CN113881697A

CN113881697A - Method for efficiently transforming plasmids in plant protoplast and application thereof

Info

Publication number: CN113881697A
Application number: CN202111326841.8A
Authority: CN
Inventors: 夏新莉; 王厚领; 牛梦雪; 封丛华; 刘晓; 刘美莹
Original assignee: Beijing Forestry University
Current assignee: Beijing Forestry University
Priority date: 2021-11-10
Filing date: 2021-11-10
Publication date: 2022-01-04
Anticipated expiration: 2041-11-10
Also published as: CN113881697B

Abstract

The invention relates to a method for efficiently transforming plasmids in plant protoplasts and application thereof, which utilizes PEG/Ca with specific ratio²⁺And (3) incubating the protoplast of the plant dissociated by the enzymatic hydrolysate with exogenous DNA plasmid, so that the exogenous gene can be obviously expressed. The invention has great application value for cultivating new plant germplasm in the field of genetic engineering by introducing exogenous genes into plant protoplasts.

Description

Method for efficiently transforming plasmids in plant protoplast and application thereof

Technical Field

The invention relates to the field of plant genetic engineering, in particular to a method for efficiently transforming plasmids in plant protoplasts and application thereof.

Technical Field

The poplar is a main artificial forest planting tree species in the yellow river basin of China, is widely planted in northern areas of China due to rapid growth, drought resistance, barren resistance and beautiful tree shape, is a main tree species for landscape greening of urban streets and expressways, is also an important tree species for maintaining and controlling wind prevention, sand fixation and returning to farming in ecological environment, and plays an important role in forestry industries such as wood processing, paper making and the like. At present, the total area of poplar artificial forests in China is 850 million hectares, which exceeds 1 hundred million acres (2018 data), and the poplar artificial forests are the first place in the world. However, the traditional poplar seedling breeding has the defects of long breeding period and difficulty in performing diversified integration on excellent characters, and simultaneously has the defect of relatively single high-quality variety, so that the diversified requirements of our country on ecological construction, vegetation recovery and forest carbon sink capacity increase are difficult to meet.

Eucalyptus is an economic tree species widely planted in Guangxi, Guangdong, Fujian and other places in south China, contributes to more than one third of wood yield in China every year, and plays a key supporting role in maintaining wood safety in China and building strategic stock bases of wood. Only Guangxi province of China, the planting area reaches more than 3000 mu and ten thousand mu, the wood yield is more than 2500 million cubic meters, and the economic benefit scale reaches more than 4700 hundred million. Meanwhile, the eucalyptus absorbs more than 8.5 hundred million tons of carbon dioxide every year in the aspects of emission reduction and carbon absorption and environmental protection, and also makes great contribution to the environmental protection industry of China. However, eucalyptus is covered by the external numbers of a water pump and a fertilizer extractor in the development process, because eucalyptus grows rapidly, and the demand for water and fertilizer is great. How to cultivate new eucalyptus species by means of genetic engineering and efficiently utilizing 'moisture' and 'fertilizer' has important significance for winning 'turning over in the breeding industry' and solving the difficult points in the forestry seedling industry.

In order to solve the shortage and diversified requirements of the poplar and the birch, a new breeding method is urgently needed to solve the problem of seedling breeding in forestry.

Disclosure of Invention

The structures of the plant cell after removal of the cell wall are collectively defined as protoplasts, without the cell wallBlocking, foreign molecules can more easily enter the cell by various transformation methods. However, how to efficiently transfer exogenous DNA plasmids into protoplasts becomes an important limiting factor, and the current common electric shock method has the significant disadvantages of long period and low efficiency (less than 5%). Aiming at the defects, the invention provides a method for efficiently transforming plasmids in plant protoplasts, which utilizes exogenous DNA plasmids with high purity and concentration to mix the protoplasts with PEG/Ca²⁺And (4) incubating the solution and the MMg solution to carry out high-efficiency exogenous DNA plasmid transformation. The method can improve the conversion efficiency to 70 percent and has great application potential.

The invention also provides an application of the method for efficiently transforming the plasmid in the protoplast in breeding of the poplar and the birch.

The invention also provides a protoplast of poplar or eucalyptus.

The invention also provides the application of the protoplast of the poplar or the eucalyptus in the exogenous gene expression.

The invention is realized by the following technical scheme:

a method for high-efficiency transformation of plasmid in plant protoplast at least comprises preparing suspension of protoplast, high-purity and concentration exogenous DNA plasmid and PEG/Ca²⁺The solution was transformed by incubation.

In one embodiment, the method for efficiently transforming plasmids in plant protoplasts further comprises the steps of incubating transformation, centrifuging by using a W5 solution, and suspending.

The suspension prepared from the protoplast is to suspend the protoplast and a solvent, wherein the solvent is MMg solution.

The ratio of the number to the volume of the protoplast to the MMg solution is 1-5x10⁵One per ml. Within the range, the transformation efficiency is the maximum, the number volume is too low, the transformation yield of the protoplast is too low, and if the number volume is too high, the protoplast is mutually accumulated and crushed easily in the operation process.

The volume ratio of the suspension to the exogenous DNA plasmid is 10: 1-2.

The suspension of the inventionThe sum of the volume of the plasmid solution and the PEG/Ca²⁺The volumes of the solutions were equal.

In one embodiment, the MMg solution comprises 0.4-0.8M mannitol (D-mannitol), 10-20mM MgCl₂2-6mM (N-morpholinyl) ethanesulfonic acid (MES).

In one embodiment, the MMg solution has mannitol (D-mannitol) of 0.5-0.7M, and may be 0.5-0.6M or 0.6-0.7M. Mannitol is a necessary condition for maintaining osmotic pressure, different species have different osmotic pressures due to different protoplast cell sizes and different surface tensions, and the optimal concentration of mannitol used for the poplar and eucalyptus according to the invention is 0.6M. Mg (magnesium)²⁺And MES ((N-morpholinyl) morpholine ethanesulfonic acid) have an effect on the membrane structure, promoting plasmid transformation efficiency, but too high a concentration can induce cell death.

