CN113881756A

CN113881756A - Quality control product for tumor fusion gene fluorescence in situ hybridization detection and preparation method thereof

Info

Publication number: CN113881756A
Application number: CN202111291652.1A
Authority: CN
Inventors: 韦良慎; 邱凯; 史鹏燕; 魏孝林; 辜依琳; 林欣欣; 郑静贤; 张秀芝
Original assignee: Jingliang Gene Technology Shenzhen Co ltd
Current assignee: Jingliang Gene Technology Shenzhen Co ltd
Priority date: 2021-11-01
Filing date: 2021-11-01
Publication date: 2022-01-04

Abstract

The invention provides a preparation method of a quality control product for tumor fusion gene fluorescence in situ hybridization detection, wherein the preparation method comprises the editing of a fusion gene, and the editing of the fusion gene comprises the following steps: (1) designing a sgRNA near the expected breakpoint of two genes involved in fusion; (2) a recombinant AAV vector is designed to allow homologous recombination and repair of two broken DNAs. The FISH quality control product of the invention obtains a fusion gene cell line with a fusion sequence completely consistent with expectations by gene editing as a raw material, has the advantages of stable and repeated production and capability of ensuring the uniformity and consistency of the quality control product, and avoids the defects of clinical samples or purchasing cell lines naturally carrying the fusion gene as the quality control product.

Description

Quality control product for tumor fusion gene fluorescence in situ hybridization detection and preparation method thereof

Technical Field

The invention belongs to the field of molecular detection, and particularly relates to a quality control product for fluorescence in situ hybridization detection of tumor fusion genes and a preparation method thereof.

Background

Lung cancer is a creditable "cancer king" in terms of the number of cases and the number of deaths. Among them, non-small cell lung cancer (NSCLC) accounts for about 80% -85%.

With the development of precise medicine, the treatment of tumors has entered the age of targeted therapy, and molecular pathology detection is the basis thereof. In the primary lung cancer diagnosis and treatment specifications, the mutation of Epidermal Growth Factor Receptor (EGFR) of tumor tissues is recommended to II-III A-stage NSCLC, N1/N2 positive non-squamous carcinoma patients and small specimen squamous carcinoma patients. For patients with advanced NSCLC, EGFR gene mutation, Anaplastic Lymphoma Kinase (ALK) and ROS1 fusion gene detection of tumor tissues should be performed routinely at the same time of diagnosis, and Braf mutation, c-Met 14 exon skipping mutation, Her-2 mutation, Ret fusion gene and the like and PD-L1 immunohistochemical detection can be performed by conditional persons.

For Chinese non-small cell lung cancer patients, the most clinically valuable targets are EGFR, ALK and ROS 1. The consensus of NCCN and ESMO lung cancer and the consensus of Chinese late non-small cell lung cancer molecular targeted therapy experts are both clear suggestions: before treatment, NSCLC patients should detect EGFR, ALK and ROS1 genes, and determine the corresponding treatment strategy according to the gene status.

Therefore, it is urgent to diagnose mutations of these genes accurately. EGFR mutation can be detected by ARMS-PCR method; ALK fusion gene detection can adopt IHC (immunohistochemistry), FISH (fluorescence in situ hybridization) or RT-PCR methods; the ROS1 fusion gene can be detected by using a RT-PCR or FISH method. However, the research shows that the RT-PCR method for detecting the fusion gene of the fusion clinical sample has higher false negative rate, and the main reasons are that: RT-PCR can only detect known fusion types, but cannot detect unknown fusion partner genes; and the quality of RNA extracted from clinical FFPE samples is poor, and the amplification failure rate is high. Therefore, for detecting ALK and ROS1 fusion genes in lung cancer, FISH is recommended as a standard method for laboratory detection.

Therefore, it is very important to the quality control of FISH detection fusion gene. At present, in the FISH detection, either no quality control product is used, or a known clinical sample or a cell line naturally carrying the fusion gene is purchased as the quality control product. This presents several potential problems: (1) if the quality control product is not used, the accuracy of the result cannot be ensured; (2) if a clinical sample is used as a quality control product, the sample is derived from human tissues with limited quantity, belongs to a disposable material and cannot be stably used for producing the quality control product for a long time; the clinical samples have tissue heterogeneity and non-repeatability, the uniformity and consistency of quality control products cannot be well ensured, and the quality control cannot be stably provided. (3) If cell lines naturally carrying the fusion genes are purchased for preparing quality control products, the sources of the cell lines are very limited, and most fusion genes do not have the naturally carried cell lines; and the cell lines are not monoclonal cells, the background is complex, heterogeneity exists among the cells, and various different FISH hybridization signals are frequently generated.

Disclosure of Invention

In order to solve the problems, the invention cultures, collects, fixes, embeds paraffin and slices the cells with specific fusion genes obtained by a precise induction gene fusion method to prepare FFPE wax sheets which can be used as FISH quality control products of the fusion genes. As the cells capable of being infinitely propagated are used as raw materials, the FISH quality control product has the advantages of stable and repeated production, and capability of ensuring the uniformity and consistency of the quality control product, and avoids the defect that clinical samples are used as the quality control product. Because the gene editing is adopted to obtain the monoclonal cell with the specific fusion gene, the FISH quality control product is not limited by the accessibility of a natural cell line, the cell background is single, the heterogeneity does not exist, and the FISH hybridization signal is homozygous and stable.

