CN111593049B

CN111593049B - Application of short DNA sequence in identification of citrus group and citrus seedling

Info

Publication number: CN111593049B
Application number: CN202010559088.6A
Authority: CN
Inventors: 洪棋斌; 龚桂芝
Original assignee: Southwest University
Current assignee: Southwest University
Priority date: 2020-06-18
Filing date: 2020-06-18
Publication date: 2021-10-29
Anticipated expiration: 2040-06-18
Also published as: CN111593049A

Abstract

The invention belongs to the technical field of genetic engineering, and discloses an application of a short DNA sequence in citrus group and citrus seedling identification, wherein a primer sequence for identifying the short DNA sequence is SEQ ID NO: 1 and SEQ ID NO: 2, and the sequences defined by the primers are representative of the major citrus group and their SNP, SSR and Indel combination profiles. The citrus genome is amplified by a given primer to obtain a target short sequence and carry out clone sequencing analysis; according to the variant characteristics or variation combination of the fragment SSR, Indel and/or SNP, the heterozygous state, citrus cluster and citrus seedling of the citrus can be identified. The invention completes the analysis and identification of different materials of citrus fruit trees by cloning and sequencing a section of specific short sequence and comparing the characteristics of the sequenced sequence. And performing genome amplification, cloning, sequencing and comparison analysis with a combined feature table on the sequence to distinguish the clusters of the citrus fruit trees.

Description

Application of short DNA sequence in identification of citrus group and citrus seedling

Technical Field

The invention belongs to the technical field of genetic engineering, and relates to application of a short DNA sequence in citrus cluster and citrus seedling identification.

Background

The citrus fruit trees belong to the Rutaceae, are rich in variation due to the influence of apomixis, easy hybridization among species, easy occurrence of asexual variation, wide cultivation, long history and the like, and not only have citrus tangelo which is widely cultivated, but also have citrus bergamot and citrus bergamot which are specially cultivated, wild semiwild great Yichang orange winged orange and the like, and trifoliate orange which is mainly used as a rootstock and a hybrid thereof, and are mainly distributed in Australia such as Australia. Research on citrus classification and system evolution has guiding effects on genetic and evolutionary relationships of citrus fruit trees, better understanding, development and utilization of the citrus fruit trees, development of citrus genetic breeding, further collection, protection, evaluation and utilization of germplasm resources and the like. The current international comparison public citrus classification system is the large species classification of w.t. swingle and the small species classification of the three sheers in the field. Swingle classified citrus plants into true citrus groups, including 6 genera, of which the citrus cultivated value was highest, into 16 varieties, 8 varieties. The Changsanlang in the field divides citrus plants into 4 genera, and admits 145 species. The classification of citrus and related genera is so different and controversial that the main reason for this is that the classification of citrus in the traditional method is mainly based on morphological criteria. The morphological indexes are greatly influenced by environmental changes, the phenomena of allotype and isomorphism of foreign matters are easy to occur at different time and places, the quantity and the types of the morphological indexes are relatively limited, and comprehensive, real and accurate tests and analysis are difficult to be greatly expanded, so that the real and comprehensive reflection of genetic differences is difficult.

A biological trait is ultimately determined by inheritance, the origin of which is the complete genomic sequence. The method is a more effective and reliable means for accurately identifying individual differences, researching systematic evolution and exploring gene functions. However, the complete citrus genome sequence is large and highly heterozygous, and the complete interpretation of the genome of each interested individual and the comparative study are carried out, so that the cost is high, the difficulty is high, and special equipment and knowledge skills are required; meanwhile, most sequences of genomes of species with similar relativity are very similar or consistent, analysis of the sequences does not contribute or only contributes to individual identification, and comparison of genome sequencing of chimpanzees and human genomes in 2017 shows that the DNA sequence similarity of the chimpanzees and the human genomes reaches 99%, and even if the DNA sequence insertion or deletion is considered, the similarity of the two is 96%. The genome sequence sites contributing to the group or individual difference are found and then are deeply analyzed, so that the interference of a large number of similar sequences is reduced, the research difficulty is greatly reduced, the cost and time for analysis and test are reduced, and the analysis and research on more individuals and materials are facilitated.

Through the above analysis, the problems and defects of the prior art are as follows: the number and types of morphological indexes are limited, the acquisition time period is long, and different samples are difficult to distinguish accurately; the citrus genome sequence is large, the heterozygosis is high, the genome is completely read for each interested individual and is compared and researched, the cost is high, and the difficulty is high.

The difficulty in solving the above problems and defects is: the accurate acquisition of the form indexes requires that the evaluation materials are arranged in the same region and under the same management condition, and technical personnel trained professionally observe the evaluation materials continuously for at least more than 3 years, so that a large amount of manpower and material resources are consumed for management, and the number and types of the form indexes are limited, so that different samples are difficult to distinguish accurately. Genome sequencing is a relatively accurate method, but at present, even if a cheapest second-generation sequencing method is adopted, the cost of assembling and obtaining a complete genome sequence of an interested individual and performing comparative analysis is at least over million RMB, and due to the fact that obtained data are huge and reach dozens of GB, subsequent analysis is difficult to perform by a common computer and a common person.

The significance of solving the problems and the defects is as follows: the gene sequence has uniqueness, can accurately obtain the gene sequence of the tested material through genome amplification, cloning, sequencing and comparative analysis, can well judge the heterozygosity of the tested material on the basis of the accurate gene sequence, and solves the problem that the existing common molecular marker technology and second-generation sequencing are difficult to overcome. Meanwhile, the current gene cloning and sequencing technology is mature, early cloning and later analysis can be carried out in a common laboratory, intermediate sequencing can be selected by a plurality of commercial companies, the total cost of a single sample is low, and the identification time is short. The method has the advantages of accurate identification, low cost, quick identification time and low technical difficulty, so the method can be widely used for distinguishing the clusters of the citrus fruit trees, identifying citrus seedlings and the like, and promotes the recognition, development and utilization of the citrus fruit trees.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides an application of a short DNA sequence in citrus cluster and citrus seedling identification.

The invention is realized by a primer, and the sequence of the primer is SEQ ID NO: 1 and SEQ ID NO: 2.

further, the purity requirement of the primer sequence is acrylamide gel electrophoresis purification level.

Another objective of the invention is to provide a target short sequence, wherein the target short sequence has the primer to amplify citrus genome to obtain the target short sequence.

Further, the method for obtaining the target short sequence comprises the following steps:

(1) extracting genome DNA of the citrus material to be analyzed, and performing PCR amplification by using DNA polymerase chain reaction to obtain a target short sequence;

(2) adding the amplification product into an agarose gel hole for electrophoresis detection, and recovering a target DNA fragment with the fragment size of 150 b;

(3) tailing the recovered target DNA fragment, and obtaining a recombinant T vector by adopting a cloning vector pGEM-T-easy; transforming the connected recombinant T vector into an escherichia coli competent cell E.coli DH5 alpha; screening blue white spots, selecting 5-6 white single colonies, shaking and culturing by a LA liquid culture medium at 37 ℃ on a constant temperature shaking table overnight, and sending a bacterial liquid to a sequencing company for sequencing.

Further, the PCR system is as follows: 1 XPCR Buffer, 1.5 mmol. L^-1Mg of (2)²⁺，0.2mmol·L^-10.33 nmol.L of dNTPs^-1The upstream primer and the downstream primer of (1), 1U of high-fidelity Taq DNA polymerase, 100ng of DNA template and 50 mu L of total volume.

Further, the amplification procedure of the PCR is as follows: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 45s, annealing at 62 ℃ for 40s, and extension at 72 ℃ for 45s, wherein each cycle is reduced by 0.5 ℃ and 10 cycles; denaturation at 94 ℃ for 45s, annealing at 58 ℃ for 40s, and extension at 72 ℃ for 40s, for 22 cycles; extending for 5min at 72 ℃; finally, the PCR product is stored at 4 ℃.

It is another object of the present invention to provide a method for identifying citrus heterozygous state, citrus cluster and citrus seedling using the target short sequence, which comprises: according to the variation characteristics or variation combination of the fragment SSR, Indel and/or SNP, the heterozygous state, citrus cluster and citrus seedling of the citrus can be identified.

Furthermore, the method for identifying the citrus heterozygous state, the citrus cluster and the citrus seedling intercepts a target fragment sequence from sequencing data returned by a sequencing company according to forward and reverse primer sequences, and performs comparison analysis on the representative sequence of the provided main citrus cluster and corresponding sequences obtained from an SNP, SSR and Indel combination feature table or a reference sample of the representative sequence. The representative sequence of the main citrus cluster is obtained by summarizing and summarizing based on sequencing and clone analysis of different types of citrus germplasm resource materials collected and stored in a national fruit tree germplasm Chongqing citrus resource garden, and reflects the difference between different citrus cluster materials.

Another object of the present invention is to provide a citrus cluster identification method using the target short sequence amplified by the primer.

Another objective of the invention is to provide a citrus seedling identification method, which uses the target short sequence amplified by the primer.

By combining all the technical schemes, the invention has the advantages and positive effects that: the invention discovers a short DNA sequence containing variable SSR, Indel and/or SNP in a plurality of tests, the sequence shows certain conservation and variation in different citrus clusters, and the citrus clusters can be better distinguished by carrying out genome amplification, cloning, sequencing and comparison analysis on the sequence.

The invention completes the analysis and identification of different materials of citrus fruit trees by clone sequencing of a specific short sequence and comparing the characteristics of SSR, Indel and/or SNP of the sequenced sequence.

The invention obtains the target short sequence by amplifying the citrus genome through the given primer, performs clone sequencing analysis, and can identify the heterozygous state, citrus cluster and citrus seedling of the citrus according to the variation characteristics or variation combination of the fragment SSR, Indel and/or SNP. The technology provided by the patent technology of the invention can identify numerous citrus clusters by only sequence composition analysis of a short sequence, has high reliability, high specificity and good repeatability, and has good application prospect in the aspects of correct storage and reasonable utilization of citrus genetic resources, genetic evolution research, early identification of citrus seedlings and the like. The invention completes the analysis and identification of different materials of citrus fruit trees by cloning and sequencing a section of specific short sequence and comparing the characteristics of the sequenced sequence.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed to be used in the embodiments of the present application will be briefly described below, and it is obvious that the drawings described below are only some embodiments of the present application, and it is obvious for those skilled in the art that other drawings can be obtained from the drawings without creative efforts.

FIG. 1 is a flow chart of the method for applying the short DNA sequence provided by the embodiment of the invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

Aiming at the problems in the prior art, the invention provides a short DNA sequence and application thereof in citrus cluster and citrus seedling identification, and the invention is described in detail below with reference to the accompanying drawings.

The primer sequence provided by the invention is SEQ ID NO: 1: tctcgctgagaatcaaat, respectively; SEQ ID NO: 2: caaggaaaattattcatcac are provided.

As shown in FIG. 1, the application method of the short DNA sequence provided by the invention comprises the following steps:

s101: amplifying citrus genome by a given primer to obtain a target short sequence and carrying out clone sequencing analysis;

s102: according to the variation characteristics or variation combination of the fragment SSR, Indel and/or SNP, the heterozygous state, citrus cluster and citrus seedling of the citrus can be identified.

The invention provides a short DNA sequence containing variable SSR, Indel and/or SNP and application thereof in citrus cluster identification, comprising the following steps:

(1) synthesizing a primer for amplifying the short sequence, wherein the primer sequence is SEQ ID NO: 1: tctcgctgagaatcaaat, respectively; SEQ ID NO: 1: caaggaaaattattcatcac, respectively; the purity requirement of the primer is acrylamide gel electrophoresis purification grade.