In one embodiment, the MMg solution is MgCl₂Is 12-17mM, and may be 12-13mM, 13-14mM, 14-15mM, or 15-16 mM.

In one embodiment, the MMg solution has a MES of 3-5mM, and may be 3-4mM or 4-5 mM.

In one embodiment, the PEG/Ca²⁺PEG in the solution is PEG_4000。Further, PEG/Ca²⁺The solution comprises PEG₄₀₀₀2-5g,ddH₂O1-5 ml, 0.8MM mannitol 0.5-2.5ml,1.0M CaCl₂ 0.5-1.5ml。

In one embodiment, the PEG₄₀₀₀2-4g, which can be 2-3g or 3-4 g. The PEG of the present invention₄₀₀₀The optimum amount of (3 g) and the final concentration of 40% is too low to have a weak effect on the modification of the membrane structure and low transformation efficiency, and too high causes cell death.

In one embodiment, the mannitol is 0.6-0.9M, may be 0.6-0.7M, 0.7-0.8M or 0.8-0.9M; the mannitol has a volume of 1.5-2.5ml, and may be 1.5-2.0ml or 2.0-2.5 ml. The addition of 1.785ml of 0.8M mannitol was optimal for maintaining the cell osmolality.

In one embodiment, the ddH₂The volume of O is 2-4ml, and may be 2-3ml, 3-4ml or 4-5 ml.

In one embodiment, the CaCl₂The volume is 0.5-1.0ml, and may be 0.5-0.6ml,0.6-0.7ml, 0.7-0.8ml, 0.8-0.9ml or 0.9-1.0 ml. Calcium ion has the effect of assisting in changing membrane structure, the effect is weak when the concentration is too low, cell death can be caused when the concentration is too high, and the optimal using amount is to add 1M CaCl₂ 0.75ml。

The invention relates to a method for efficiently transforming plasmids in plant protoplasts, wherein the purity of exogenous DNA plasmids is an absorbance value OD₂₆₀/OD₂₈₀1.6-2.0, may be 1.6-1.7, 1.7-1.8 or 1.8-2.0.

Further preferably, the concentration of the foreign DNA plasmid is 1 to 3. mu.g/. mu.l, and the concentration may be 1 to 2 or 2 to 3. mu.g/. mu.l.

OD in plasmid DNA₂₆₀/OD₂₈₀The absorbance value reflects the purity of the plasmid, where OD₂₆₀/OD₂₈₀The plasmid purity was highest at 1.8, and the influence on cells at the time of transformation was minimal, and subsequent experiments could be performed. The transformation efficiency increased with increasing plasmid concentration, with plasmid concentrations above 2. mu.g/. mu.l having a constant transformation efficiency.

The method for efficiently transforming the plasmids in the plant protoplast, disclosed by the invention, is characterized in that the time required for incubation and transformation is 30-60 min; the temperature is 20-30 ℃.

In one embodiment, the time required for said incubation to convert may be 30-40min,40-50min or 50-60 min; the temperature can be 20-22 deg.C, 22-23 deg.C, 23-24 deg.C, 24-25 deg.C, and 25-26 deg.C. The optimal time for incubation is 50min, the number of cells transferred into the deplasmid is small, the transformation efficiency is low, the time is too long, the PEG-induced membrane characteristic change can cause dehydration and death of plant cells, and the transformation efficiency is reduced. The optimal transformation temperature is 23 ℃, and if the temperature is too low, the cell activity is not good, and if the temperature is too high, the transformation is inhibited.

The preparation of the high-concentration and high-purity exogenous DNA plasmid is obtained by the following steps: (4) cutting pEGAD vector plasmid by Sma I single enzyme, and constructing target gene on pEGAD vector by seamless cloning method;

(5) cloning the 35S-GFP-gene part on the constructed pEGAD vector by using high fidelity enzyme, and connecting the cloned part to a pBLUE-T vector;

(6) the pBLUE-T vector was transformed into E.coli Top10, and plasmid extraction was performed.

In one embodiment, the method for preparing a high-concentration high-purity foreign DNA plasmid of the present invention further comprises the steps of (4) and (3) eluting and concentrating after the step of extracting.

The step of eluting and concentrating after the big extraction comprises the steps of adding isopropanol and NaCl into the eluent, uniformly mixing, centrifuging, removing the supernatant, washing the precipitate with 85-95% ethanol, centrifuging, removing the ethanol, drying the precipitate, and then using ddH₂And diluting the O to the high concentration of the exogenous DNA plasmid.

The ethanol concentration in the step (4) is 70%.

The plants of the invention are poplar and eucalyptus. The poplar includes, but is not limited to, populus tomentosa, populus alba, populus 84K, populus deltoids, populus Sinkiangensis, populus tomentosa, populus tremuloides, or populus 107. The eucalyptus includes, but is not limited to, one or more of eucalyptus urophylla, or eucalyptus urophylla.

The invention also provides a method for efficiently transforming plasmids in the populus tomentosa protoplast, which comprises the following steps:

A. construction of pEGAD expression vector

Amplifying PtHTB9 gene of the Chinese white poplar by using cDNA of the Chinese white poplar as a template through an RT-PCR method, and carrying out enzyme digestion incubation on a pEGAD carrier by using Sma I enzyme; incubating by using In-fusion seamless cloning enzyme, transferring the product to escherichia coli Top10 by a heat shock method, and screening positive clones on an LB culture medium of kanamycin;

wherein, the PtHTB9 gene sequence is SEQ ID NO 1:

ATGGCTCCCAAAGCAGAGAAGAAGCCAGCTGAGAAAAAACCGGCAGCAGCGGAGAAAGCTCCGGCGGAGAAGAAGCCAAGGGCAGAGAAGAAGTTGCCAAAAGAAGGCGCCGGTGACAAGAAGAAGAAGAAGGCAAAGAAGAACGTCGAGACCTATAAGATCTACATCTTCAAGGTATTGAAACAGGTTCACCCTGACATCGGGATCTCGAGCAAGGCTATGGGTATCATGAACAGTTTTATAAACGATATCTTTGAGAAACTTGCTCAGGAGTCATCAAGGCTTGCAAGGTATAATAAGAAGCCCACTATCACTTCAAGGGAGATCCAGACTGCTGTGAGATTGGTGTTGCCTGGGGAGCTTGCCAAACATGCTGTTTCAGAAGGGACTAAGGCTGTAACCAAATTTACTAGCTCTTAG

sequence of forward primer F SEQ ID NO 2:

5’-GCGGCCGAATTCCCCGGGATGGCTCCCAAAGCAGAGAAG-3’

sequence of reverse primer R SEQ ID NO3:

5’-AAGCTTCTCGAGCCCGGGCTAAGAGCTAGTAAATTTGGTTACAG-3’

B. construction of pTOPO-Blunt transformation vector

Cloning the constructed pEGAD carrier by using upstream and downstream primer pair '35S-GFP-PtHTB 9' fragment through PCR, connecting the recovered product with pTOPO-Blunt carrier by using T4 ligase, transferring to escherichia coli Top10 through a heat shock method, and screening positive clones on an LB culture medium of ampicillin;

sequence of 35S-GFP-PtHTB9 fragment SEQ ID NO4

TTAATTAAGAGCTCGCATGCCCTTTCAGAAAGAATGCTAACCCACAGATGGTTAGAGAGGCTTACGCAGCAGGTCTCATCAAGACGATCTACCCGAGCAATAATCTCCAGGAAATCAAATACCTTCCCAAGAAGGTTAAAGATGCAGTCAAAAGATTCAGGACTAACTGCATCAAGAACACAGAGAAAGATATATTTCTCAAGATCAGAAGTACTATTCCAGTATGGACGATTCAAGGCTTGCTTCACAAACCAAGGCAAGTAATAGAGATTGGAGTCTCTAAAAAGGTAGTTCCCACTGAATCAAAGGCCATGGAGTCAAAGATTCAAATAGAGGACCTAACAGAACTCCCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACGCTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGAACACGGGGACTCTAGCGCTACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTCCGGAGCTGCGGCCGCTGCCGCTGCGGCAGCGGCCGAATTCCCCGGGATGGCTCCCAAAGCAGAGAAGAAGCCAGCTGAGAAAAAACCGGCAGCAGCGGAGAAAGCTCCGGCGGAGAAGAAGCCAAGGGCAGAGAAGAAGTTGCCAAAAGAAGGCGCCGGTGACAAGAAGAAGAAGAAGGCAAAGAAGAACGTCGAGACCTATAAGATCTACATCTTCAAGGTATTGAAACAGGTTCACCCTGACATCGGGATCTCGAGCAAGGCTATGGGTATCATGAACAGTTTTATAAACGATATCTTTGAGAAACTTGCTCAGGAGTCATCAAGGCTTGCAAGGTATAATAAGAAGCCCACTATCACTTCAAGGGAGATCCAGACTGCTGTGAGATTGGTGTTGCCTGGGGAGCTTGCCAAACATGCTGTTTCAGAAGGGACTAAGGCTGTAACCAAATTTACTAGCTCTTAG

Sequence of the upstream primer F SEQ ID NO5: 5'-TTCATTTGGA GAGAACACGG GGACT-3'

Sequence of the downstream primer R SEQ ID NO 6: 5'-ATGTTGACGGATCTCTAGCTTATCGAAT-3'

C. High purity, high concentration plasmid extraction

Culturing the constructed pTOPO-Blunt '35S-GFP-PtHTB 9' and Escherichia coli Top10 strain with ampicillin overnight, and performing plasmid extraction and concentration by using a plasmid extraction kit;

D. exogenous DNA plasmid transformation

Suspending poplar protoplasts with MMg solution for later use; adding exogenous DNA plasmid into centrifuge tube, adding MMg solution, resuspending to obtain protoplast suspension, adding equal volume of PEG/Ca²⁺Mixing the solution, incubating, adding W5 solution, centrifuging, adding W5 solution into the precipitate, resuspending, and culturing.

The invention also provides a method for efficiently transforming plasmids in the protoplast of the eucalyptus grandis DH32-29, which comprises the following steps:

A. construction of pEGAD expression vector

Using cDNA of 'E.grandis DH 32-29' as a template, amplifying the EgHTB9 gene of 'E.grandis DH 32-29' by an RT-PCR method, carrying out enzyme digestion incubation on a pEGAD vector by using Sma I enzyme, carrying out In-fusion seamless cloning enzyme incubation, transferring a product to escherichia coli Top10 by a heat shock method, and screening positive clones on an LB culture medium of kanamycin;

EgHTB9 gene sequence SEQ ID NO 7

ATGGCGCCGAAGGCGGAGAAGAAGCCGGCGGAGAAGAAGCCGGCCGACGACAAGAAGGCCGAGAAGGCGCCGGCCGAGAAGAAGCCGCGGGCGGAGAAGAAGTTGCCGAAGGAGGCCGGGTCGGCGGACAAGAAGAAGAAGAAGGCGAAGCGGAGCGTGGAGACGTACAAAATCTACATCTTCAAGGTGCTGAAGCAGGTCCACCCGGACATCGGCATCTCCAGCAAGGCCATGGGCATCATGAACTCCTTCATCAACGACATCTTCGAGAAGCTCGCCCAGGAGTCCTCCCGCCTCGCCCGCTACAACAAGAAGCCCACCATCACCTCCCGGGAAATCCAGACCGCCGTCCGCCTCGTCTTGCCCGGGGAGCTGGCCAAGCACGCCGTCTCCGAGGGCACCAAGGCCGTCACCAAATTCACCAGCTCTTAG

Sequence of forward primer F SEQ ID NO 8:

5’-GCGGCCGAATTCCCCGGGATGGCGCCGAAGGCGGAGAAG-3’

sequence of reverse primer R SEQ ID NO 9:

5’-AAGCTTCTCGAGCCCGGGCTAAGAGCTGGTGAATTTGGTGACG-3’

B. construction of pTOPO-Blunt transformation vector

Cloning the constructed pEGAD carrier by using upstream and downstream primer pair '35S-GFP-EgHTB 9' fragment through PCR, connecting the recovered product with pTOPO-Blunt carrier by using T4 ligase, transferring to escherichia coli Top10 through a heat shock method, and screening positive clones on LB culture medium of ampicillin;

sequence of the 35S-GFP-EgHTB9 "fragment SEQ ID NO 10:

TTAATTAAGAGCTCGCATGCCCTTTCAGAAAGAATGCTAACCCACAGATGGTTAGAGAGGCTTACGCAGCAGGTCTCATCAAGACGATCTACCCGAGCAATAATCTCCAGGAAATCAAATACCTTCCCAAGAAGGTTAAAGATGCAGTCAAAAGATTCAGGACTAACTGCATCAAGAACACAGAGAAAGATATATTTCTCAAGATCAGAAGTACTATTCCAGTATGGACGATTCAAGGCTTGCTTCACAAACCAAGGCAAGTAATAGAGATTGGAGTCTCTAAAAAGGTAGTTCCCACTGAATCAAAGGCCATGGAGTCAAAGATTCAAATAGAGGACCTAACAGAACTCCCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACGCTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGAACACGGGGACTCTAGCGCTACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTCCGGAGCTGCGGCCGCTGCCGCTGCGGCAGCGGCCGAATTCCCCGGGATGGCGCCGAAGGCGGAGAAGAAGCCGGCGGAGAAGAAGCCGGCCGACGACAAGAAGGCCGAGAAGGCGCCGGCCGAGAAGAAGCCGCGGGCGGAGAAGAAGTTGCCGAAGGAGGCCGGGTCGGCGGACAAGAAGAAGAAGAAGGCGAAGCGGAGCGTGGAGACGTACAAAATCTACATCTTCAAGGTGCTGAAGCAGGTCCACCCGGACATCGGCATCTCCAGCAAGGCCATGGGCATCATGAACTCCTTCATCAACGACATCTTCGAGAAGCTCGCCCAGGAGTCCTCCCGCCTCGCCCGCTACAACAAGAAGCCCACCATCACCTCCCGGGAAATCCAGACCGCCGTCCGCCTCGTCTTGCCCGGGGAGCTGGCCAAGCACGCCGTCTCCGAGGGCACCAAGGCCGTCACCAAATTCACCAGCTCTTAG

sequence of the upstream primer F SEQ ID NO 11: 5'-TTCATTTGGA GAGAACACGG GGACT-3'

Sequence of downstream primer R SEQ ID NO 12: 5'-ATGTTGACGGATCTCTAGCTTATCGAAT-3'

C. High purity, high concentration plasmid extraction

Culturing the constructed pTOPO-Blunt '35S-GFP-EgHTB 9' and Escherichia coli Top10 strain with ampicillin overnight, and performing plasmid extraction and concentration by using a plasmid extraction kit;

D. exogenous DNA plasmid transformation

Dissolving eucalypt protoplast in MMg solutionSuspending for later use; adding exogenous DNA plasmid into centrifuge tube, adding MMg solution resuspended protoplast extract, and adding equal volume of PEG/Ca²⁺Mixing the solution, incubating, adding W5 solution, centrifuging, adding W5 solution into the precipitate, resuspending, and culturing.

The invention also provides a transformed plant protoplast prepared by the transformation method.

The invention also provides the use of the transformed plant protoplast for exogenous gene expression.

Advantageous effects

The method for efficiently transforming exogenous DNA plasmids in the poplar and eucalyptus protoplasts designed by the invention can remarkably accelerate the breeding work of the poplar and the eucalyptus and promote the cultivation of excellent new substances by the genetic engineering means, and has important significance.

The invention adopts the PEG/Ca2+ and MMg solution with specific proportion and the DNA plasmid with high concentration and purity to incubate at specific temperature and for a certain time, which can break through the bottleneck problem of low efficiency (5%) of the electric shock transformation method and improve the transformation efficiency to 70%. The method can efficiently express exogenous DNA plasmids, thereby changing the gene expression mode in the protoplast of the poplar and the eucalyptus and providing important technical support for cultivating new germplasms of the poplar and the eucalyptus through genetic engineering.

Drawings

FIG. 1 is a map of a plant expression vector pEGAD showing "EcoR I-Sma I-Hind III-BamH I" as a multiple cloning site;

FIG. 2 is a map of pTOPO-Blunt vector used for transformation of poplar and eucalyptus protoplasts with the DNA plasmid of interest, showing the sites where "DNA Insert" was used to ligate and Insert the "35S-GFP-gene".

FIG. 3 detection by confocal laser microscopy after transformation of a "populus" mid-nuclear localization gene "35S-GFP-PtHTB 9".

FIG. 4 detection by confocal laser microscopy after transformation of a "Eucalyptus" nuclear localization gene "35S-GFP-EgHTB 9".

Detailed Description

The invention will be described in detail hereinafter with reference to the accompanying drawings in conjunction with embodiments. It should be noted that the embodiments and features of the embodiments may be combined with each other without conflict. The experimental procedures used in the following examples are conventional ones unless otherwise specified, and the reagents and materials used therein are commercially available ones unless otherwise specified.

Wherein, the used pEGAD vector is a conventional vector;

pTOPO-Blunt vector was purchased from Beijing Edley Biotech Ltd;

the In-Fusion enzyme for seamless cloning was purchased from Liuhe Jingtong, Inc. of Beijing;

sma I enzyme was purchased from neb (new England biolabs), attorney: beijing Bailingke Biotechnology Limited liability company

Coli Top10 was purchased from Beijing Bomaide Gene technology, Inc

T4 ligase was purchased from neb (new England biolabs), attorney: beijing Bailingke Biotechnology Limited liability company

cDNA as template, RNA extraction kit purchased from Tiangen Biochemical technology Co., Ltd, and reverse transcription to obtain

Various pharmaceutical reagents were purchased from Sigma, unless otherwise specified.