Cells carrying a specific fusion gene are obtained by the method of precisely inducing gene fusion of the present invention. This method allows the fusion breakpoint sequence to be identical to the sequence of the native fusion event or the designed fusion event, thereby obtaining a gene-editing cell with a specific fusion gene that is identical to that expected.

In one aspect, the invention provides a preparation method of a quality control product for tumor fusion gene fluorescence in situ hybridization detection.

The preparation method comprises the following steps: editing of the fusion gene.

The preparation method comprises the following steps:

(1) editing the fusion gene;

(2) culturing and collecting cells carrying the fusion gene;

(3) fixing neutral formalin;

(4) fixing and forming the agarose gel solution;

(5) embedding paraffin after dehydration;

(6) slicing, spreading and baking.

The editing of the fusion gene comprises the following steps:

(1) designing a sgRNA near the expected breakpoint of two genes involved in fusion;

(2) a homologous recombination AAV vector is designed to make two broken DNAs undergo homologous recombination and repair.

The sgRNA is in a region within 100bp upstream or downstream of an expected breakpoint of the gene, and the expected breakpoint is in the exon, the exon boundary or an intron region.

Preferably, the sgRNA is selected from SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.13, and SEQ ID NO. 14.

Preferably, the two genes are gene a and gene B, and the homologous recombinant AAV vector comprises two structural regions:

the I region is a homologous left arm, starts from a 100-plus 1000bp region at the upstream of the expected breakpoint of the gene A and ends at the expected breakpoint of the gene A;

region II is the homologous right arm, starting at the expected breakpoint of gene B, and comprises the 100-and 1000-bp region downstream thereof.

Preferably, said homologous recombination AAV vector i region is selected from: SEQ ID NO.10, SEQ ID NO. 21; the homologous recombination plasmid II is selected from the following regions: SEQ ID NO.11, SEQ ID NO. 22.

Preferably, the method for editing the fusion gene comprises the following steps:

(1) designing related sgRNAs, and preparing AAV vectors;

(2) editing gene fusion;

(3) and detecting mRNA of the fusion gene.

Further specifically, the step (2) comprises: the two sgrnas were mixed with Cas9 protein, and cells were transfected by electroporation. After electroporation was complete, cells were infected with recombinant AAV.

Preferably, the mixing ratio of the two sgrnas to the Cas9 protein is 1: 3 (mass ratio); the multiplicity of infection (the ratio of the AAV viral genome copy number to the cell number) of the recombinant AAV was 100000.

Preferably, the fusion gene is a fusion gene COSF408, which is a fusion between the 13 th intron sub-partial region of the EML4 gene (ENST00000318522.10) and the 19 th intron of the ALK gene (ENST 00000389048.8); sgRNA1 for EML4 gene: SEQ ID No. 2; sgRNA2 for the ALK gene: SEQ ID No. 3; the sequence of the homologous recombination AAV vector I region is SEQ ID NO. 10; the sequence of the II area is SEQ ID NO. 11.

Preferably, the fusion gene is a fusion gene COSF1196, which is a fusion between exon 4 of SLC34A2 gene (ENST00000382051.8) and exon 32 of ROS1 gene (ENST 00000368507.8); sgRNA1 for SLC34a2 gene: SEQ ID No. 13; sgRNA2 against ROS1 gene: SEQ ID No. 14; the sequence of the homologous recombination AAV vector I area is SEQ ID NO.21, and the sequence of the II area is SEQ ID NO. 22.

The gene editing method is characterized in that on the basis of CRISPR/Cas9, sgRNAs are respectively designed near expected breakpoints of two genes (gene A and gene B) participating in fusion, namely sgRNA1 and sgRNA2, and simultaneously, a homologous recombination AAV vector is designed. The method utilizes sgRNA1 and sgRNA2 to guide the cleavage of Cas9 protein on gene a and gene B, and simultaneously causes the breakage of two DNA sites. In the presence of the homologous recombination AAV vector, the two broken DNAs are subjected to homologous recombination and repair, so that the breakpoint is accurately introduced. Further, the Cre recombinase is used to delete the resistance selection gene and the fluorescent protein coding gene, so as to obtain a fusion gene containing an accurate breakpoint sequence, as shown in fig. 1.

In another aspect, the invention provides a quality control product for fluorescence in situ hybridization detection of tumor fusion genes.

The quality control product is prepared by the preparation method.

Preferably, the quality control product is a fusion of an SLC34A2 gene and an ROS1 gene.

Preferably, the quality control product is a fused quality control product of an EML4 gene and an ALK gene.

In still another aspect, the invention provides the application of the preparation method and/or the quality control product in preparing a reagent and/or a kit for tumor fusion gene fluorescence in situ hybridization detection.

In another aspect, the invention provides a kit for detecting the fluorescence in situ hybridization of the tumor fusion gene.

The kit comprises the quality control product.

The kit also comprises other reagents for detecting the tumor fusion gene by fluorescence in situ hybridization.

The invention has the beneficial effects that:

1. a tumor fusion gene cell line with a fusion sequence completely consistent with the expectation is obtained by a novel fusion gene editing method.

2. The cell line obtained by gene editing is used for preparing the FISH quality control product, can realize infinite stable propagation, realizes long-term stable production of the quality control product, and overcomes the limitation of adopting human tissue sample sources.

3. The prepared FISH quality control product can be used for carrying out quality control on the FISH detection process, and the accuracy of FISH detection is improved.

Drawings

FIG. 1 shows a scheme adopted in the gene fusion editing in the present invention.

FIG. 2 shows the results of Sanger sequencing of correct cell clones with DNA level fusion of the EML4 gene and ALK gene.

FIG. 3 shows the results of Sanger sequencing of correct cell clones with RNA level fusions of the EML4 gene and the ALK gene.

FIG. 4 shows the results of Sanger sequencing of the SLC34A2 gene fused to the ROS1 gene DNA level in the correct cell clone.

FIG. 5 shows the results of Sanger sequencing of the SLC34A2 gene fused to the RNA level of the ROS1 gene in the correct cell clone.

FIG. 6 shows the result of electrophoresis of the PCR product in example 3.

FIG. 7 is a diagram showing the distribution of cells in the fused gene FISH quality control section.

FIG. 8 is a FISH detection map of fused cells.

Detailed Description

The present invention will be further illustrated in detail with reference to the following specific examples, which are not intended to limit the present invention but are merely illustrative thereof. The experimental methods used in the following examples are not specifically described, and the materials, reagents and the like used in the following examples are generally commercially available under the usual conditions without specific descriptions.

Example 1 preparation method of quality control product for fluorescence in situ hybridization detection of tumor fusion gene

Comprises the following steps

(1) Design of fusion genes

COSF408 is the fusion between the 13 th intron subregion of the EML4 gene (ENST00000318522.10) and the 19 th intron of the ALK gene (ENST00000389048.8), and 200bp sequences of the upstream and downstream of an expected breakpoint are respectively selected for display, and the sequences are shown as SEQ ID No.1 and specifically as follows:

cccctcagcccctaggtaaccaccaatttcctttaggtctctatagatttacttgttgatgacatttcatataaatggagtcatacaatgtgtggtcttttatgacttgcttctttcacttagttttttttgttttgttttgtttgtttgttttttgagatggagtttcactcttgttgcccaggctggagtgcagtggt//ctgatttttagctttgca tttactttaaatcatgcttcaattaaagacacaccttctttaatcattttattagtatttctaagtatgatggaaa ggttcagagctcaggggaggatatggagatccagggaggcttcctgtaggaagtggcctgtgtagtgcttcaaggg ccaggctgccaggccatgttgcagctgacc

the sequence is in italics the sequence of the EML4 gene, underlined the ALK gene sequence, "//" the expected breakpoint location of the fusion gene.

Referring to the requirements of fig. 1, specifically: the sgRNA for the upstream gene EML4 and the sgRNA for the downstream gene ALK are in regions within 100bp upstream or downstream of the expected breakpoint of the two genes, respectively.

Aiming at the two genes, two sgrnas are respectively designed, which are respectively as follows:

sgRNA1 for EML4 gene: SEQ ID No. 2;

sgRNA2 for the ALK gene: SEQ ID No. 3;

the sgRNA was directly obtained by a chemical synthesis method, and the sgRNA of this example was synthesized by tassel corporation.

The primers were designed as follows:

F1：SEQ ID NO.4；

R1：SEQ ID NO.5；

F2：SEQ ID NO.6；

R2：SEQ ID NO.7；

Fa：SEQ ID NO.8；

Rb：SEQ ID NO.9；

with reference to the requirements of fig. 1: region I, homologous left arm, starts at the 100-and 1000-bp region upstream of the expected breakpoint of EML4 and ends at the expected breakpoint of EML 4; region II, homologous right arm, the expected breakpoint begins at the expected breakpoint of ALK, including the 100-bp region downstream thereof.

Synthesizing and preparing homologous recombination AAV vector.

Wherein, the sequence of the I region is as follows: SEQ ID No. 10;

the sequence of the II region is: SEQ ID No. 11;