(2) Extracting the genome DNA of the citrus material to be analyzed, and amplifying by using a DNA Polymerase Chain Reaction (PCR) to obtain a target short sequence. The PCR system was as follows: 1 XPCR Buffer, 1.5 mmol. L^-1Mg of (2)²⁺，0.2mmol·L^-10.33 nmol.L of dNTPs^-1The upstream primer and the downstream primer of (1), 1U of high fidelity Taq DNA polymerase, about 100ng of DNA template and 50 mu L of total volume. The amplification procedure is pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ of 45s, annealing at 62 ℃ for 40s, extending at 72 ℃ for 45s, and reducing the temperature by 0.5 ℃ for each cycle for 10 cycles; denaturation at 94 ℃ for 45s, annealing at 58 ℃ for 40s, and extension at 72 ℃ for 40s, for 22 cycles; extending for 5min at 72 ℃; finally, the PCR product is stored at 4 ℃.

(3) And adding the amplification product into an agarose gel hole for electrophoresis detection, and recovering the target DNA fragment. Fragment size 150b or so.

(4) And (3) tailing the recovered target DNA fragment, and obtaining a recombinant T vector by adopting a cloning vector pGEM-T-easy. And transforming the connected recombinant T vector into an Escherichia coli competent cell E.coli DH5 alpha. Screening blue white spots, selecting 5-6 white single colonies, shaking and culturing by a LA liquid culture medium at 37 ℃ on a constant temperature shaking table overnight, and sending a bacterial liquid to a sequencing company for sequencing.

(5) And intercepting a target fragment sequence from sequencing data returned by a sequencing company according to the forward and reverse primer sequences, and comparing and analyzing the target fragment sequence with a provided representative sequence of the main citrus cluster and an SNP, SSR and Indel combination characteristic table thereof or corresponding sequences obtained from other samples.

The invention provides a short DNA sequence, a representative sequence of the sequence in a main citrus cluster, a SNP, SSR and Indel combination characteristic table of the representative sequence, and application of the short DNA sequence in citrus seedling identification, variety resource collection, citrus genetic evolution research and citrus cluster identification. The short sequence is widely distributed in different citrus and kindred plants and is defined by a pair of developed primers, wherein the primer sequence is SEQ ID NO: tctcgctgagaatcaaat, respectively; SEQ ID NO: caaggaaaattattcatcac are provided. The length of the short sequence is about 150b, the short sequence contains variable SSR, Indel and/or SNP, the total length of the short sequence, different repeat and repeat quantity of SSR, Indel insertion site difference, SNP and heterozygous/homozygous state, and there is regularity difference in oranges and kindreds. According to the research of the invention, the representative sequences of the main citrus clusters and the SNP, SSR and Indel combined characteristic table thereof are summarized, and the cluster differentiation of citrus trees can be better carried out by comparing the clone sequencing data of the short fragments with the characteristic table.

TABLE 1 representative sequences of major citrus clusters and their SNP, SSR and Indel combination profiles

The technical solution of the present invention is further described with reference to the following specific examples.

Example 1: short sequence analysis of evening orange

1. Synthesizing forward and reverse primers for amplifying the short sequence, and requiring the purification level of acrylamide gel electrophoresis.

2. And extracting genome DNA of the late orange. The improved CTAB method is adopted to extract the genome DNA of the late orange. Detecting the concentration of the extracted DNA by a micro ultraviolet spectrophotometer, detecting the integrity of the extracted DNA by 1% agarose gel electrophoresis, and storing at 4 ℃ for later use.

3. And amplifying by using a DNA Polymerase Chain Reaction (PCR) to obtain the target short sequence. The PCR system was as follows: 1 XPCR Buffer, 1.5 mmol. L^-1Mg of (2)²⁺0.2 mmol. multidot.L-1 of dNTPs, 0.33 nmol. multidot.L^-11U of Takara high fidelity Taq DNA polymerase, and about 100ng of DNA template with a total volume of 50. mu.L. The amplification procedure is pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 45s, annealing at 62 ℃ for 40s, and extension at 72 ℃ for 45s, wherein each cycle is reduced by 0.5 ℃ and 10 cycles; denaturation at 94 ℃ for 45s, annealing at 58 ℃ for 40s, and extension at 72 ℃ for 40s, for 22 cycles; extending for 5min at 72 ℃; finally, the PCR product is stored at 4 ℃.

3. Recovering the target DNA fragment. And adding the amplification product into an agarose gel hole for electrophoresis detection, and recovering the target DNA fragment.

