic hypervariable site of claim 5 in citrus cytoplasmic sources, citrus genetic evolution research, variety resource collection, citrus population and citrus seedling identification, wherein the chloroplast genomic hypervariable site sequence amplified from the primer is used in a method of identifying citrus population and citrus seedlings.
CN202111185233.XA 2021-10-12 2021-10-12 Chloroplast genome hypervariable site and detection method and application thereof Active CN113881798B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111185233.XA CN113881798B (en) 2021-10-12 2021-10-12 Chloroplast genome hypervariable site and detection method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111185233.XA CN113881798B (en) 2021-10-12 2021-10-12 Chloroplast genome hypervariable site and detection method and application thereof

Publications (2)

Publication Number Publication Date
CN113881798A CN113881798A (en) 2022-01-04
CN113881798B true CN113881798B (en) 2024-04-02

Family

ID=79006247

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111185233.XA Active CN113881798B (en) 2021-10-12 2021-10-12 Chloroplast genome hypervariable site and detection method and application thereof

Country Status (1)

Country Link
CN (1) CN113881798B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109337997A (en) * 2018-09-20 2019-02-15 江西省林业科学院 A kind of Camellia polymorphism Chloroplast gene microsatellite molecular marker primer and screening and the method for screening sibling species
CN111593049A (en) * 2020-06-18 2020-08-28 西南大学 Application of short DNA sequence in identification of citrus group and citrus seedling

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10767188B2 (en) * 2013-09-25 2020-09-08 Nutech Ventures Methods and compositions for obtaining useful plant traits

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109337997A (en) * 2018-09-20 2019-02-15 江西省林业科学院 A kind of Camellia polymorphism Chloroplast gene microsatellite molecular marker primer and screening and the method for screening sibling species
CN111593049A (en) * 2020-06-18 2020-08-28 西南大学 Application of short DNA sequence in identification of citrus group and citrus seedling

Also Published As

Publication number Publication date
CN113881798A (en) 2022-01-04

Similar Documents

Publication Publication Date Title
CN106755482B (en) SSR molecular marker III for identifying progeny plants of Gala apples and application thereof
CN110241248A (en) KASP label relevant to Grain Weight in Common Wheat under condition of salt stress and its application
Wang et al. A genetic linkage map of Populus adenopoda Maxim.× P. alba L. hybrid based on SSR and SRAP markers
CN109830261B (en) Method for screening quantitative trait candidate genes
CN109929945B (en) Molecular marker BrSF2604 primer of main effect QTL sites in flowering phase and mature phase of brassica napus and application thereof
CN102174527B (en) Application of upright dense cluster genes in improvement of utilization efficiency of nitrogen fertilizer
CN112410462B (en) SNP molecular marker closely linked with pumpkin semi-dwarf traits and application thereof
CN109762926A (en) A kind of and the associated molecular labeling primer of siliqua of oilseed rape number and application
CN110004242B (en) Molecular marker BrSF0239 primer of main QTL sites in flowering phase and mature phase of brassica napus and application thereof
CN113881798B (en) Chloroplast genome hypervariable site and detection method and application thereof
CN111593049B (en) Application of short DNA sequence in identification of citrus group and citrus seedling
CN109055593A (en) Improve the SNP marker of fiber yield and the identification and breeding method of high yield cotton
CN108998567B (en) Molecular marker primer and method for identifying amygdalus pedunculata pall, amygdalus mongolicus and prunus ulmaria
CN108504771A (en) A method of exploitation sugarcane SSR marker and identification Sugarcane Breeding affiliation
CN115141893A (en) Molecular marker group containing 7 molecular markers and used for predicting dry matter content of kiwi fruit, application and kit thereof
CN103740856B (en) Molecular method for predicting verticillium wilt resisting capability of different cotton materials
CN110643728B (en) Method for improving breeding efficiency of poplar crossbreeding
CN107058322A (en) The miRNA related to Dunaliella salina cell saline-alkaline tolerance
CN107326081B (en) Identification method of kiwi fruit germplasm resources and application thereof
CN111235301A (en) Method for identifying authenticity of bitter gourd varieties and special SSR primer combination thereof
CN109825636A (en) One kind is for identifying the SSR molecular marker and its application of Variety of Apple &#34; red rosy clouds &#34; finger-print
CN112251530B (en) SSR (simple sequence repeat) marker associated with ramie fiber fineness and application thereof
CN112593006B (en) Wheat green-extending character main effect QTL locus, KASP primer closely linked with same and application of KASP primer
CN108998566B (en) Molecular marker primer for identifying super-red kiwi variety and application thereof
CN109055601B (en) Molecular marker primer for identifying kiwi fruit and kiwi fruit 2 variety and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant