CN113862271B - Drug-resistant non-coding RNA of multi-drug-resistant Acinetobacter baumannii and application of drug-resistant non-coding RNA - Google Patents

Abstract

The invention discloses ncRNA for enhancing bacterial drug resistance, and belongs to the technical field of microorganisms. The ncRNA is: (1) adeA5' UTR: the gene is positioned in the 5' -end untranslated region of the acinetobacter baumannii adeA gene; or, (2) adeC5' UTR: the gene is located in the 5' -end untranslated region of the acinetobacter baumannii adeC gene. The ncRNA has high drug resistance correlation with bacteria, and particularly has close drug resistance correlation with norfloxacin and gentamicin. The ncRNA is used for constructing a drug resistance model, and the drug effect evaluation is carried out on the drug for resisting the drug resistance bacteria, so that the application value is higher.

Description

Drug-resistant non-coding RNA of multi-drug-resistant Acinetobacter baumannii and application of drug-resistant non-coding RNA

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to a drug-resistant non-coding RNA of multi-drug-resistant Acinetobacter baumannii and application thereof.

Background

Acinetobacter baumannii (Acinetobacter baumannii) is a non-fermented aerobic gram-negative pathogenic bacterium, has a complex antibacterial drug resistance mechanism, and comprises high expression of a drug efflux pump, production of drug inactivating enzymes (beta-lactamase, aminoglycoside modifying enzymes and the like), formation of a biological film, change of drug action targets of penicillin binding proteins, 16S rRNA methylase and the like, change of outer membrane permeability and the like. Recent studies have found that non-coding RNAs (ncRNAs) play an important role in regulating the expression levels of related drug-resistant genes (drug efflux pumps, biofilm formation, virulence factors, cell membrane permeability, cell wall synthesis, etc.).

Bacterial ncRNAs are a class of RNA molecules that are widely present in the genome of prokaryotes and that are capable of being transcribed but do not encode proteins other than transfer tRNA, ribosomal rRNA, messenger mRNA and housekeeping ncRNAs, which are 50 to 300nt in length. Bacterial ncRNAs are located mainly in intergenic regions, some in the 5 'untranslated region (UTR) and 3' UTR of the coding genes, can fold into stable stem loops or hairpin structures, complement the mRNA of the target gene or bind directly to the target protein resulting in attenuation or loss of function of the mRNA or protein, an important participant in bacterial resistance to antibacterial drugs. However, there is no report on the genes related to the influence of ncRNAs on drug resistance in Acinetobacter baumannii.

Disclosure of Invention

The invention aims to solve the problems that: provides a novel ncRNA for enhancing bacterial drug resistance and application thereof.

The technical scheme of the invention is as follows:

a ncRNA that enhances bacterial resistance, the ncRNA being:

(1) adeA5' UTR: the gene is positioned in the 5' -end untranslated region of the acinetobacter baumannii adeA gene; or alternatively, the first and second heat exchangers may be,

(2) adeC5' UTR: the gene is located in the 5' -end untranslated region of the acinetobacter baumannii adeC gene.

Further, the acinetobacter baumannii is AYE strain.

Further, the homology between the sequence of the adeA5' UTR and the sequence shown in SEQ ID NO.1 is 99% -100%;

or, the homology between the adeC5' UTR and the sequence shown in SEQ ID NO.2 is 96% -100%.

A drug resistant bacterial model, which is a bacterium that overexpresses the ncRNA described above.

As in the previous bacterial model, the bacteria are Acinetobacter baumannii.

As the bacterial model, acinetobacter baumannii is AYE strain.

Use of the foregoing ncrnas in constructing a drug resistant bacterial model.

Further, the antibacterial drugs tolerated by the drug-resistant bacterial model are: beta-lactams, tetracyclines, aminoglycosides, macrolides, quinolones, chloramphenicol and/or tigecycline antibacterial agents.

Further, the beta-lactam antibacterial drug is: cefotaxime and/or cefepime;

and/or, the tetracycline antibacterial drug is: doxycycline and/or tetracycline;

and/or, the aminoglycoside antibacterial drug is: gentamicin, amikacin, streptomycin and/or tobramycin;

and/or, the macrolide antibacterial drug is: azithromycin;

and/or, the quinolone antibacterial drugs are: levofloxacin, norfloxacin, moxifloxacin and/or enoxacin.

