CN113846098A - Small RNA and application thereof in treatment of cardiovascular diseases - Google Patents

Small RNA and application thereof in treatment of cardiovascular diseases Download PDF

Info

Publication number
CN113846098A
CN113846098A CN202111110039.5A CN202111110039A CN113846098A CN 113846098 A CN113846098 A CN 113846098A CN 202111110039 A CN202111110039 A CN 202111110039A CN 113846098 A CN113846098 A CN 113846098A
Authority
CN
China
Prior art keywords
nucleic acid
acid molecule
srna
seq
angiotensin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202111110039.5A
Other languages
Chinese (zh)
Other versions
CN113846098B (en
Inventor
蒋澄宇
汤克功
赵煜
王小娜
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Basic Medical Sciences of CAMS
Original Assignee
Institute of Basic Medical Sciences of CAMS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Basic Medical Sciences of CAMS filed Critical Institute of Basic Medical Sciences of CAMS
Priority to CN202111110039.5A priority Critical patent/CN113846098B/en
Priority claimed from CN202111110039.5A external-priority patent/CN113846098B/en
Publication of CN113846098A publication Critical patent/CN113846098A/en
Application granted granted Critical
Publication of CN113846098B publication Critical patent/CN113846098B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/12—Antihypertensives
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/485—Exopeptidases (3.4.11-3.4.19)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/17—Metallocarboxypeptidases (3.4.17)
    • C12Y304/17023—Angiotensin-converting enzyme 2 (3.4.17.23)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Cardiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Zoology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Vascular Medicine (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Urology & Nephrology (AREA)
  • Virology (AREA)
  • Hospice & Palliative Care (AREA)
  • Epidemiology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention relates to a small RNA and application thereof in treatment of cardiovascular diseases. Specifically, the invention provides a polypeptide as set forth in SEQ ID NO:1 or a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% sequence identity thereto, vectors, host cells, pharmaceutical compositions comprising the same, and uses thereof in the treatment of cardiovascular disease.

