CN103571836A - Efficient antibacterial activity antisense nucleic acid sequence of multidrug resistant Acinetobacter baumannii - Google Patents
Efficient antibacterial activity antisense nucleic acid sequence of multidrug resistant Acinetobacter baumannii Download PDFInfo
- Publication number
- CN103571836A CN103571836A CN201210251518.3A CN201210251518A CN103571836A CN 103571836 A CN103571836 A CN 103571836A CN 201210251518 A CN201210251518 A CN 201210251518A CN 103571836 A CN103571836 A CN 103571836A
- Authority
- CN
- China
- Prior art keywords
- multidrug resistant
- resistant acinetobacter
- acinetobacter baumannii
- nucleic acid
- antisense
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention discloses an antisense oligonucleotide sequence for inhibiting growth of multidrug resistant Acinetobacter baumannii, and an application thereof, and belongs to the field of novel antibacterial preparation research and development. According to the invention, the computer-assisted design and oligonucleotide dot blot hybridization combined technology is adopted to screen the antisense oligonucleotide adopting coding gene gyrA of the multidrug resistant Acinetobacter baumannii topoismerase IIA subunit as target gene so as to inhibit growth of multidrug resistant Acinetobacter baumannii; the antisense oligonucleotide sequence has significant multidrug resistant Acinetobacter baumannii growth inhibition activity at a low concentration, and can present rapid and efficient bactericidal activity (ie., cause death of multidrug resistant Acinetobacter baumannii) when the concentration is increased; and the designed antisense nucleic acid has characteristics of strong inhibition activity and high specificity, is suitable for treatment of multidrug resistant Acinetobacter baumannii infections, and can be potentially developed into the anti-multidrug resistant Acinetobacter baumannii infection drug.
Description
Technical field
The present invention relates to a kind of anti sense nucleotide sequence, be specially a kind of anti sense nucleotide sequence that suppresses the growth of multidrug resistant Acinetobacter bauamnnii bacillus.
Background technology
Thereby antisense technology is to express for the antisense nucleic acid inhibition specific gene of particular target sequence according to nucleic acid hybridization principle design, its development is extremely rapid in recent years, as a kind of new gene therapy means, antisense technology has been widely used in the medical researches such as virus infection, tumour, heredopathia, and obtained great successes, there is extremely important theoretical and practical significance.The advantages such as prokaryotic organism are compared with eukaryote, have genome structure simple, and adjusting and controlling growth mechanism is relatively single, are applied to by antisense technology the application potential that prokaryotic organism system has " mystery " undoubtedly.
At present, all there is corresponding resistant organism in the microbiotic of nearly all clinical application, and the microbiotic that therefore adopts traditional target spot to screen is difficult to avoid the problem of resistance.Scientist has completed the genome sequencing work of multiple important pathogenic bacteria, and new-generation sequencing technology will make this register increase sharply.These huge genome sequence column informations are also found whereby new antibacterials action target spot for genome times afterwards comprehensively analyzing gene function possibility are provided.In recent years, adopt the progress of antisense technology Screening and Identification pathogenic bacterium indispensable gene in genome range remarkable, and these indispensable genes likely develop into new antibacterials target spot in recent years, antisense technology has been brought into play vital role in novel antibacterial medicament research and development.People adopt antisense technology to identify indispensable gene, have found many antibacterials action target spots with development prospect; For the antisense nucleic acid of drug resistant gene effectively reversing drug resistance bacterium to existing antibiotic susceptibility, antisense nucleic acid for growth indispensable gene has significant anti-microbial activity, by improving its Cell uptake characteristic and anti-microbial activity, antisense nucleic acid is expected to develop into antibacterials of new generation, for the mankind benefit.