The ncRNA has very important effect on bacterial multi-drug resistance, and when the ncRNA is knocked out, the bacterial drug resistance is obviously reduced, especially the drug resistance of the norfloxacin and the gentamicin is most obviously reduced. The ncRNA of the invention can be used for improving the drug resistance of bacteria, further can be used for constructing a drug resistance model, and has higher application value in evaluating the drug effect of drugs against drug resistance bacteria.

It should be apparent that, in light of the foregoing, various modifications, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims.

The above-described aspects of the present invention will be described in further detail below with reference to specific embodiments in the form of examples. It should not be understood that the scope of the above subject matter of the present invention is limited to the following examples only. All techniques implemented based on the above description of the invention are within the scope of the invention.

Drawings

FIG. 1 is a genetic schematic of the adeABC and adeRS operons;

FIG. 2 is a hybridization diagram of a transcription blot of adeABC; and (3) injection: probe adeA, adeB and adeC respectively represent specific probes of corresponding genes; 1. 2, 3, 4 respectively represent Bowman's stationary bars BM4454, CIP 70-10, BM4547 (CIP 70-10 AdeRP116L), BM4546 (CIP 70-10 AdeST 153M); 6kb, 4.5kb and 1.4kb represent transcripts of adeABC, adeAB, adeC after binding of RNA in the strain to different probes, respectively.

FIG. 3 is a transcriptional profile of adeABC; and (3) injection: -10 and-35 are adeABC potential promoters; +1 is the transcription initiation site of adeABC; represents a ribosome binding site; []Represents adeA5' utr;a translation initiation codon representing adeABC; />Indicates the translation initiation codon of adeR.

FIG. 4 is a gel electrophoresis diagram of PCR products of two intergenic regions using cDNA and DNA of AYE as templates; and (3) injection: m: a DNA Marker; 1. 2 are PCR products with cDNA and DNA of AYE as templates adeA5' UTR respectively; 3. 4 are PCR products using cDNA and DNA of AYE as templates, adeC5' UTR, respectively.

FIG. 5 is the sequencing result of PCR products of adeA5' UTR using cDNA of AYE as a template; and (3) injection: query: gene sequencing results of PCR products with cDNA of AYE as template; sbject: the adeA5' UTR gene sequence of strain AYE.

FIG. 6 shows the sequencing results of PCR products of adeC5' UTR using cDNA of AYE as a template; and (3) injection: query: gene sequencing results of PCR products with cDNA of AYE as template; sbject: the adeC5' utr gene sequence of strain AYE.

FIG. 7 is the secondary structure of adeA5' UTR; and (3) injection: (1) the method comprises the following steps The adeABC operon ribosome binding site AGGUUU; (2) the method comprises the following steps 20bp forward repeat: UUCACACCUCAUUCACACCU

FIG. 8 is the secondary structure of the adeC5' UTR;

FIG. 9 is a gel electrophoresis characterization of adeA5'UTR and adeC5' UTR knockout strains; and (3) injection: m: a DNA Marker;1 represents a PCR amplification product of a homology arm primer of a gene; 2-4 represent PCR amplification products of discrimination primers (AYE plasma p2, AYE plasma p4, AYE csy) of the AYE strain, respectively: 5 represents pMo-Tel ^R PCR amplified products of the primers.

Detailed Description

In order to make the purposes, technical solutions and advantages of the implementation of the present invention more clear, the technical solutions in the embodiments of the present invention will be clearly and completely described below.

Example 1

1. 2-segment ncRNA: verification of adeA5'UTR and adeC5' UTR

According to the principle that elements such as a promoter and the like cannot be transcribed and ncRNA can not be transcribed but is not translated into protein, and analyzing research results reported in literature and protein coding regions published by NCBI, cDNA and DNA of AYE strain are used as templates in the research, primers adeA5'UTR Up F/Down R, adeC5' UTR Up F/Down R and polymerase chain reaction (polymerase chain reaction, PCR) are used for amplifying 2-segment intergenic regions, and amplification products are obtained according to gel electrophoresis and gene sequencing, and the specific operations are as follows:

(1) Preparation of DNA template: extracting a strain genome DNA template by a boiling method: inoculating the strain on a MH agar culture medium plate by a three-area lineation method to recover the strain, and incubating for 16-20 h at 37 ℃; a typical single colony was picked from an agar plate and placed in 50. Mu.l ddH2O, heated at 95℃for 15min, centrifuged at 10000rpm for 5min, the supernatant was carefully aspirated as a DNA template, and 2. Mu.l of the template was placed on 1% agar for detection of DNA. And (5) placing the qualified template number in a refrigerator at the temperature of minus 20 ℃ for standby.