The first embodiment is as follows: construction of pEGAD expression vector

As shown in FIG. 1, in this example, the HTB9 genes of "Chinese white poplar" and "Eucalyptus grandis DH 32-29" were amplified by RT-PCR using cDNAs of "Chinese white poplar" and "Eucalyptus grandis DH 32-29" as templates and named PtHTB9 and EgHTB9, respectively. The primer is a seamless cloning primer added with a joint, wherein the thick part is the joint primer, and the specific sequence is as follows:

Aspen

forward primer F: 5'-GCGGCCGAATTCCCCGGGATGGCTCCCAAAGCAGAGAAG-3'

Reverse primer R: 5'-AAGCTTCTCGAGCCCGGGCTAAGAGCTAGTAAATTTGGTTACAG-3'

Eucalyptus

Forward primer F: 5'-GCGGCCGAATTCCCCGGGATGGCGCCGAAGGCGGAGAAG-3'

Reverse primer R: 5'-AAGCTTCTCGAGCCCGGGCTAAGAGCTGGTGAATTTGGTGACG-3'

The size of the PCR primer is identified by agarose gel electrophoresis, and then the size is cut and recovered. Meanwhile, carrying out enzyme digestion incubation on the pEGAD carrier shown in the figure 1 by using Sma I enzyme, then carrying out separation by using agarose gel electrophoresis, and carrying out gel cutting recovery; and (3) incubating for 30min at a constant temperature of 50 ℃ by using In-fusion seamless clonase, transferring the product to escherichia coli Top10 by a heat shock method, screening positive clones on an LB culture medium of kanamycin, and identifying by using a sequencing primer.

Example two: construction of pTOPO-Blunt transformation vector

The pEGAD carrier which is constructed well is cloned by PCR through the upstream primer pair and the downstream primer pair of fragment fragments of '35S-GFP-PtHTB 9' and '35S-GFP-EgHTB 9', and is subjected to agarose gel electrophoresis and then gel cutting recovery and purification, wherein the primers are as follows:

upstream primer F: 5'-TTCATTTGGA GAGAACACGG GGACT-3'

Downstream primer R: 5'-ATGTTGACGGATCTCTAGCTTATCGAAT-3'

The recovered product was ligated with pTOPO-Blunt vector overnight at 4 ℃ with T4 ligase, transferred to E.coli Top10 by heat shock method, and positive clones were selected on LB medium of ampicillin and identified by sequencing.

Example three: high purity, high concentration plasmid extraction

400ml of the constructed pTOPO-Blunt "35S-GFP-PtHTB 9" and pTOPO-Blunt "35S-GFP-EgHTB 9" E.coli Top10 strain was cultured overnight with 50mg/L of ampicillin, and plasmid-extracted using DP117 endotoxin-free plasmid extraction kit from Tiangen Biochemical technology Co., Ltd. for plasmid extraction, and the eluted plasmid was concentrated as follows:

(1) adding 1.42ml isopropanol and 0.42ml 5M NaCl into each 1ml eluate, mixing, and standing at room temperature for 5 min;

(2) centrifuging at 8000rpm for 10min at room temperature, and carefully removing supernatant;

(3) adding 0.5ml 70% ethanol, washing the precipitate, centrifuging at room temperature 8000rpm for 5min, and carefully removing ethanol;

(4) repeating the step 3 once;

(5) drying the precipitate in air for about 5-10min, adding ddH₂O plasmid diluted to a concentration of 2. mu.g/. mu.l.

Example four: exogenous DNA plasmid transformation

(1) Protoplasts of poplar and eucalyptus were treated with MMg solution (0.6M D-mannitol,15mM MgCl)₂,4mM MES)

Suspending for later use.

(2) 10 μ l of plasmid with concentration of 2 μ g/μ l was added into a 1.5ml centrifuge tube, 100 μ l of protoplast extract resuspended in MMg solution was added with a tip-cut pipette tip, the mixture was gently inverted and mixed, and 110 μ l (equal volume) of PEG/Ca was added²⁺Solutions (PEG)₄₀₀₀ 3g,ddH₂O 2.25ml,0.8M D-mannitol 1.785ml,1.0M CaCl₂0.75ml) and mixed well.

(3) Incubate at 23 ℃ for 50min in the dark.

(4) Mu.l (2 volumes) of W5 solution (154mM NaCl,125mM CaCl) were added to the centrifuge tubes₂5mM KCl,2mM MES,5mM glucose), centrifuging at 23 deg.C for 1min at 100g, and discarding the supernatant;

(5) adding 100 μ l W5 solution into the precipitate, mixing, centrifuging at 23 deg.C and 100g for 1min, removing supernatant,

(6) repeating the step 5 once;

(7) 1ml of W5 solution was added and gently resuspended.

(8) Culturing at 23 deg.C in dark for 16 h.

Example four: microscopic observation and analysis

After centrifuging for 1min at the rotating speed of 100g, 100 mul of precipitate is left, is directly sucked and placed under a glass bottom dish, is observed by a laser confocal microscope, and is subjected to statistical analysis on the conversion efficiency. The conversion efficiency (number of luminescent cells/total number of cells) of poplar was 71%, and the conversion efficiency (number of luminescent cells/total number of cells) of eucalyptus was 75%.

Example five screening test

The parameters of the invention have the screening process: wherein the plasmid concentration uses different gradients of 0.3 mug/mul, 1.0 mug/mul, 1.5 mug/mul, 2.0 mug/mul and 3.0 mug/mul, experiments show that the transformation efficiency is increased along with the increase of the plasmid concentration, wherein the lowest plasmid concentration used for achieving the maximum transformation efficiency is 2.0 mug/mul; PEG4000 concentrations of 20% and 40%, respectively, were tested, with 40% PEG being capable of greater conversion efficiency; the transformation time is set with gradients from 20, 30, 40, 50, 60 minutes and the like, the transformation efficiency is improved along with the increase of time, and the activity of the protoplast is reduced and completely influenced in 60 minutes.