4. Recovering the fragment clone. And (3) tailing the recovered target DNA fragment, and obtaining a recombinant T vector by adopting a cloning vector pGEM-T-easy. And transforming the connected recombinant T vector into an Escherichia coli competent cell E.coli DH5 alpha. Screening blue white spots, selecting 6 white single colonies, shaking and culturing by a LA liquid culture medium at 37 ℃ on a constant temperature shaking table overnight, and sending a bacterial liquid to a sequencing company for sequencing.

6. And (4) carrying out alignment analysis on the target fragments. And the sequencing company returns 6 groups of sequencing data, cuts out a target fragment sequence from the sequencing data according to a primer sequence, inputs the sequence into a word document, analyzes and finds the difference according to the fragment length and the sequence composition, wherein 4 target fragments in the 6 groups are one sequence, and 2 target fragments are the other sequence, so that the short sequence of the late orange is in a heterozygous state.

The two sequences obtained were:

fragment 1 was 155bp in length and was composed of SEQ ID NO: 3: tctcgctgagaatcaaatcgtcacatttttcaccaagtaattaattaagtactcttatagttcattttatacacacacacacacatatatatatgtatatatgtatatatgtatatgagacgctataaattgcgagtgatgaataattttccttg

Fragment 2 is 149bp in length and has the sequence set as SEQ ID NO: 4: tctcgctgagaatcaaatcgtcacatttttcaccaagtaattaattaagtactcttatagttcattttatacacacacacacacacatatatatatgtatatatgtatatgagacgctataaattgcgagtgatgaataattttccttg

Example 2: short sequence analysis of large-minute wenzhou mandarin orange

2. Extracting genome DNA of the great molecular wenzhou mandarin orange. The improved CTAB method is adopted to extract the genome DNA of the citrus unshiu of the greater molecular Wenzhou. Detecting the concentration of the extracted DNA by a micro ultraviolet spectrophotometer, detecting the integrity of the extracted DNA by 1% agarose gel electrophoresis, and storing at 4 ℃ for later use.

6. And (4) carrying out alignment analysis on the target fragments. The sequencing company returns 6 groups of sequencing data, cuts out a target fragment sequence from the primer sequence, inputs the sequence into a word document, analyzes and finds that all sequences have consistent composition, so that the local short sequence of the great molecular wenzhou mandarin orange is very likely to be in a homozygous state.

The sequence obtained was: the fragment was 149bp in length and the sequence set to SEQ ID NO: 5: tctcgctgagaatcaaatcgtcacatttttcaccaagtaattaattaagtactcttatagttcattttatacacacacacacacacatatatatatgtatatatgtatatgagacgctataaattgcgagtgatgaataattttccttg

By comparing the short segments of the late citrus aurantium and the large citrus unshiu, the length and the sequence composition of the short segment of the large citrus unshiu and the short segment 2 of the sweet orange are consistent, but the sequence existing states are different, the large citrus unshiu is homozygous, and the late citrus aurantium is heterozygous.

The technical effects of the present invention will be described in detail with reference to the detection.

Detecting the citrus seedlings:

the detection of the Or and the rootstock, the Or is a new variety of oranges which are developed in large quantity in recent years in China, the accumulated popularization area exceeds one million mu, and at present, many fruit growers still use the Or as an important candidate variety of newly-built orchards, so that seedlings still have great demands. The citrus seedlings consist of scions and rootstocks, the citrus seedlings have strong tree vigor, high yield and long fruit bearing time, and in comparison tests of the rootstocks in some regions, it is found that Ziyang fragrant oranges are suitable rootstocks for kernel citrus and have developed main roots, can better support rapid growth and long-time fruit bearing, and Hovenia dulcis are suitable rootstocks for kernel-free citrus and are beneficial to matching with fruit retention measures and reducing physiological fruit drop of kernel-free citrus. Therefore, the objective requirement of accurately identifying the scions and the stocks of the Or seedlings still exists at present, and the identification is beneficial to fruit growers to select suitable seedlings according to the regional characteristics of the fruit growers, so that the seedling breeders are promoted to keep the seedlings pure, and the basis for government supervision of the seedlings is provided.