(2) Preparation of cDNA template: (1) extraction of total RNA of bacteria: resuscitating the aboveBacterial strain bacteria were inoculated in MH broth liquid medium at 37℃and after overnight incubation at 200rpm, the bacterial strain bacteria were inoculated in a liquid medium according to 1:100 in 5ml MHB broth, to OD ₆₀₀ And the total RNA is extracted from the bacteria by operating the kit according to the instruction of the total RNA extraction kit, wherein the total RNA is 0.4-0.6. The quality of the RNA samples was analyzed by Nano Drop 2000 and 1% agarose gel electrophoresis. The integrity of RNA samples can be checked by observing the 5S, 16S, 23S rRNA bands in 1% agarose gel electrophoresis. (2) Reverse transcription of RNA: according to Goldenstar ^TM The RT6 cDNA Sythesis Mix kit instructions were used to purify and reverse transcribe RNA into cDNA.

(3) Carrying out horizontal gel electrophoresis on the amplified product to preliminarily identify the size of the product, and comparing the amplified product with the original sequence after gene sequencing.

Results 1: the CDS region of the operon adeABC was found from the gene data of Acinetobacter baumannii AYE strain published by NCBI, and the transcriptional characteristics of adeABC (promoter, transcription initiation site, ribosome binding site, translation initiation site, adeA5'UTR, adeC5' UTR, FIG. 1, FIG. 2, FIG. 3) were analyzed in combination with Isabelle Marchand results of research (Isabelle Marchand, laurence Damier-Picole, patrice Courvalin, et al expression of the RND-Type Efflux Pump AdeABC in AdeRS Two-Component System [ J ]. American Society for Microbiology,2004,48 (9): 3298-3304).

Results 2: putative 2-piece ncRNA: both adeA5'UTR and adeC5' UTR were transcribed and were not CDS region and promoter, and the fragment size of the cDNA-templated product was identical to that of the DNA-templated product after gel-level electrophoresis of the PCR products templated by AYE cDNA and DNA, respectively (FIG. 4).

Results 3: the results of gene sequencing showed that the nucleotide sequences of the PCR products using cDNA and DNA of AYE as templates were identical to the original sequences (FIGS. 5 and 6).

2. 2-segment ncRNA: molecular characterization of adeA5'UTR and adeC5' UTR

adeA5' UTR sequence (SEQ ID NO. 1):

AGAAAAUCUGGCUAUAGAAAGUGCUUCAACUCAUCAUACGCUAAAUUAUCCGUAUUUCUCCACACUUACUCCACACUUUAGUGAUUAUCCCUACACACUCAUCAAAAAUAAUACGAACAUCAAAAAGUCACUAGGUUUGGACAGU, 145nt in length;

adeC5' utr sequence (SEQ ID No. 2):

GUUCAAUGCAUCAGGGGAAUACUUAAUUUCCUCUGAUGCUUCAUAUGCUCAAAAUUUACUUUAUUUGGAGAAUACU, 76nt in length.

BLAST (Basic Local Alignment Search Tool) and RNAflod (RNA secondary structure prediction) tools analyze the molecular characteristics (primary and secondary) of 2-piece ncrnas.

Results 1: BLAST results show that the nucleotide sequences of 2-segment ncRNAs have high identity in Acinetobacter baumannii: adeA5' UTR (99% or more); adeC5' utr (96% or more).

Results 2: the adeA5'UTR (FIG. 7) and the adeC5' UTR (FIG. 8) have a stable stem-loop structure (ΔG: -18.22 kcal/mol) and a hairpin structure (ΔG: -22.70 kcal/mol), respectively.