Description

Small RNA and application thereof in treatment of cardiovascular diseases
Technical Field
The present invention relates to the field of nucleic acid therapy. More specifically, the present invention relates to a novel small RNA and its use in the treatment of cardiovascular diseases, in particular, hypertension, myocarditis, myocardial hypertrophy, heart failure, myocardial infarction, cardiomyopathy.
Background
The concept of using nucleic acid molecules, including RNA molecules, as therapeutic drugs has moved from concept to clinical reality over the past few decades. In fact, the nucleic acid molecule possesses many attributes that make it useful as a therapeutic drug. They are capable of folding into complex conformations that allow them to bind to proteins, small molecules or other nucleic acids, some of which may even form catalytic centers. Small interfering RNA (siRNA) has a wider and wider prospect as an effector molecule of RNAi as a therapeutic drug. At present, a plurality of siRNA drugs enter clinical experiments, indicating good development prospect. Generally, siRNA, miRNA and other small non-coding RNAs are referred to indiscriminately as small nucleic acids or small RNAs (srnas). Small RNAs are a large class of small, non-coding RNAs that are encoded within the genome of animals and plants and are approximately 18-24 nucleotides in length. Small RNAs have been shown to be involved in a variety of regulatory pathways including development, viral defense, hematopoietic processes, organogenesis, cell proliferation and apoptosis, fat metabolism, and the like.
The present inventors' group found in previous studies that various compounds capable of promoting nucleic acid delivery or synthetic compounds were extracted from chinese medicine, and that the extracted compounds or various combinations were utilized to promote the uptake and entry of nucleic acids such as sRNA into target cells and to promote the entry of nucleic acids into target sites in subjects in need thereof (see, WO2019184991a1, CN111918672A, the contents of which are incorporated herein by reference).
Cardiovascular diseases are the most serious health problems in the whole world, and hypertension is the most main risk factor of cardiovascular diseases and easily causes the problems of atherosclerosis, coronary heart disease, myocardial infarction, heart failure and the like. Hypertension, i.e., a long-lasting rise in blood pressure, is one of the important risk factors for death and morbidity from cardiovascular diseases. It is estimated that 10 million people worldwide are affected by hypertension, which accounts for over half of the 1700 million deaths each year due to cardiovascular disease. Approximately 5% of patients with hypertension have underlying causes, but the vast majority are diagnosed as "essential hypertension," the cause of which is unknown.
Blood pressure is determined by several parameters of the cardiovascular system, including the balance of blood volume and cardiac output and arterial tension, which are regulated by intravascular volume and the neurohumoral system. Maintaining physiological blood pressure levels involves a complex interplay of various factors of an intact neurohumoral system, including the renin-angiotensin-aldosterone system, the natriuretic peptide system, the endothelin system, the sympathetic nervous system, and the immune system. Failure or disruption of factors involved in blood pressure control in any component of this complex neurohumoral system may directly or indirectly lead to increased mean blood pressure or blood pressure variability, or both, over time, as a result of damage to target organs such as cardiovascular disease.
Among the first-line hypotensive drugs currently recommended by international guidelines for hypertension are diuretics, calcium channel blockers, angiotensin converting enzyme inhibitors, beta-blockers, and angiotensin receptor antagonists. Although the development of modern medicine has achieved significant efficacy in controlling blood pressure, the compliance rate of blood pressure control in patients receiving treatment for lowering blood pressure is not satisfactory, and many drugs have significant side effects, such as: dizziness, flushed face, cold limbs, chest distress, tinnitus and the like, which seriously affect the medication compliance of patients.
Disclosure of Invention