Two scion varieties of Or and Damien mandarin orange and two rootstocks of Zingyang fragrant orange and Wangcang Poncirus trifoliata are selected, and experimental detection is carried out on the Or nursery stock.

The experimental procedures and results are as follows.

2. And extracting the genomic DNA of the sample. The improved CTAB method is adopted to extract genome DNA, but two scion varieties of Wo citrus and Qing Jia navel orange adopt leaves, and two rootstocks of Ziyang fragrant orange and Wangcang Ponciri trifoliate adopt thin roots. After DNA extraction, a trace ultraviolet spectrophotometer is adopted to detect the concentration, 1% agarose gel electrophoresis is adopted to detect the integrity of the extracted DNA, and the DNA is stored for standby at 4 ℃.

4. Recovering the fragment clone. And (3) tailing the recovered target DNA fragment, and obtaining a recombinant T vector by adopting a cloning vector pGEM-T-easy. And transforming the connected recombinant T vector into an Escherichia coli competent cell E.coli DH5 alpha. Screening blue white spots, selecting 6 white single colonies from each material, shaking and culturing by a LA liquid culture medium at 37 ℃ on a constant temperature shaking table overnight, and sending bacterial liquid to a sequencing company for sequencing.

6. And (4) carrying out alignment analysis on the target fragments. The sequencing company returns 6 groups of sequencing data of 4 materials, cuts out a target fragment sequence from the sequencing data according to a primer sequence, inputs the sequence into a word document, compares a representative sequence of a main citrus cluster in the table 1 and an SNP, SSR and Indel combined characteristic table thereof, converts the sequence corresponding to the combined characteristic into a capital state, and compares and analyzes the capital state.

7. Two types of sequences were obtained from wakan, 155bp SEQ ID NO: 6 and 149bp of SEQ ID NO: 7. on the combined sequence features: all A and A, but SEQ ID NO: 6 is AC7+ AT5 repeats, multiple TATATG insertions, which should be classified as the CR1 type of Citrus spaghetti; and SEQ ID NO: 7 are AC8+ AT5 repeats and AAG insertions and should be classified as the CR3 type of Citrus spaghetti, so Wo citrus is heterozygous AT this short sequence site.

SEQ ID NO：6：

tctcgctgagaatcaaatcgtcacatttttcaccaagtaattaattaagtactcttatagttcattttatacacacacacacacatatatatatgtatatatgtatatatgtatatgagacgctataaattgcgagtgatgaataattttccttg

SEQ ID NO：7：

tctcgctgagaatcaaatcgtcacatttttcaccaagtaattaattaagtactcttatagttcattttatacacacacacacacacatatatatatgtatataagtatatgagacgctataaattgcgagtgatgaataattttccttg

8. 1 type of sequence is obtained from the great molecular wenzhou mandarin orange, namely 149bp SEQ ID NO: 8. the sequence combinations characterized by A beginning with A, AC8+ AT5 repeats and AAG insertions should be classified as the CR3 type of Citrus spaghetti, and therefore Citrus unshiu is homozygous AT this short sequence site.

SEQ ID NO：8：

tctcgctgagaatcaaatcgtcacatttttcaccaagtaattaattaagtactcttatagttcattttatacacacacacacacacatatatatatgtatatatgtatatgagacgctataaattgcgagtgatgaataattttccttg

9. Sengyang orange gave two types of sequences, 145bp of SEQ ID NO: 8 and 149bp of SEQ ID NO: 9. on sequence combination characteristics: SEQ ID NO: 9 is C starting T, no AC repeat, has (AT)9 and (GT)7 repeats, and should be classified as CY2 type of Yichang orange; SEQ ID NO: 10 is A beginning and A, with AC8+ AT5 repeats and AAG insertions, should be classified as the CR3 type of Citrus spaghetti, so that Ziyang orange is heterozygous AT this short sequence position.