Acinetobacter bauamnnii be distributed widely in environment and healthy population in, very easily on medical material, stick, can cause the infection of the multiple locations such as human respiratory, urinary tract, central nervous system, in recent years due to the extensive application of Broad spectrum antibiotics, this microbial infection is obviously risen.The treatment of infection difficulty that current existing microbiotic causes for the Acinetobacter bauamnnii of the even general resistance of multidrug resistant, because its resistance mechanism is complicated and very likely have new resistance mechanism, therefore traditional antibacterials have suitable limitation in treatment, the antibiotic preparation making new advances in the urgent need to exploitation.
Antisense nucleic acid can form by the specific binding with target gene sterically hindered, suppresses transcribing and translating of target gene.The necessary gene of bacterial growth of take is target, and utilizing antisense nucleic acid to make that its growth is required must protein delation, can reach the object of bacteria growing inhibiting.The method infecting from gene level searching treatment multidrug resistant Acinetobacter bauamnnii is expected to become the new way of anti-infective therapy.
GyrA gene is the indispensable gene of bacterial growth, and the encoding gene as type Ⅱ topoisomerase A subunit plays a significant role in bacterium DNA replication, suppresses the growth that its expression can anti-bacteria.Can antisense nucleic acid be form stable DNA:RNA heteroduplex (heteroduplexes) structure to the restraining effect key of target gene.Due to the sterically hindered effect of mRNA secondary structure, thereby only have minority site to be combined with antisense nucleic acid, bring into play down regulation of gene expression effect, so the design of effective nucleic acid sequence screening is the key of antisense technology.Also there is no so far the efficient anti sense nucleotide sequence for multidrug resistant Acinetobacter bauamnnii gyrA gene.
Summary of the invention
In order to overcome multidrug resistant Acinetobacter bauamnnii to the extensive resistance of existing microbiotic, the difficult problem that anti-infective therapy's success ratio is low, the invention provides a kind of anti sense nucleotide sequence for multidrug resistant Acinetobacter bauamnnii with high-efficiency antimicrobial activity, this sequence is the nucleotide sequence of one section of synthetic, and it and multidrug resistant Acinetobacter bauamnnii indispensable gene gyrA specific site sequence are complementary.By doses anti sense nucleotide sequence of the present invention in addition stability modify and go in thalline, thereby such antisense nucleic acid can be combined with target gene specific and be suppressed the expression of target gene, reach efficient, low toxicity or suppress innocuously the object of the growth of multidrug resistant Acinetobacter bauamnnii, and then the treatment disease relevant with its infection.
The present invention adopts following technical scheme to realize:
1. the present invention is directed to gyrA full length gene coding region sequence, by utilizing two kinds of mRNA secondary structure analysis software predictions of Mfold and RNA structure4.6, analyze the secondary structure of gyrA mRNA, the secondary structure figure of gyrA mRNA while drawing 37 ℃ with minimum free energy principle, and carry out free energy calculating, comprise the parameters such as Overall Δ G, Duplex Δ G, Break targ Δ G, oligo-self Δ G and oligo-oligo Δ G, select the local hybridization of mRNA relax zone, as structural regions such as hair fastener, expansion ring, interior rings, design antisense oligonucleotide probe.Utilize dot hybridization technology, the gyrA mRNA molecule of the antisense oligonucleotide probe of design and digoxigenin labeled is carried out in situ hybridization, verify the validity that it is combined with target gene, filter out the anti sense nucleotide sequence that an energy is combined with gyrA stable gene.
2. according to the anti sense nucleotide sequence described in above 1, it is characterized in that thering is the nucleotide sequence complementary with the following sequence (Seq ID No.1) of multidrug resistant Acinetobacter bauamnnii gyrA gene: 5 ' GAUGGUGAUAGCGCUGCGGC 3 '
3. according to the anti sense nucleotide sequence described in above 1, it is characterized in that thering is following sequence (Seq ID No.2):
5’GCCGCAGCGCTATCACCATC?3’
4. according to the anti sense nucleotide sequence of any one in above 1-3 item, it is characterized in that the base complementrity of it and multidrug resistant Acinetobacter bauamnnii gyrA mRNA, can effectively suppress multidrug resistant Acinetobacter bauamnnii and grow.