3. Homology arm of knockout gene and design of primer

Firstly, designing homology arms of a to-be-knocked-out gene, detection primers and enzyme cutting sites through gene sequences of AYE strains obtained by NCBI database, and adopting a mode of artificial synthesis on upper and lower homology arms of adeA5'UTR and adeC5' UTR to obtain a plasmid template containing the homology arm sequences, wherein the primers are shown in table 1, and the homology arm sequences are as follows:

upper and lower homology arm sequences of adeA5' UTR (SEQ ID NO. 3):

CGAATAACACTCATGCCTTCACGTTTTAAATAATTTTCAATAATGTCGCCAATATCGTAGTCATCTTCTACCACAAGAATAACTTTATCTTGGCAATCAAAAGAAAAAGAATGATCAAACATATGCAAAAGCATCTTTTACTTCCTTTATTTTTATCTATTGGGCTGATATTACAGGGGTGTGATTCAAAAGAAGTCGCTCAAGCTGAGCCACCACCGGCTAAAGTCAGTGTATTAAGCATTCAACCGCAG；

upper and lower homology arm sequences of adeC5' UTR (SEQ ID No. 4):

GGTGGCATGATTTCAGCAACCATTCTGGCTATTTTCTTTGTTCCCGTGTTTTTTATCTTCATTTTGGGTGCAGTAGAAAAGCTATTTTCCTCTAAGAAAAAAATCTCATCCTAAATGTCTAAATCGGCAATCGTATCTCGTGGACTCATTCTTTCTACACTCTCAGTCACTTTAGTTGCATGTGTCAATATGCAAGCGCCACAGCCTGCAATCACATCTCATATTCC。

TABLE 1 primer design

Note that: the front base is the protecting base of the restriction enzyme site

4. Preparation of homologous recombinant vectors

(1) amplification of upper and lower homology arms of adeA5'UTR and adeC5' UTR: the homology arm gene was amplified using the artificially synthesized homology arm gene as a template with the adeA 5'UTRUp F (Not 1)/adeA 5' UTR Down R (BamHI) and adeC5'UTRUp F (Not 1)/adeC 5' UTR Down R (BamHI) primer pairs, respectively.

(2) Ligation of recombinant vectors: suicide vector pMo-Tel ^R The amplified adeA5'UTR and adeC5' UTR homology arm genes were digested with BamHI/Not1 restriction enzymes, respectively, to give pMo-Tel with BamHI/Not1 cohesive ends ^R The homology arms of the plasmid and the corresponding gene are then ligated using T4DNA ligase.

(3) Transformation of the recombinant vector: the ligation product was transferred into E.coli competent cells Dh5α by chemical transformation, resuscitated and plated on a solid medium plate with kanamycin resistance (50. Mu.g/ml), and incubated at 37℃for 16-20 h.

(4) Identification of recombinant vectors: monoclonal colonies were picked and used with plasmid primer pMo-Tel ^R F/pMo130-Tel ^R And (3) screening and constructing a recombinant vector successfully by using the R and homologous arm primers, and verifying gene sequencing.

5. Introduction of recombinant vectors

The recombinant plasmid was introduced into AYE recipient bacteria using bacterial binding. The specific method comprises the following steps:

(1) The recombinant plasmid was electrotransferred to E.coli competent cells 47055, and after resuscitation, it was plated on a solid medium plate having kanamycin resistance (50. Mu.g/ml), and incubated at 37℃for 16 to 20 hours.

(2) Monoclonal colonies were picked and used with plasmid primer pMo-Tel ^R F/pMo130-Tel ^R R and homology arm primers identify bacteria that were successfully introduced.

(3) The identified 47055 bacteria were inoculated into 5ml LB (Luria-Bertani) liquid medium with kanamycin resistance (50. Mu.g/ml), cultured overnight at 37℃at 200rpm, and AYE were picked up and monoclonal in 5ml LB liquid medium at 37℃at 200rpm to the growth log phase.

(4) 47055 bacterial liquid and AYE bacterial liquid are mixed in a ratio of 3:1 in a 2ml EP tube, supernatant is discarded after centrifugation at 4000rpm for 2min, 1ml of physiological saline is added for resuspension, centrifugation is carried out to obtain supernatant for clarification, and supernatant is discarded.

(5) 100. Mu.l of physiological saline was added to resuspend the bacteria, and then the bacteria were dripped onto a LB solid medium plate with a 0.45 μm NC membrane for binding, and incubated at 37℃for 6 to 8 hours.