SEQ ID NO：9：

tctcgctgagaatcaaatcgtcacatttttcaccaagtaattaactacgtactcttatagttcattttatacatatatatatatatatatgtgtgtgtgtgtatatgcgacgctataaattgcgtgtgatgaatagttttccttg

SEQ ID NO：10：

10. The trifoliate orange is provided with two types of sequences, 135bp SEQ ID NO: 11 and 145bp of SEQ ID NO: 12. on sequence combination characteristics: SEQ ID NO: 11 is C start T, no AC repetition, contains GTTTA and (TA)5(TG)4 repetition, and should be classified as P1 type of Poncirus trifoliata; SEQ ID NO: 12 is C-first T, has ACAC repetition and (TA)5(TG)8 repetition, and should be classified as P2 type of Poncirus trifoliata, so Poncirus trifoliata is heterozygous at the short sequence site.

SEQ ID NO：11：

tctcgctgagaatcaaatcgtcacatttttcaccaagtaattaattacgtactcttatagttcattttgtttatatatatatatgtgtgtgtatatgcgacgctataaattgcgtgtgatgaataattttccttg

SEQ ID NO：12：

tctcgctgagaatcaaatcgtcacatttttcaccaagtaattaattacgtactcttatagttcattttatacacatatatatatatgtgtgtgtgtgtgtgtatatgcgacgctataaattgcctgtgatgaataattttccttg

12. From the sequence analysis result, two scion varieties are homozygous and heterozygous, although two stocks are heterozygous, the size difference of heterozygous fragments is obvious, and meanwhile, the representative sequences of all 4 varieties are also obviously different on the combination characteristics of SNP (single nucleotide polymorphism), SSR (simple sequence repeat) and Indel (Indel), so that the short sequence clone sequencing of the technology can realize the distinction among the scion varieties, among the stock strains and between the scions and the stocks without objection.

The invention can identify the citrus group and citrus seedling only by cloning and sequencing a section of short sequence and then according to the variation characteristics or variation combination of SSR, Indel and/or SNP of the short sequence. The technology provided by the patent technology of the invention can identify numerous citrus groups only by sequence composition analysis of a short sequence, has high specificity and good repeatability, and has good application prospect in correct storage and reasonable utilization of citrus genetic resources, genetic evolution research, early identification of citrus seedlings and the like.

The above description is only for the purpose of illustrating the present invention and the appended claims are not to be construed as limiting the scope of the invention, which is intended to cover all modifications, equivalents and improvements that are within the spirit and scope of the invention as defined by the appended claims.

Sequence listing

<110> university of southwest

<120> a short DNA sequence, and its application in identification of citrus group and citrus seedling

<141> 2020-06-18

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tctcgctgag aatcaaat 18

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

caaggaaaat tattcatcac 20

<210> 3

<211> 155

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tctcgctgag aatcaaatcg tcacattttt caccaagtaa ttaattaagt actcttatag 60

ttcattttat acacacacac acacatatat atatgtatat atgtatatat gtatatgaga 120

cgctataaat tgcgagtgat gaataatttt ccttg 155

<210> 4

<211> 149

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tctcgctgag aatcaaatcg tcacattttt caccaagtaa ttaattaagt actcttatag 60

ttcattttat acacacacac acacacatat atatatgtat atatgtatat gagacgctat 120

aaattgcgag tgatgaataa ttttccttg 149

<210> 5

<211> 149

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tctcgctgag aatcaaatcg tcacattttt caccaagtaa ttaattaagt actcttatag 60

ttcattttat acacacacac acacacatat atatatgtat atatgtatat gagacgctat 120

aaattgcgag tgatgaataa ttttccttg 149

<210> 6

<211> 155

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tctcgctgag aatcaaatcg tcacattttt caccaagtaa ttaattaagt actcttatag 60

ttcattttat acacacacac acacatatat atatgtatat atgtatatat gtatatgaga 120

cgctataaat tgcgagtgat gaataatttt ccttg 155

<210> 7

<211> 149

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tctcgctgag aatcaaatcg tcacattttt caccaagtaa ttaattaagt actcttatag 60

ttcattttat acacacacac acacacatat atatatgtat ataagtatat gagacgctat 120

aaattgcgag tgatgaataa ttttccttg 149

<210> 8

<211> 149

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tctcgctgag aatcaaatcg tcacattttt caccaagtaa ttaattaagt actcttatag 60