Anti sense nucleotide sequence provided by the present invention, modifies and imports in bacterial body through overstability, significantly the growth of anti-bacteria and without overt toxicity effect.In a preferred embodiment of the invention, 12 continuous base sequence Seq ID No.3 of described antisense nucleic acid are synthetic with the form of peptide nucleic acid(PNA), through wearing film peptide KFFKFFKFFK sequence modification, reach antisense sequences is proceeded to the object in bacterial body with stable form.
Anti sense nucleotide sequence provided by the present invention can be used for the medicine that preparation antagonism multidrug resistant Acinetobacter bauamnnii infects, and its restraining effect to bacterial growth is that traditional microbiotic cannot be equal to.
Accompanying drawing explanation
Fig. 1 is the growth curve of bacteria (5 μ mol/L peptide nucleic acid(PNA) concentration can significantly suppress Acinetobacter bauamnnii growth) of drawing according to mensuration OD600 value under the PNA effect of different concns
Fig. 2 is the growth curve of bacteria (5 μ mol/L peptide nucleic acid(PNA) concentration have good bacteria growing inhibiting effect, and 10 μ mol/L peptide nucleic acid(PNA) concentration have fungicidal activity) of drawing according to plate count under the PNA effect of different concns
Embodiment
1: antisense nucleic acid synthetic
For keeping under study for action stable of antisense nucleic acid, be difficult for being degraded and lose inhibition usefulness, described antisense nucleic acid is synthetic to increase its stability with the form of peptide nucleic acid(PNA) (PNA), and add and wear film peptide KFFKFFKFFK sequence modification, overcome bacterial film structure to macromolecular barrier action, to reach, antisense sequences is proceeded to the object in bacterial body with stable form.
Peptide nucleic acid(PNA) (PNA) is the DNA analogue of synthetic, with peptide bond (NH-CO), replaces natural skeleton 3 ', the 5 ' phosphodiester bond of nucleic acid, have highly water-soluble, high stability, with the specificity high of base pairing.Yet peptide nucleic acid(PNA) is more much larger than the molecular weight of common drug, cause it to be difficult to by bacterial outer membrane, penetrate in bacterial body smoothly, by wearing film peptide, modify the penetrating power that can improve peptide nucleic acid(PNA).In addition, the length of peptide nucleic acid(PNA) also will affect the film ability of wearing of himself, and the peptide nucleic acid(PNA) of general 9mer-12mer when wearing film peptide KFFKFFKFFK and is connected, can significantly improve the penetrating power of peptide nucleic acid(PNA), simultaneously effective raising Antisense Suppression efficiency.
Therefore, the PNA sequence of 12mer has been selected in this research, selects wherein 12 continuous base sequence seq ID No.3 of described anti sense nucleotide sequence, carries out peptide nucleic acid(PNA) synthetic, and adds and wear film peptide sequence KFFKFFKFFK and modify, and forms peptide peptide nucleic acid(PNA) (KFF)
3k-PNA.
2: the cultivation of multidrug resistant Acinetobacter bauamnnii
Institute is provided by clinical laboratory of No.1 Hospital Attached to the Chongqing Medical University with multidrug resistant Acinetobacter bauamnnii bacterial strain, and drug sensitive test result shows that it is to Ampicillin Trihydrate, piperacillin, Kefzol, cefuroxime axetil, ceftazime, cefepime, imipenum, tobramycin, Levofloxacin, trimethoprim/sulfamethoxazole, ampicillin/sulbactam, piperacillin/Tazobactam Sodium, cephalofruxin, cefotetan, ceftriaxone, aztreonam, gentamicin, Ciprofloxacin, the equal resistance of furadantin.Inoculation is cultivated based on 37 ℃ of shaking table shaken overnight in LB liquid culture.