(6) The bacteria bound on the NC membrane were scraped off and resuspended in a 2ml EP tube containing 1ml LB liquid medium, centrifuged at 4000rpm for 2min, the supernatant discarded, resuspended again, centrifuged to clarify the supernatant, and the supernatant discarded.

(7) 200. Mu.l of physiological saline was added to resuspend the bacteria, 100. Mu.l of the bacterial liquid was spread on LB solid medium plates having resistance to potassium tellurite (30. Mu.g/ml) and gentamicin (16. Mu.g/ml) (T+G), and incubated at 37℃for 16 to 20 hours.

(8) Monoclonal colonies were picked up and amplified using primers csyF/csy R, AYE plasmid 2F/AYE plasmid 2R, AYE plasmid 4F/AYE plasmid 4R, pMo130-Tel ^R F/pMo130-Tel ^R R, homology arm primer screening is successful to introduce AYE strain of recombinant vector.

6. Gene knockout

The experiment uses the homologous recombination principle and suicide vector pMo-130-Tel ^R The resistance to tellurite was knocked out by two-step screening of the adeA5'UTR and adeC5' UTR genes. The specific method comprises the following steps:

(1) The AYE strain which is successfully introduced into the recombinant vector is inoculated into 10% sucrose YT liquid culture medium for daily subculture, and meanwhile, the subcultured bacterial liquid is diluted and coated on a 10% sucrose YT solid culture medium plate, and incubated for 16-20 h at 37 ℃.

(2) Picking colonies on a 10% sucrose YT solid culture medium plate, streaking and inoculating on a T+G solid culture medium plate and an LB solid culture medium plate sequentially, and then incubating at 37 ℃ for 16-20 h. Bacteria growing on LB solid medium but not on T+G solid medium were selected, PCR products were amplified with the above discrimination primers and homology arm primers, and then the knock-out strain was identified by electrophoresis (FIG. 9) and genome sequencing.

7. Drug sensitivity test

Preparing bacterial liquid: the strain is inoculated on LB solid medium plate by three-line zoning method, incubated for 16-20 h at 37 ℃, several monoclonal colonies are picked up and resuspended in sterile physiological saline, 600nm (OD) ₆₀₀ ) Lower absorbance, adjusting the physiological saline to the Mc0.5 (1×10) ⁸ CFU/ml), diluted 20-fold for use.

Preparation of antibacterial drugs: the antibacterial drug is prepared into an antibacterial drug storage stock solution with corresponding concentration by using a solvent specified by a standard published by CLSI2019, and the stock solution is properly diluted by using the specified solvent, so as to obtain a series of liquid medicine with the concentration of 10240 mug/ml, the concentration of 0.625 mug/ml respectively.

The measuring method comprises the following steps: referring to the CLSI2019 standard, the MIC values of antibacterial drug pairs AYE such as beta-lactams, tetracyclines, aminoglycosides, macrolides, quinolones and sulfonamides and the like and gene knockout strains of the antibacterial drug pairs are measured by adopting a trace broth dilution method by taking staphylococcus aureus ATCC 29213 and escherichia coli ATCC 25922 as quality control strains. The specific method comprises the following steps:

taking 96-well plates, adding 180 mu l of CAMH broth culture medium, 10 mu l of medicinal liquid with corresponding concentration, 10 mu l of prepared bacterial liquid, and finally adding drugs with the concentration of 1024 mu g/ml, 512 mu g/ml, the concentration of the final drug being equal to the total amount of the final drug, 0.0317 mu g/ml, and the final inoculum size being about 5 multiplied by 10 ⁵ CFU/ml was additionally filled with blank wells (190. Mu.l of CAMHB and 10. Mu.l of each of the liquid medicines) and incubated at 37℃for 16-20 h.

Interpretation criteria: after incubation, OD was measured by using an ELISA reader ₆₀₀ Less than 0.10, is considered sterile grown, and the colored drug is visually observed to give MIC values.

Results: the results of the drug sensitive experiments showed (Table 2) that 2 knock-out strains all had different levels of decrease in MIC for the antibacterial drugs (beta-lactams, quinolones, tetracyclines, aminoglycosides, macrolides, etc.), with the most significant decrease in MIC values for aminoglycosides and quinolones, and the AYE DeltaadeA 5'UTR strain was significantly lower than the AYE DeltaadeC 5' UTR strain, especially from > 1024. Mu.g/ml to 128. Mu.g/ml and 32. Mu.g/ml, respectively.