preparation of recombinant AAV vectorThe method comprises the following steps: a) according to the design of the recombinant vector, a recombinant AAV expression plasmid was constructed by the following method: the I area and the II area on the vector are synthesized by a chemical synthesis method, and are connected to a pAAV-CMV-GFP-WPRE plasmid (Yunzhou organism, China) after XbaI/NdeI double enzyme digestion. The ligation products were transformed into T1 competent cells (purchased from Okinawa gold, China), bacterial clones were identified by PCR, and correctly ligated clones were selected. The correct clone is expanded and extracted to obtain large amount of high purity plasmid. Adding 1-3 μ g of pAAV helper plasmid (purchased from GeneMedi, China), 1-3 μ g of pAAV9 Rep-Cap plasmid (purchased from GeneMedi, China) and 1-3 μ g of expression plasmid into 20 μ L of Lipofactamine 3000 (purchased from Life technologies, USA), mixing, and standing at room temperature for 10 min; adding the reagent to 2X 10⁶The cell culture was continued in HEK293T cells. b) Transfection was carried out for 72h, the supernatant was collected and filtered using a 0.22 μm filter. c) Collection of AAV viruses: 10mL of 40% sucrose was added to an ultracentrifuge tube, and the cell supernatant was then added to the tube and ultracentrifuged (30000rpm, 3h) at 4 ℃. After centrifugation, the supernatant was carefully discarded, and AAV virus was resuspended in an appropriate amount of PBS solution. Subpackaging the virus solution, and storing at-80 deg.C for long term.

(2) Editing of gene fusions

The two sgrnas were separately contacted with Cas9 protein (purchased from Life technologies, cat # a36498) according to 1: 3 (mass ratio), standing at room temperature for 10min to respectively form ribonucleoprotein complex RNP1 and RNP 2. Mixing RNP1, RNP2, 1 μ g of homologous recombinant plasmid, and 0.5 × 10⁶The cells are mixed and transfected by adopting an electroporation method, and the specific transfection conditions are as follows: 420V, 30 ms.

After the electroporation is finished, the prepared recombinant AAV is mixed with the cells according to the multiplicity of infection of 100000, namely 0.5X 10¹¹The recombinant AAV was copied and added to the cells, and cultured for 24 hours. The cells were single cell cloned as follows: a) the cells were digested and collected. b) According to the method of multiple ratio dilution, the cells are accurately counted,viable cells were diluted to 5/mL with medium and the cells were mixed well. c) 10mL of the cell suspension was dispensed evenly into a 96-well plate, 0.1mL per well.

Culturing the cells in a cell culture box, adding a small amount of TrypLE Express enzyme (10 mu L, purchased from Life technologies, Inc., with the product number of 12604021) to digest the cells when the cell clones are formed, taking part of the cells as an amplification template, and respectively amplifying the clones by using primer pairs F1/R1 and F2/R2 and carrying out Sanger sequencing verification; and (5) performing expanded culture on the rest cells for later use.

(3) Detection of fusion gene mRNA

And (3) carrying out amplification culture on the clone obtained in the step (3), extracting RNA and reverse transcription of the cell, carrying out PCR amplification by using cDNA as a template and adopting primers Fa and Rb, wherein a target amplification product is a fusion gene mRNA sequence, and sanger sequencing detects whether the fusion of the fusion gene at the RNA level is accurate.

As shown in FIG. 3, the method provided by the present invention can accurately connect the breakpoints occurring between exons and ensure the sequence at DNA level and RNA level to be accurate.

(4) The EML4-ALK fusion cell line was cultured to 10⁸In order of magnitude and in logarithmic growth phase, cells were collected by centrifugation.

(5) Cells were fixed with 10% neutral formalin for 24 h. After cell fixation, the cells were resuspended in 70% (v/v) ethanol and the remaining formalin solution was washed away.

(6) Mixing the fixed cell suspension with the agarose gel solution with the same volume, and fixing and molding.

(7) And (4) performing dehydration treatment by using a Leica full-automatic dehydrator.

(8) And (3) dehydrating the cell clusters, putting the cell clusters into an embedding mold, and embedding paraffin by using a come Histocore Archardia H + C embedding machine. The embedded wax block is placed on a come card RM2255 paraffin slicer for slicing to a thickness of 3-5 μm.

(9) The sections were spread on water at 37 ℃ and spread.

(10) And fishing the slices onto an anti-drop glass slide, and baking the slices until the slices are dried.

Obtaining the cell paraffin embedded wax sheet, namely the fusion gene FISH quality control product.

Example 2 a method for preparing a quality control for use in fluorescence in situ hybridization detection of tumor fusion gene the method for preparing a quality control of example 1 was referred to, except that COSF408 was replaced with COSF 1196.

COSF1196 is the fusion between the 4 th exon of SLC34A2 gene (ENST00000382051.8) and the 32 th exon of ROS1 gene (ENST00000368507.8), and 200bp sequences at the upstream and downstream of the expected breakpoint are respectively selected for display, and the sequences are shown as SEQ ID NO.12, and specifically as follows: aacttctcagggtttccaacactaaaagtttcatgcctttctctctctccccccatcccacccccctgcagAGAGAGACACCAAAGGGAAGATTCTCTGTTTCTTCCAAGGGATTGGGAGATTGATTTTACTTCTCGGATTTCTCTACTTTTTCGTGTGCTCCCTGGATATTCTTAGTAGCGCCTTCCAGCTGGTTGGAG/orCTGGAGTCCCAAATAAACCAGGCATTCCCAAATTACTAGAAGGGAGTAAAAATTCAATACA GTGGGAGAAAGCTGAAGATAATGGATGTAGAATTACATACTATATCCTTGAGATAAGgtatgtgtgtttgcaaagt acttgtaaatgacaaagaactaagaagataattataaagtaatcaaaagtaacactatttatg

The sequence is the SLC34A2 gene sequence in italic, the ROS1 gene sequence in underlined, "//" is the expected breakpoint position of the fusion gene, with exons in upper case and introns in lower case.