3: the growth-inhibiting effect of antisense nucleic acid to multidrug resistant Acinetobacter bauamnnii
The bacterium liquid of above-mentioned incubated overnight is diluted to approximately 10 with MHB substratum
5cFU/ml, the bacterium liquid of getting after 100 μ l dilutions adds 96 orifice plates, adds (KFF) simultaneously
3k-PNA, makes its concentration be respectively 0,5,10,20,40 μ mol/L.96 orifice plates are put into 37 ℃ of incubators and cultivate 24h, respectively at 0h, 1h, 2h, 3h, 4h, 5h, 6h, 7h, 8h takes out and measures OD600 value, simultaneously in oh, 2h, 4h, 6h, 8h does plate count, observes (KFF)
3the restraining effect of K-PNA to bacterial growth.
The external bacteriostatic test result to multidrug resistant Acinetobacter bauamnnii shows: the peptide nucleic acid(PNA) that this institute is used is the significantly growth of anti-bacteria when 5 μ mol/L concentration, when 10 μ mol/L concentration, has fungicidal activity, the results are shown in Figure 1, Fig. 2.Cell toxicity test has no obvious toxic reaction when 40 μ mol/L concentration.Result shows that anti sense nucleotide sequence provided by the present invention has extremely strong anti-microbial activity, can be used for preparing the medicine that anti-multidrug resistant Acinetobacter bauamnnii infects.
Claims (7)
1. an antisense nucleotide, is characterized in that having the nucleotide sequence with the following sequence complementation of multidrug resistant Acinetobacter bauamnnii gyrA gene: 5 ' GAUGGUGAUAGCGCUGCGGC 3 '.
2. antisense nucleotide as claimed in claim 1, is characterized in that having following sequence: 5 ' GCCGCAGCGCTATCACCATC 3 '
3. the antisense nucleotide as described in claim 1-2, is characterized in that the base complementrity of it and multidrug resistant Acinetobacter bauamnnii gyrA mRNA effectively suppressing the growth of multidrug resistant Acinetobacter bauamnnii.
4. as the modification type of the antisense base sequences of any one in claim 1-3.
5. if an antisense base sequences in claim 1-3 is as the application that treats and/or prevents the genomic medicine of multidrug resistant Acinetobacter bauamnnii infection.
6. as the application of any one anti sense nucleotide sequence in medical science in claim 1-3.
7. the modification type of anti sense nucleotide sequence as claimed in claim 4 is as the application that treats and/or prevents the genomic medicine of multidrug resistant Acinetobacter bauamnnii infection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210251518.3A CN103571836A (en) | 2012-07-20 | 2012-07-20 | Efficient antibacterial activity antisense nucleic acid sequence of multidrug resistant Acinetobacter baumannii |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210251518.3A CN103571836A (en) | 2012-07-20 | 2012-07-20 | Efficient antibacterial activity antisense nucleic acid sequence of multidrug resistant Acinetobacter baumannii |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103571836A true CN103571836A (en) | 2014-02-12 |
Family
ID=50044548
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210251518.3A Pending CN103571836A (en) | 2012-07-20 | 2012-07-20 | Efficient antibacterial activity antisense nucleic acid sequence of multidrug resistant Acinetobacter baumannii |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103571836A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108271397A (en) * | 2015-07-13 | 2018-07-10 | 阿瑞斯遗传股份有限公司 | For predicting the genetic test of the resistance of acinetobacter calcoaceticus species combating microorganisms agent |
| CN113862271A (en) * | 2020-12-31 | 2021-12-31 | 成都医学院 | Drug-resistant non-coding RNA of multiple drug-resistant acinetobacter baumannii and application thereof |
-
2012
- 2012-07-20 CN CN201210251518.3A patent/CN103571836A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| GENBANK: "HQ724533", 《GENBANK》 * |