Except for the above parameters, other components and operation methods are the same as those of the third and fourth embodiments.

Example six screening experiments with transformation temperature and time

The conversion temperature is respectively set to four gradients of 20 ℃,23 ℃, 26 ℃ and 29 ℃, the conversion time is set to four gradients of 30min, 40min, 50min and 60min, the conversion efficiency is influenced when the temperature is too high or too low, and the optimal temperature is 23 ℃. If the transformation time is too short for 30min, the efficiency is low, and if the transformation time is too long for 60min, the proportion of dead cells can be remarkably increased.

Sequence listing

<110> Beijing university of forestry

<120> method for efficiently transforming plasmid in plant protoplast and application thereof

<141> 2021-11-09

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 420

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 1

atggctccca aagcagagaa gaagccagct gagaaaaaac cggcagcagc ggagaaagct 60

ccggcggaga agaagccaag ggcagagaag aagttgccaa aagaaggcgc cggtgacaag 120

aagaagaaga aggcaaagaa gaacgtcgag acctataaga tctacatctt caaggtattg 180

aaacaggttc accctgacat cgggatctcg agcaaggcta tgggtatcat gaacagtttt 240

ataaacgata tctttgagaa acttgctcag gagtcatcaa ggcttgcaag gtataataag 300

aagcccacta tcacttcaag ggagatccag actgctgtga gattggtgtt gcctggggag 360

cttgccaaac atgctgtttc agaagggact aaggctgtaa ccaaatttac tagctcttag 420

<210> 2

<211> 39

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 2

gcggccgaat tccccgggat ggctcccaaa gcagagaag 39

<210> 3

<211> 44

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 3

aagcttctcg agcccgggct aagagctagt aaatttggtt acag 44

<210> 4

<211> 2053

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 4

ttaattaaga gctcgcatgc cctttcagaa agaatgctaa cccacagatg gttagagagg 60

cttacgcagc aggtctcatc aagacgatct acccgagcaa taatctccag gaaatcaaat 120

accttcccaa gaaggttaaa gatgcagtca aaagattcag gactaactgc atcaagaaca 180

cagagaaaga tatatttctc aagatcagaa gtactattcc agtatggacg attcaaggct 240

tgcttcacaa accaaggcaa gtaatagaga ttggagtctc taaaaaggta gttcccactg 300

aatcaaaggc catggagtca aagattcaaa tagaggacct aacagaactc cccgtaaaga 360

ctggcgaaca gttcatacag agtctcttac gactcaatga caagaagaaa atcttcgtca 420

acatggtgga gcacgacacg cttgtctact ccaaaaatat caaagataca gtctcagaag 480

accaaagggc aattgagact tttcaacaaa gggtaatatc cggaaacctc ctcggattcc 540

attgcccagc tatctgtcac tttattgtga agatagtgga aaaggaaggt ggctcctaca 600

aatgccatca ttgcgataaa ggaaaggcca tcgttgaaga tgcctctgcc gacagtggtc 660

ccaaagatgg acccccaccc acgaggagca tcgtggaaaa agaagacgtt ccaaccacgt 720

cttcaaagca agtggattga tgtgatatct ccactgacgt aagggatgac gcacaatccc 780

actatccttc gcaagaccct tcctctatat aaggaagttc atttcatttg gagagaacac 840

ggggactcta gcgctaccgg tcgccaccat ggtgagcaag ggcgaggagc tgttcaccgg 900

ggtggtgccc atcctggtcg agctggacgg cgacgtaaac ggccacaagt tcagcgtgtc 960

cggcgagggc gagggcgatg ccacctacgg caagctgacc ctgaagttca tctgcaccac 1020

cggcaagctg cccgtgccct ggcccaccct cgtgaccacc ctgacctacg gcgtgcagtg 1080

cttcagccgc taccccgacc acatgaagca gcacgacttc ttcaagtccg ccatgcccga 1140

aggctacgtc caggagcgca ccatcttctt caaggacgac ggcaactaca agacccgcgc 1200

cgaggtgaag ttcgagggcg acaccctggt gaaccgcatc gagctgaagg gcatcgactt 1260

caaggaggac ggcaacatcc tggggcacaa gctggagtac aactacaaca gccacaacgt 1320

ctatatcatg gccgacaagc agaagaacgg catcaaggtg aacttcaaga tccgccacaa 1380

catcgaggac ggcagcgtgc agctcgccga ccactaccag cagaacaccc ccatcggcga 1440

cggccccgtg ctgctgcccg acaaccacta cctgagcacc cagtccgccc tgagcaaaga 1500

ccccaacgag aagcgcgatc acatggtcct gctggagttc gtgaccgccg ccgggatcac 1560

tctcggcatg gacgagctgt acaagtccgg agctgcggcc gctgccgctg cggcagcggc 1620

cgaattcccc gggatggctc ccaaagcaga gaagaagcca gctgagaaaa aaccggcagc 1680

agcggagaaa gctccggcgg agaagaagcc aagggcagag aagaagttgc caaaagaagg 1740

cgccggtgac aagaagaaga agaaggcaaa gaagaacgtc gagacctata agatctacat 1800

cttcaaggta ttgaaacagg ttcaccctga catcgggatc tcgagcaagg ctatgggtat 1860

catgaacagt tttataaacg atatctttga gaaacttgct caggagtcat caaggcttgc 1920

aaggtataat aagaagccca ctatcacttc aagggagatc cagactgctg tgagattggt 1980

gttgcctggg gagcttgcca aacatgctgt ttcagaaggg actaaggctg taaccaaatt 2040

tactagctct tag 2053

<210> 5

<211> 25

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 5

ttcatttgga gagaacacgg ggact 25

<210> 6

<211> 28