Aiming at SLC34A2 gene and ROS1 gene, two sgRNAs are respectively designed, namely:

sgRNA1 for SLC34a2 gene: SEQ ID No. 13;

sgRNA2 against ROS1 gene: SEQ ID No. 14;

the primers were designed as follows:

F1：SEQ ID NO.15；

R1：SEQ ID NO.16

F2：SEQ ID NO.17

R2：SEQ ID NO.18

Fa：SEQ ID NO.19

Rb：SEQ ID NO.20。

with reference to figure 1 requirements: region I, homologous left arm, starts at the 100-and 1000-bp region upstream of the SLC34A2 expected breakpoint and ends at the SLC34A2 expected breakpoint; region II, the homologous right arm, the expected breakpoint begins at the expected breakpoint of ROS1, including the 100-and 1000-bp region downstream thereof.

Wherein, the sequence of the I region is as follows: SEQ ID No. 21;

the sequence of the II region is: SEQ ID NO. 22.

As shown in FIG. 4, the correct cell clone obtained by screening, which contains the accurate breakpoint of SLC34A2 gene and ROS1 gene, is consistent with the expected sequence and the effect designed in FIG. 1.

As shown in FIG. 5, the method provided by the present invention can accurately connect the breakpoints occurring between exons and ensure that the sequences at the DNA level and RNA level are accurate.

Example 3 RT-PCR detection of fusion Gene FISH quality control

1. RNA of the fusion gene FISH quality control wax plate is extracted by using QIAGEN RNeasy FFPE Kit instructions. The specific operation is as follows:

1) scraping wax sheets of the FISH quality control products, and placing the FISH quality control products into a 15mL centrifuge tube.

2) Paraffin was removed with a dewaxing agent.

3) The colorless lower phase was transferred to a new 2mL centrifuge tube.

4) After incubation on ice for 3min, centrifugation at 20000 Xg was carried out for 15 min.

5) The supernatant was transferred to a new centrifuge tube, taking care not to touch the pellet.

6) Approximately 1/10 sample volumes of DNase Booster Buffer were added, along with 10. mu.L of DNase I stock solution. And inverting the centrifuge tube upside down to mix the liquid. Simple centrifugation to collect the residual liquid on the tube wall.

7) Incubate at room temperature for 15 min.

8) Add 320. mu.L Buffer RBC and mix the lysates thoroughly.

9) 720 μ L of 100% ethanol was added to the sample, which was mixed well with the tip and immediately proceeded to the next step.

10) Transfer 700. mu.L of sample (including any sediment that may be present) onto RNeasy MinElute spin column. The collection tube was capped, centrifuged at 28000 Xg for 15s, and the collection liquid was discarded from the collection tube.

11) And repeating the steps until all the previous samples are processed.

12) Add 500. mu.L Buffer RPE to RNeasy MinElute spin column. Carefully cap the collection tube, centrifuge at 28000 Xg for 15s, and discard the collection from the tube.

13) Add 500. mu.L Buffer RPE to the RNeasy mini spin column, cover the collection tube, centrifuge at 28000 Xg for 2min, and discard the tube.

14) RNeasy MinElute spin column was placed in a new 2mL collection tube, the lid opened, the tube centrifuged at full speed for 5min, and the tube discarded.

15) RNeasy Min Elute spin column was placed in a new 1.5mL collection tube, 14-30. mu.L of RNase-free water was added directly to the membrane of the spin column, the lid was carefully closed, the tube was centrifuged at full speed for 1Min, and the eluate was collected.

2. RT-PCR detection of RNA expression

1) The extracted RNA was subjected to concentration measurement using a Qubit.

2) 100ng of the extracted RNA was taken and reverse-transcribed into cDNA using reverse transcriptase. RNA extracted from a background cell line prior to gene editing was used as a negative control and was also reverse transcribed to cDNA.

3) The PCR reaction was performed using Takara Premix Ex Taq enzyme. The PCR reaction solution is prepared according to the following system:

reagent	Amount of addition
		Premix Ex Taq	25μL
cDNA template	20ng
		Primer 1	1μL
Primer 2	1μL
		Sterilized water	To 50 μ L

Wherein the primer sequences and PCR product related information for EML4-ALK fusion and SLC34A2-ROS1 fusion are as follows:

the PCR procedure was as follows:

the results are as follows:

and (3) carrying out agarose gel electrophoresis on the PCR product, wherein the result is shown in figure 6, A is the detection result of the RT-PCR gel fused with EML4-ALK, and B is the detection result of the RT-PCR gel fused with SLC34A2-ROS 1. Wherein the lane M is 100bp ladder, the bands are respectively 100bp, 200bp, 300bp and 400bp from bottom to top, and so on. Lane "+" is RT-PCR detection band of fusion gene cell line, and lane "-" is RT-PCR detection band of gene editing background cell line. As can be seen, the PCR bands corresponding to the expected sizes appear in the lanes "+" while those do not appear in the lanes "-" as a negative control. The gene-edited EML4-ALK fusion cell line successfully and correctly expresses EML4-ALK fusion RNA, and the gene-edited SLC34A2-ROS1 fusion cell line also successfully and correctly expresses SLC34A2-ROS1 fusion RNA.