| PRATHIBA KURUPATI ET AL.: "Inhibition of Gene Expression and Growth by Antisense Peptide Nucleic Acids in a Multiresistant _-Lactamase-Producing Klebsiella pneumoniae Strain", 《ANTIMICROBIAL AGENTS AND CHEMOTHERAPY》 * |
| 魏艳艳 等: "泛耐药研究进展", 《安徽医药》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108271397A (en) * | 2015-07-13 | 2018-07-10 | 阿瑞斯遗传股份有限公司 | For predicting the genetic test of the resistance of acinetobacter calcoaceticus species combating microorganisms agent |
| CN113862271A (en) * | 2020-12-31 | 2021-12-31 | 成都医学院 | Drug-resistant non-coding RNA of multiple drug-resistant acinetobacter baumannii and application thereof |
| CN113862271B (en) * | 2020-12-31 | 2024-02-23 | 成都医学院 | Drug-resistant non-coding RNA of multi-drug-resistant Acinetobacter baumannii and application of drug-resistant non-coding RNA |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Guo et al. | Responses of antibiotic and heavy metal resistance genes to bamboo charcoal and bamboo vinegar during aerobic composting | |
| Hughes et al. | Evolutionary trajectories to antibiotic resistance | |
| Huang et al. | Effect of plant physiological characteristics on the removal of conventional and emerging pollutants from aquaculture wastewater by constructed wetlands | |
| Bhagat et al. | Molecular and functional characterization of endophytic fungi from traditional medicinal plants | |
| Zhu et al. | Genome sequence of Stenotrophomonas maltophilia RR-10, isolated as an endophyte from rice root | |
| CN102282248A (en) | Methods for isolating bacteria | |
| Simoni et al. | Spread of colistin resistance gene mcr-1 in Italy: characterization of the mcr-1.2 allelic variant in a colistin-resistant blood isolate of Escherichia coli | |
| CN105950506B (en) | One plant of bacillus amyloliquefaciens and its application for control of plant bacterial wilt | |
| CN103571836A (en) | Efficient antibacterial activity antisense nucleic acid sequence of multidrug resistant Acinetobacter baumannii | |
| CN101200483A (en) | Antisense nucleic acid of resistant and tolerant dimethoxyphenecillin staphylococcus aureus drug resistant gene | |
| CN105287622A (en) | Method, target spot and application for reducing invasiveness of pseudomonas aeruginosa through NO accumulation | |
| CN101418293A (en) | Tiny RNA-21 antisense oligonucleotides and use thereof | |
| Mohamedsalih et al. | Antimicrobial activity of silver nanoparticles with antibiotics against clinically isolated Acinetobacter baumannii | |
| CN1213057C (en) | Structure of antisense oligonucleotide to inhibit activity of telomerase and its application | |
| Waldor | Disarming pathogens-a new approach for antibiotic development | |
| Cheng et al. | Dual RNA sequencing analysis of Bacillus amyloliquefaciens and Sclerotinia sclerotiorum during infection of soybean seedlings by S. sclerotiorum unveils antagonistic interactions | |
| Hayashi et al. | Cas9-assisted biological containment of a genetically engineered human commensal bacterium and genetic elements | |
| CN104988083A (en) | Streptomyces platensis and applications of Streptomyces platensis in production of platensimycin and platencin | |
| Khwathisi | Strain improvement and characterization of antibiotic producing microorganisms from soil | |
| CN101215561B (en) | MiR-181a antisense oligonucleotide with leukemia resisting action and application thereof | |
| CN104711237A (en) | Method for regulating and controlling activity of 1,4-dihydroxy-2-naphthoic acid-polyisoprene transferase | |
| CN105200084B (en) | A kind of method of insect cell expression antibacterial peptide Cecropin DC1 | |
| CN110354127A (en) | Application of the ethacridine lactate in Killing Mycobacterium Tuberculosis drug | |
| CN105061537B (en) | A kind of nucleoside antibiotic and its application in antibacterials are prepared | |
| CN102349896A (en) | Pharmaceutical composition of imipenem, cilastatin and sulbactam |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140212 |