ttcattttat acacacacac acacacatat atatatgtat atatgtatat gagacgctat 120

aaattgcgag tgatgaataa ttttccttg 149

<210> 9

<211> 145

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tctcgctgag aatcaaatcg tcacattttt caccaagtaa ttaactacgt actcttatag 60

ttcattttat acatatatat atatatatat gtgtgtgtgt gtatatgcga cgctataaat 120

tgcgtgtgat gaatagtttt ccttg 145

<210> 10

<211> 149

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tctcgctgag aatcaaatcg tcacattttt caccaagtaa ttaattaagt actcttatag 60

ttcattttat acacacacac acacacatat atatatgtat ataagtatat gagacgctat 120

aaattgcgag tgatgaataa ttttccttg 149

<210> 11

<211> 135

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tctcgctgag aatcaaatcg tcacattttt caccaagtaa ttaattacgt actcttatag 60

ttcattttgt ttatatatat atatgtgtgt gtatatgcga cgctataaat tgcgtgtgat 120

gaataatttt ccttg 135

<210> 12

<211> 145

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tctcgctgag aatcaaatcg tcacattttt caccaagtaa ttaattacgt actcttatag 60

ttcattttat acacatatat atatatgtgt gtgtgtgtgt gtatatgcga cgctataaat 120

tgcctgtgat gaataatttt ccttg 145

Claims

1. Use of a primer in identification of citrus heterozygous state or citrus group, wherein the sequence of the primer is as shown in SEQ ID NO: 1 and SEQ ID NO: 2, the purity requirement of the primer sequence is acrylamide gel electrophoresis purification level.

2. Use of a short sequence of interest in the identification of citrus heterozygous state or citrus group, wherein the short sequence of interest consists of SEQ ID NO: 1 and SEQ ID NO: 2, amplifying the citrus genome.

3. The application of claim 2, wherein the target short sequence is obtained by a method comprising:

(2) adding the amplification product into an agarose gel hole for electrophoresis detection, and recovering a target DNA fragment;

(3) tailing the recovered target DNA fragment, and obtaining a recombinant T vector by adopting a cloning vector pGEM-T-easy; transforming the connected recombinant T vector into an escherichia coli competent cell E.coliDH5 alpha; screening blue white spots, selecting 5-6 white single colonies, shaking and culturing by a LA liquid culture medium at 37 ℃ on a constant temperature shaking table overnight, and sending a bacterial liquid to a sequencing company for sequencing.

4. The use of claim 3, wherein the PCR system is as follows: 1 XPCR Buffer, 1.5 mmol.L-1 Mg 2+, 0.2 mmol.L-1 dNTPs, 0.33 nmol.L-1 upstream and downstream primers, 1U of high fidelity Taq DNA polymerase, 100ng of DNA template, and 50 muL of total volume.

5. The use of claim 3, wherein the PCR amplification procedure is: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 45s, annealing at 62 ℃ for 40s, and extension at 72 ℃ for 45s, wherein each cycle is reduced by 0.5 ℃ and 10 cycles; denaturation at 94 ℃ for 45s, annealing at 58 ℃ for 40s, and extension at 72 ℃ for 40s, for 22 cycles; extending for 5min at 72 ℃; finally, the PCR product is stored at 4 ℃.

6. A method for identifying a citrus heterozygous state, comprising the use of SEQ ID NO: 1 and SEQ ID NO: 2, recovering target amplification product, selecting 5-6 monoclonals, sequencing to obtain two sequences, and obtaining one sequence, wherein the citrus is in heterozygous state.

7. A citrus cluster identification method comprising using SEQ ID NO: 1 and SEQ ID NO: 2, amplifying citrus genome by using the primers shown in the specification, recovering a target amplification product, then selecting 5-6 monoclonals for sequencing, and comparing and analyzing a sequencing result with a representative sequence of a main citrus group and a SNP, SSR and Indel combination characteristic table thereof, wherein the representative sequence of the main citrus group and the SNP, SSR and Indel combination characteristic table thereof are as follows:

thereby identifying the citrus cluster.