TABLE 2 results of drug sensitivity experiments

In conclusion, the ncRNA has very important effect on bacterial multi-drug resistance, and when the ncRNA is knocked out, the bacterial drug resistance is obviously reduced, especially the drug resistance to norfloxacin and gentamicin is most obviously reduced. The ncRNA of the invention can be used for improving the drug resistance of bacteria, further can be used for constructing a drug resistance model, and has higher application value in evaluating the drug effect of drugs against drug resistance bacteria.

SEQUENCE LISTING

<110> Chengdu medical college

<120> drug-resistant non-coding RNA of multiple drug-resistant Acinetobacter baumannii and application thereof

<130> GY044-2021P0113874CCZ

<150> 2020116441207

<151> 2020-12-31

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 145

<212> RNA

<213> artificial sequence

<400> 1

agaaaaucug gcuauagaaa gugcuucaac ucaucauacg cuaaauuauc cguauuucuc 60

cacacuuacu ccacacuuua gugauuaucc cuacacacuc aucaaaaaua auacgaacau 120

caaaaaguca cuagguuugg acagu 145

<210> 2

<211> 76

<212> RNA

<213> artificial sequence

<400> 2

guucaaugca ucaggggaau acuuaauuuc cucugaugcu ucauaugcuc aaaauuuacu 60

uuauuuggag aauacu 76

<210> 3

<211> 251

<212> DNA

<213> artificial sequence

<400> 3

cgaataacac tcatgccttc acgttttaaa taattttcaa taatgtcgcc aatatcgtag 60

tcatcttcta ccacaagaat aactttatct tggcaatcaa aagaaaaaga atgatcaaac 120

atatgcaaaa gcatctttta cttcctttat ttttatctat tgggctgata ttacaggggt 180

gtgattcaaa agaagtcgct caagctgagc caccaccggc taaagtcagt gtattaagca 240

ttcaaccgca g 251

<210> 4

<211> 227

<212> DNA

<213> artificial sequence

<400> 4

ggtggcatga tttcagcaac cattctggct attttctttg ttcccgtgtt ttttatcttc 60

attttgggtg cagtagaaaa gctattttcc tctaagaaaa aaatctcatc ctaaatgtct 120

aaatcggcaa tcgtatctcg tggactcatt ctttctacac tctcagtcac tttagttgca 180

tgtgtcaata tgcaagcgcc acagcctgca atcacatctc atattcc 227

Claims (7)

1. A ncRNA for reducing acinetobacter baumannii resistance, wherein said ncRNA is:

（1）adeA5' UTR: gene located in Acinetobacter baumanniiadeAThe 5' -untranslated region of the gene;

the saidadeAThe sequence of the 5' UTR is shown as SEQ ID NO. 1; or alternatively, the first and second heat exchangers may be,

（2）adeC5' UTR: gene located in Acinetobacter baumanniiadeCThe 5' -untranslated region of the gene;

the saidadeCThe sequence of the 5' UTR is shown in SEQ ID NO. 2.

2. The ncRNA of claim 1 wherein: the Acinetobacter baumannii is AYE strain.

3. A bacterial model with reduced resistance, characterized by: the bacterial model is Acinetobacter baumannii knocked out of the ncRNA as claimed in claim 1 or 2.

4. A bacterial model according to claim 3, wherein: the Acinetobacter baumannii is AYE strain.

5. Use of the ncRNA of claim 1 or 2 for constructing a bacterial model with reduced resistance.

6. The use according to claim 5, wherein: the bacterial model has reduced resistance to the following drugs: beta-lactams, tetracyclines, aminoglycosides, macrolides, quinolones, chloramphenicol and/or tigecycline antibacterial agents.

7. The use according to claim 6, wherein:

the beta-lactam antibacterial drug is as follows: cefotaxime and/or cefepime;

and/or, the tetracycline antibacterial drug is: doxycycline and/or tetracycline;

and/or, the aminoglycoside antibacterial drug is: gentamicin, amikacin, streptomycin and/or tobramycin;

and/or, the macrolide antibacterial drug is: azithromycin;

and/or, the quinolone antibacterial drugs are: levofloxacin, norfloxacin, moxifloxacin and/or enoxacin.