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 6

atgttgacgg atctctagct tatcgaat 28

<210> 7

<211> 432

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 7

atggcgccga aggcggagaa gaagccggcg gagaagaagc cggccgacga caagaaggcc 60

gagaaggcgc cggccgagaa gaagccgcgg gcggagaaga agttgccgaa ggaggccggg 120

tcggcggaca agaagaagaa gaaggcgaag cggagcgtgg agacgtacaa aatctacatc 180

ttcaaggtgc tgaagcaggt ccacccggac atcggcatct ccagcaaggc catgggcatc 240

atgaactcct tcatcaacga catcttcgag aagctcgccc aggagtcctc ccgcctcgcc 300

cgctacaaca agaagcccac catcacctcc cgggaaatcc agaccgccgt ccgcctcgtc 360

ttgcccgggg agctggccaa gcacgccgtc tccgagggca ccaaggccgt caccaaattc 420

accagctctt ag 432

<210> 8

<211> 39

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 8

gcggccgaat tccccgggat ggcgccgaag gcggagaag 39

<210> 9

<211> 43

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 9

aagcttctcg agcccgggct aagagctggt gaatttggtg acg 43

<210> 10

<211> 2065

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 10

ttaattaaga gctcgcatgc cctttcagaa agaatgctaa cccacagatg gttagagagg 60

cttacgcagc aggtctcatc aagacgatct acccgagcaa taatctccag gaaatcaaat 120

accttcccaa gaaggttaaa gatgcagtca aaagattcag gactaactgc atcaagaaca 180

cagagaaaga tatatttctc aagatcagaa gtactattcc agtatggacg attcaaggct 240

tgcttcacaa accaaggcaa gtaatagaga ttggagtctc taaaaaggta gttcccactg 300

aatcaaaggc catggagtca aagattcaaa tagaggacct aacagaactc cccgtaaaga 360

ctggcgaaca gttcatacag agtctcttac gactcaatga caagaagaaa atcttcgtca 420

acatggtgga gcacgacacg cttgtctact ccaaaaatat caaagataca gtctcagaag 480

accaaagggc aattgagact tttcaacaaa gggtaatatc cggaaacctc ctcggattcc 540

attgcccagc tatctgtcac tttattgtga agatagtgga aaaggaaggt ggctcctaca 600

aatgccatca ttgcgataaa ggaaaggcca tcgttgaaga tgcctctgcc gacagtggtc 660

ccaaagatgg acccccaccc acgaggagca tcgtggaaaa agaagacgtt ccaaccacgt 720

cttcaaagca agtggattga tgtgatatct ccactgacgt aagggatgac gcacaatccc 780

actatccttc gcaagaccct tcctctatat aaggaagttc atttcatttg gagagaacac 840

ggggactcta gcgctaccgg tcgccaccat ggtgagcaag ggcgaggagc tgttcaccgg 900

ggtggtgccc atcctggtcg agctggacgg cgacgtaaac ggccacaagt tcagcgtgtc 960

cggcgagggc gagggcgatg ccacctacgg caagctgacc ctgaagttca tctgcaccac 1020

cggcaagctg cccgtgccct ggcccaccct cgtgaccacc ctgacctacg gcgtgcagtg 1080

cttcagccgc taccccgacc acatgaagca gcacgacttc ttcaagtccg ccatgcccga 1140

aggctacgtc caggagcgca ccatcttctt caaggacgac ggcaactaca agacccgcgc 1200

cgaggtgaag ttcgagggcg acaccctggt gaaccgcatc gagctgaagg gcatcgactt 1260

caaggaggac ggcaacatcc tggggcacaa gctggagtac aactacaaca gccacaacgt 1320

ctatatcatg gccgacaagc agaagaacgg catcaaggtg aacttcaaga tccgccacaa 1380

catcgaggac ggcagcgtgc agctcgccga ccactaccag cagaacaccc ccatcggcga 1440

cggccccgtg ctgctgcccg acaaccacta cctgagcacc cagtccgccc tgagcaaaga 1500

ccccaacgag aagcgcgatc acatggtcct gctggagttc gtgaccgccg ccgggatcac 1560

tctcggcatg gacgagctgt acaagtccgg agctgcggcc gctgccgctg cggcagcggc 1620

cgaattcccc gggatggcgc cgaaggcgga gaagaagccg gcggagaaga agccggccga 1680

cgacaagaag gccgagaagg cgccggccga gaagaagccg cgggcggaga agaagttgcc 1740

gaaggaggcc gggtcggcgg acaagaagaa gaagaaggcg aagcggagcg tggagacgta 1800

caaaatctac atcttcaagg tgctgaagca ggtccacccg gacatcggca tctccagcaa 1860

ggccatgggc atcatgaact ccttcatcaa cgacatcttc gagaagctcg cccaggagtc 1920

ctcccgcctc gcccgctaca acaagaagcc caccatcacc tcccgggaaa tccagaccgc 1980

cgtccgcctc gtcttgcccg gggagctggc caagcacgcc gtctccgagg gcaccaaggc 2040

cgtcaccaaa ttcaccagct cttag 2065

<210> 11

<211> 25

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 11

ttcatttgga gagaacacgg ggact 25

<210> 12

<211> 28

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 12

atgttgacgg atctctagct tatcgaat 28

Claims

1. A method for efficiently transforming a plasmid in a plant protoplast, comprising: comprises at least a suspension prepared from protoplasts, a high purity and concentration of exogenous DNA plasmid, and PEG/Ca²⁺Carrying out incubation transformation on the solution; preferably, the method further comprises the steps of incubating, centrifuging and suspending by using a W5 solution after transformation; the plant is poplar or eucalyptus.

2. The method of claim 1, wherein: the suspension prepared from the protoplast is to suspend the protoplast and a solvent, wherein the solvent is MMg solution; the ratio of the number to the volume of the protoplast to the MMg solution is 1-5x10⁵One per ml.