Example 4 HE staining of fusion Gene FISH quality controls

The method comprises the following specific steps:

1) and (3) drying the quality control slide in an oven at 70 ℃ for 10 min.

2) Xylene I dewaxed for 5 minutes and xylene II dewaxed for 5 minutes.

3) The mixture is washed sequentially with absolute ethyl alcohol for 2 minutes, 90% ethyl alcohol for 1 minute, 80% ethyl alcohol for 1 minute, 70% ethyl alcohol for 1 minute and water for 1 minute.

4) Hematoxylin staining solution (Harris) for 5 minutes, 1% hydrochloric acid ethanol differentiation section for 5 seconds, tap water reverse blue for 5 minutes, and eosin staining solution (water soluble) for 30 seconds.

5) 80% ethanol for 1 minute, 95% ethanol for 2 times each for 1 minute, and anhydrous ethanol for 2 times each for 1 minute. The xylene is clear 2 times for 5 minutes each. And (5) sealing the resin sheet, and finally performing microscopic examination under a microscope.

Microscopic examination results: the cells in the prepared fusion gene FISH quality control product section are uniformly distributed. FIG. 7 shows that A is the cell distribution of the EML4-ALK fusion FISH quality control product section seen under a 200-fold microscope, B is the cell distribution of the EML4-ALK fusion FISH quality control product section seen under a 400-fold microscope, C is the cell distribution of the SLC34A2-ROS1 fusion FISH quality control product section seen under a 200-fold microscope, and D is the cell distribution of the SLC34A2-ROS1 fusion FISH quality control product section seen under a 400-fold microscope.

Example 5 FISH detection of quality control articles (Vysis 6q22 ROS1 Break Apart)

The operation is carried out by referring to the operation instruction of a Vysis FISH kit, and the specific steps are as follows:

(1) dewaxing the slide

1) The slides were immersed in Hemo-De for 10 minutes at room temperature.

2) This was repeated twice, each time with a new Hemo-De.

3) The slide was dehydrated in absolute ethanol at room temperature for 5 minutes.

4) And (5) repeating the step (3).

5) Air-dry the slide or place the slide in a slide heater at 45-50 ℃ for 2-5 minutes.

(2) Pretreatment slide

HCl helps to solubilize the basic nucleoprotein, making the probe more accessible to DNA. HCl is also used to extract extracellular matrix proteins, which can limit the accessibility of probes to cells and cause tissue autofluorescence. The pre-treatment buffer aids in the denaturation of proteins and the removal of cross-links between proteins. This is important to allow for adequate protease digestion.

1) The slide was immersed in 0.2N hydrochloric acid for 20 minutes.

2) The slide was immersed in purified water for 3 minutes.

3) The slides were immersed in the wash buffer for 3 minutes.

4) The slides were immersed in the pretreatment solution at 80 ℃ for 30 minutes.

5) The slide was immersed in purified water for 1 minute.

6) The slides were immersed in the wash buffer for 5 minutes. Repeat using a second staining jar containing wash buffer.

(3) Treatment of slides with protease

Proteases are capable of digesting tissue proteins and are essential for the accessibility of probes to target DNA.

1) Remove the slide from the second jar of wash buffer and press the slide edge against a paper towel to remove excess buffer.

2) The slides were immersed in a protease solution at 37 ℃ for 10 minutes.

3) The slides were immersed in the wash buffer for 5 minutes. Repeat using a second staining jar containing wash buffer.

4) The slides were dried by placing them on a slide heater at 45-50 ℃ for 2-5 minutes.

(4) Fixing sample

Sample fixation ensures that tissue loss during denaturation and hybridization is minimized.

1) The slides were immersed in 10% buffered formalin solution at room temperature for 10 minutes.

2) The slides were immersed in the wash buffer for 5 minutes. Repeat using a second staining jar containing wash buffer.

3) The slides were dried by placing them on a slide heater at 45-50 ℃ for 2-5 minutes.

(5) Denaturing the sample

1) Slides were immersed in pre-heated 72 ± 1 ℃ (<6 slides/cylinder) denaturing solution for 6 minutes.

2) Dehydration in 70%, 85% and 100% absolute ethanol, each for 1 minute.

3) Dried on a glass slide heater at 45-50 ℃ for 2-5 minutes.

(6) Hybridization of

1) The probe was preheated to room temperature, vortexed and spun down.

2) 10mL of probe mixture was added to the sample area of the slide.

3) A22X 22mm coverslip was covered and its edges were sealed with rubber adhesive.

4) Slides were placed in a preheated, humidified box with a sealed lid and placed in a 37 ℃ incubator overnight (14-18 hours).

(7) Post-hybridization washes

1) Post-hybridization wash buffer was added to each of the two Coplin staining jars. One of the cylinders was preheated in a water bath at 72 + -1 deg.C, and the other was left at room temperature.

2) The sealant was gently pulled with forceps to remove the rubber adhesive seal from the slide.

3) The slides were immersed in post-hybridization wash buffer at room temperature and the coverslips were allowed to float open.

4) Excess liquid was aspirated from the slide edge and the slide was immersed in post-hybridization wash buffer at 72 ± 1 ℃ for 2min (<6 slides/cylinder).

5) Slides were removed from the wash buffer and allowed to air dry vertically in the dark.

(8) Counterstain and slide storage

10 μ L of DAPI counterstain was placed on the target area of the slide and covered with a coverslip. Observation was performed using a fluorescence microscope.

The results are as follows:

the EML4-ALK fusion cell line counted 50 cells, 44 positive cells, 88% positive/assay cells, and rearranged the ALK gene.

The SLC34a2-ROS1 fusion cell line counted 50 cells, 47 positive cells, 94% positive cells/analyzed cells, and ROS1 gene rearranged.

FISH detection of fused cells is shown in FIG. 8, where A is the FISH detection of EML4-ALK fused cells and B is the FISH detection of SLC34A2-ROS1 fused cell line.

Sequence listing

<110> Jingliang Gene technology (Shenzhen) Limited

<120> quality control product for tumor fusion gene fluorescence in situ hybridization detection and preparation method thereof