3. The method of claim 1, wherein: the volume ratio of the suspension to the exogenous DNA plasmid is 10: 1-2; the sum of the volumes of the suspension and the plasmid solution and the PEG/Ca²⁺The volumes of the solutions were equal.

4. A method according to any one of claims 1-3, characterized by: the MMg solution comprises 0.4-0.8M mannitol (D-mannitol), 10-20mM magnesium chloride, and 2-6mM (morpholine ethanesulfonic acid MES).

5. A method according to any one of claims 1-3, characterized by: the PEG/Ca²⁺PEG in the solution is PEG₄₀₀₀(ii) a Preferably, PEG/Ca²⁺The solution comprises PEG₄₀₀₀2-5g,ddH₂O1-5 ml, 0.8M mannitol 0.5-2.5ml,1.0M calcium chloride 0.5-1.5 ml.

6. A method according to any one of claims 1-3, characterized by: wherein the high purity of the exogenous DNA plasmid is the absorbance value OD₂₆₀/OD₂₈₀1.6-2.0, high concentration 1-3 μ g/μ l.

7. A method according to any one of claims 1-3, characterized by: wherein the time required for incubation and transformation is 30-60 min; the temperature is 20-30 ℃.

8. A method according to any one of claims 1-3, characterized by: the preparation of the high-concentration and high-purity exogenous DNA plasmid is obtained by the following steps:

(1) cutting pEGAD vector plasmid by Sma I single enzyme, and constructing target gene on pEGAD vector by seamless cloning method;

(2) cloning the 35S-GFP-gene part on the constructed pEGAD vector by using high fidelity enzyme, and connecting the cloned part to a pBLUE-T vector;

(3) transforming the pBLUE-T vector into escherichia coli Top10, and carrying out plasmid big extraction;

preferably, the method also comprises a step (4), wherein the plasmid in the step (3) is subjected to large extraction and then is subjected to elution and concentration; preferably, the step (4) of elution and concentration is that isopropanol and sodium chloride are added into the eluent, the mixture is evenly mixed and centrifuged, the supernatant is removed, 85 to 95 percent ethanol is used for washing and precipitating, the centrifugation is carried out, the ethanol is discarded, the precipitate is dried, and ddH is used for the precipitate₂Diluting to high exogenous DNA plasmid concentration;

preferably, when the plant is poplar, the steps are as follows:

A. construction of pEGAD expression vector

Amplifying PtHTB9 gene of the Chinese white poplar by using cDNA of the Chinese white poplar as a template through an RT-PCR method, and carrying out enzyme digestion and hatching on a pEGAD carrier by using Sma I enzyme; incubating by using In-fusion seamless cloning enzyme, transferring the product to escherichia coli Top10 by a heat shock method, and screening positive clones on an LB culture medium of kanamycin; wherein, the sequence of the PtHTB9 gene is SEQ ID NO1, the sequence of a forward primer F is SEQ ID NO2, and the sequence of a reverse primer R is SEQ ID NO 3;

B. construction of pTOPO-Blunt transformation vector

Cloning the constructed pEGAD carrier by using upstream and downstream primer pair '35S-GFP-PtHTB 9' fragment through PCR, connecting the recovered product with pTOPO-Blunt carrier by using T4 ligase, transferring to escherichia coli Top10 through a heat shock method, and screening positive clones on an LB culture medium of ampicillin; wherein the sequence of the 35S-GFP-PtHTB 9' fragment is SEQ ID NO4, the sequence of the upstream primer F is SEQ ID NO5, and the sequence of the downstream primer R is SEQ ID NO 6;

C. high purity, high concentration plasmid extraction

D. exogenous DNA plasmid transformation

Suspending poplar protoplasts with MMg solution for later use; adding exogenous DNA plasmid into centrifuge tube, adding MMg solution, resuspending to obtain protoplast suspension, adding equal volume of PEG/Ca²⁺Mixing the solutions, incubating, adding W5 solution, centrifuging, adding W5 solution into the precipitate, resuspending, and culturing;

or when the plant is eucalyptus, the method comprises the following steps:

A. construction of pEGAD expression vector

Using cDNA of 'E.grandis DH 32-29' as a template, amplifying the EgHTB9 gene of 'E.grandis DH 32-29' by an RT-PCR method, carrying out enzyme digestion incubation on a pEGAD vector by using Sma I enzyme, carrying out In-fusion seamless cloning enzyme incubation, transferring a product to escherichia coli Top10 by a heat shock method, and screening positive clones on an LB culture medium of kanamycin; wherein, the sequence of the EgHTB9 gene is SEQ ID NO 7, the sequence of the forward primer F is SEQ ID NO 8, and the sequence of the reverse primer R is SEQ ID NO 9;

B. construction of pTOPO-Blunt transformation vector

Cloning the constructed pEGAD carrier by using upstream and downstream primer pair '35S-GFP-EgHTB 9' fragment through PCR, connecting the recovered product with pTOPO-Blunt carrier by using T4 ligase, transferring to escherichia coli Top10 through a heat shock method, and screening positive clones on LB culture medium of ampicillin; wherein, the sequence of the 35S-GFP-EgHTB 9' fragment is SEQ ID NO 10: the sequence of the upstream primer F is SEQ ID NO 11, and the sequence of the downstream primer R is SEQ ID NO 12;

C. high purity, high concentration plasmid extraction

D. exogenous DNA plasmid transformation

Suspending the eucalyptus protoplast by using an MMg solution for later use; adding exogenous DNA plasmid into centrifuge tube, adding MMg solution resuspended protoplast extract, and adding equal volume of PEG/Ca²⁺Mixing the solution, incubating, adding W5 solution, centrifuging, adding W5 solution into the precipitate, resuspending, and culturing.

9. A transformed plant protoplast prepared by the transformation method according to any one of claims 1 to 8.

10. Use of the transformed plant protoplast of claim 1 for exogenous gene expression.