<160> 26

<170> SIPOSequenceListing 1.0

<210> 1

<211> 400

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 1

cccctcagcc cctaggtaac caccaatttc ctttaggtct ctatagattt acttgttgat 60

gacatttcat ataaatggag tcatacaatg tgtggtcttt tatgacttgc ttctttcact 120

tagttttttt tgttttgttt tgtttgtttg ttttttgaga tggagtttca ctcttgttgc 180

ccaggctgga gtgcagtggt ctgattttta gctttgcatt tactttaaat catgcttcaa 240

ttaaagacac accttcttta atcattttat tagtatttct aagtatgatg gaaaggttca 300

gagctcaggg gaggatatgg agatccaggg aggcttcctg taggaagtgg cctgtgtagt 360

gcttcaaggg ccaggctgcc aggccatgtt gcagctgacc 400

<210> 2

<211> 20

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 2

gagtttcact cttgttgccc 20

<210> 3

<211> 20

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 3

actaataaaa tgattaaaga 20

<210> 4

<211> 20

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 4

caagcaagcc ctttcctgtc 20

<210> 5

<211> 23

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 5

gttatgtaac gcggaactcc ata 23

<210> 6

<211> 24

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 6

ccaccaattt cctttaggtc tcta 24

<210> 7

<211> 19

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 7

ggagagccct ggttctcct 19

<210> 8

<211> 22

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 8

ggggaatgga gatgttctta ct 22

<210> 9

<211> 18

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 9

gggcattccg gacacctg 18

<210> 10

<211> 500

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 10

tagcatactc aaactgagac ataatttttt ttaggatacc aaagccttag aaattttagt 60

caatttgtta agtataatag cagctcaaat agatgagtaa aaaagaacaa tctcagtaac 120

aacttcgata tataattcac ataccatgaa atctaccctg ttgaagtatg cctttaagtt 180

cagtggtttt tagtatattt acaaggttgt gcagccatca ccactatctg acctaaggac 240

attttcatca ccccaaaaag aaagcctgta cccattagta gtcactttct atttctccct 300

cccctcagcc cctaggtaac caccaatttc ctttaggtct ctatagattt acttgttgat 360

gacatttcat ataaatggag tcatacaatg tgtggtcttt tatgacttgc ttctttcact 420

tagttttttt tgttttgttt tgtttgtttg ttttttgaga tggagtttca ctcttgttgc 480

ccaggctgga gtgcagtggt 500

<210> 11

<211> 500

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 11

ctgattttta gctttgcatt tactttaaat catgcttcaa ttaaagacac accttcttta 60

atcattttat tagtatttct aagtatgatg gaaaggttca gagctcaggg gaggatatgg 120

agatccaggg aggcttcctg taggaagtgg cctgtgtagt gcttcaaggg ccaggctgcc 180

aggccatgtt gcagctgacc acccacctgc agtgtaccgc cggaagcacc aggagctgca 240

agccatgcag atggagctgc agagccctga gtacaagctg agcaagctcc gcacctcgac 300

catcatgacc gactacaacc ccaactactg ctttgctggc aagacctcct ccatcagtga 360

cctgaaggag gtgccgcgga aaaacatcac cctcattcgg tgagcgccct gctgccgtcc 420

tgggaggaga ggggtgcagt gtaggggctg aatgttatca cagcaccgca gactcctcta 480

gccacaaaag gccggcagag 500

<210> 12

<211> 400

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 12

aacttctcag ggtttccaac actaaaagtt tcatgccttt ctctctctcc ccccatccca 60

cccccctgca gagagagaca ccaaagggaa gattctctgt ttcttccaag ggattgggag 120

attgatttta cttctcggat ttctctactt tttcgtgtgc tccctggata ttcttagtag 180

cgccttccag ctggttggag ctggagtccc aaataaacca ggcattccca aattactaga 240

agggagtaaa aattcaatac agtgggagaa agctgaagat aatggatgta gaattacata 300

ctatatcctt gagataaggt atgtgtgttt gcaaagtact tgtaaatgac aaagaactaa 360

gaagataatt ataaagtaat caaaagtaac actatttatg 400

<210> 13

<211> 20

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 13

tcttagtagc gccttccagc 20

<210> 14

<211> 20

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 14

tgggaatgcc tggtttattt 20

<210> 15

<211> 20

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 15

gtatgatgcc ccaagccctc 20

<210> 16

<211> 23

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 16

gttatgtaac gcggaactcc ata 23

<210> 17

<211> 22

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 17

gctctgagct cattgccaaa ct 22

<210> 18

<211> 20

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 18

gctgttcatc agtggctggt 20

<210> 19

<211> 21

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 19

gccagacagc tggatgcaag c 21

<210> 20

<211> 23

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 20

tgcagctact actctgaact gaa 23

<210> 21

<211> 510

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 21

agccattatc tccgaccctg cacttagcag gtggctagtg ctgtcaactg cctcactcag 60

tgacactgtg gctcagctga gcatggagcc tggtttttct gtcgcagacc acattgaacc 120

cctcctccca aacgcaaatc ctttagaggc actttaccag gggtttcagc taaatggacc 180

acagcggtaa ctgctttgaa agctgcagcg atggctgctt cccatctgta aggctggcta 240

gacataagaa cttaacggct gccaggctgg gaagggaggg gaggtcgggg gagctctgag 300

ctcattgcca aacttctcag ggtttccaac actaaaagtt tcatgccttt ctctctctcc 360

ccccatccca cccccctgca gagagagaca ccaaagggaa gattctctgt ttcttccaag 420

ggattgggag attgatttta cttctcggat ttctctactt tttcgtgtgc tccctggata 480

ttcttagtag cgccttccag ctggttggag 510

<210> 22

<211> 500

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 22

ctggagtccc aaataaacca ggcattccca aattactaga agggagtaaa aattcaatac 60

agtgggagaa agctgaagat aatggatgta gaattacata ctatatcctt gagataaggt 120

atgtgtgttt gcaaagtact tgtaaatgac aaagaactaa gaagataatt ataaagtaat 180

caaaagtaac actatttatg caaatgtatt tatatacaaa cacaaagatc tttagttaaa 240

ggactcacat gcatcattac gttctttgct caattcctag acgttggtct tggcatgcta 300

attataaaca gatcacgtca ttctcagaaa tctctaactg ctcattgaca ctttatggaa 360

attgtttgat cataggctca tgcaaccagt attaacttaa tatcagtttt gtttaaaaag 420

cttagctgat gtttaatgtt aaataatgat ggcatgtaaa ttcctgatga taatttgctt 480

tagcaaggtg aatactctct 500

<210> 23

<211> 20

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 23

ggagcggcaa ttcactaaca 20

<210> 24

<211> 20

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 24

tgctcagctt gtactcaggg 20

<210> 25

<211> 20

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 25

cttctgccgt cctactccac 20

<210> 26

<211> 21

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 26

tggacttcca tgtgcaaaca c 21

Claims

1. A preparation method of a quality control product for tumor fusion gene fluorescence in situ hybridization detection is characterized by comprising the following steps: editing the fusion gene; the editing of the fusion gene comprises the following steps:

(2) a recombinant AAV vector is designed to allow homologous recombination and repair of two broken DNAs.

2. The method of claim 1, wherein the sgRNA is located within 100bp upstream or downstream of an expected breakpoint of a gene, the expected breakpoint being within an exon, an exon boundary, or an intron region.

3. The method of claim 2, wherein the sgRNA is selected from the group consisting of SEQ ID No.2, SEQ ID No.3, SEQ ID No.13, and SEQ ID No. 14.

4. The method of claim 3, wherein the two genes are Gene A and Gene B, and the recombinant AAV vector comprises two domains:

5. The method of claim 4, comprising the steps of:

(1) editing the fusion gene;

(2) culturing and collecting cells carrying the fusion gene;

(3) fixing neutral formalin;

(4) fixing and forming the agarose gel solution;

(5) embedding paraffin after dehydration;

(6) slicing, spreading and baking.

6. A method for editing a fused gene, comprising the method for editing a fused gene according to claim 1; the fusion gene is the fusion of SLC34A2 gene and ROS1 gene or the fusion of EML4 gene and ALK gene.

7. A quality control product for the fluorescence in situ hybridization detection of tumor fusion genes, which is prepared by the preparation method of any one of claims 1 to 6.

8. Use of the preparation method of any one of claims 1-6 and/or the quality control product of claim 7 in the preparation of a reagent and/or a kit for the fluorescent in situ hybridization detection of tumor fusion genes.

9. A kit for detecting tumor fusion gene by fluorescence in situ hybridization, which is characterized by comprising the quality control product of claim 7.

10. The kit of claim 9, wherein the kit further comprises other reagents for fluorescence in situ hybridization detection.