The present application is based in part on the following findings: the present inventors isolated a novel small RNA from a Chinese herbal medicine and unexpectedly found that the small RNA targets the 3' UTR of the Angiotensin Converting Enzyme (ACE) gene of humans and mice and is effective in improving or reducing angiotensin II-induced hypertension, myocarditis, myocardial hypertrophy, heart failure, myocardial infarction, cardiomyopathy, and myocardial fibrosis.
Based on the above findings, in a first aspect, the present invention provides an isolated nucleic acid molecule comprising or consisting of the sequence:
A) SEQ ID NO:1 (GGGAUAAGGAUUGGCUCU);
B) and SEQ ID NO: 1(GGGAUAAGGAUUGGCUCU), having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% sequence identity;
C) and SEQ ID NO:1 has at least 10, preferably at least 9, at least 8, at least 7, at least 6, at least 5, at least 4, at least 3, at least 2, at least 1 nucleotide substitutions, deletions or additions to the sequence;
D) is capable of hybridizing to SEQ ID NO:1 to a nucleotide sequence shown in the specification; or
E) Is capable of hybridizing to SEQ ID NO:16, or a nucleotide sequence shown in the figure.
In a preferred embodiment, the isolated nucleic acid molecule according to the invention reduces the expression of the markers for cardiac hypertrophy, ANP and BNP, the expression of the genes Col1a1 and Col3a1 associated with cardiac fibrosis, and the expression of the genes IL-6 and MCP-1 associated with cardiac inflammation by targeting sequence UCCUGCCCUGUCCCUGUCCCC (SEQ ID NO:16) of the 3' UTR of angiotensin converting enzyme.
In a further preferred embodiment, the isolated nucleic acid molecule according to the invention is an RNA molecule or a DNA molecule, preferably it is a small RNA molecule; preferably, it is a small RNA molecule of 18-24 nucleotides in length, preferably it is a small RNA molecule of 19, 20, 21, 22, 23, or 24 nucleotides in length.
In another aspect, the invention provides a vector comprising a nucleic acid molecule according to the invention.
In another aspect, the invention provides a host cell transfected with a vector of the invention.
In another aspect, the invention provides a pharmaceutical composition comprising a nucleic acid molecule of the invention and a sphingoid lipid and derivatives thereof; preferably, the sphingoid lipid is sphingosine (d18: 1); preferably, the nucleic acid molecule is present in an amount of 0.1-1000. mu.M, preferably 3.0. mu.M-100. mu.M; preferably 0.3. mu.M, 0.6. mu.M, 0.9. mu.M, 1.0. mu.M, 3.0. mu.M, 6.0. mu.M, 9.0. mu.M, 10.0. mu.M, 13.0. mu.M, 16.0. mu.M, 19.0. mu.M, 20.0. mu.M, 23.0. mu.M, 26.0. mu.M, 29.0. mu.M, 30.0. mu.M, 33.0. mu.M, 36.0. mu.M, 39.0. mu.M, 40.0. mu.M, 43.0. mu.M, 46.0. mu.M, 49.0. mu.M, 50.0. mu.M, 53.0. mu.M, 56.0. mu.M, 59.0. mu.M, 60.0. mu.M, 63.0. mu.M, 66.0. mu.M, 69.0. mu.M, 70.0 μ M, 73.0 μ M, 76.0 μ M, 79.0 μ M, 80.0 μ M, 83.0 μ M, 86.0 μ M, 89.0 μ M, 90.0 μ M, 100 μ M, 130 μ M, 160 μ M, 190 μ M, 200 μ M, 250 μ M, 300 μ M, 350 μ M, 400 μ M, 450 μ M, 500 μ M, 550 μ M, 600 μ M, 650 μ M, 700 μ M, 750 μ M, 800 μ M, 850 μ M, 900 μ M, 950 μ M, 1000 μ M, or any range between these; the sphingosine (d18:1) is contained in an amount of 0.01-1000mg/ml, preferably 0.03mg/ml, 0.06mg/ml, 0.09mg/ml, 0.1mg/ml, 0.13mg/ml, 0.16mg/ml, 0.19mg/ml, 0.2mg/ml, 0.23mg/ml, 0.26mg/ml, 0.29mg/ml, 0.3mg/ml, 0.33mg/ml, 0.36mg/ml, 0.39mg/ml, 0.4mg/ml, 0.43mg/ml, 0.46mg/ml, 0.49mg/ml, 0.5mg/ml, 0.53mg/ml, 0.56mg/ml, 0.59mg/ml, 0.6mg/ml, 0.63mg/ml, 0.66mg/ml, 0.69mg/ml, 0.7mg/ml, 0.73mg/ml, 0.79mg/ml, 0.83mg/ml, 0.73mg/ml, 0.83mg/ml, 0.79mg/ml, 0.7mg/ml, 0.73mg/ml, 0.7mg/ml, 0.23mg/ml, 0.86mg/ml, 0.89mg/ml, 0.9mg/ml, 0.93mg/ml, 0.96mg/ml, 0.99mg/ml, 1.0mg/ml, 3.0mg/ml, 6.0mg/ml, 9.0mg/ml, 10.0mg/ml, 13.0mg/ml, 16.0mg/ml, 19.0mg/ml, 20.0mg/ml, 23.0mg/ml, 26.0mg/ml, 29.0mg/ml, 30.0mg/ml, 33.0mg/ml, 36.0mg/ml, 39.0mg/ml, 40.0mg/ml, 43.0mg/ml, 46.0mg/ml, 49.0mg/ml, 50.0mg/ml, 53.0mg/ml, 56.0mg/ml, 59.0mg/ml, 60.0mg/ml, 63.0mg/ml, 66.0mg/ml, 0mg/ml, 0.73mg/ml, 0mg/ml, 0.0mg/ml, 0mg/ml, 0.0mg/ml, 0mg/ml, 0 mg/0 mg/ml, 0mg/ml, 0mg/ml, 79.0mg/ml, 80.0mg/ml, 83.0mg/ml, 86.0mg/ml, 89.0mg/ml, 90.0mg/ml, 100mg/ml, 130mg/ml, 160mg/ml, 190mg/ml, 200mg/ml, 250mg/ml, 300mg/ml, 350mg/ml, 400mg/ml, 450mg/ml, 500mg/ml, 550mg/ml, 600mg/ml, 650mg/ml, 700mg/ml, 750mg/ml, 800mg/ml, 850mg/ml, 900mg/ml, 950mg/ml, 1000mg/ml, or any range therebetween.
Preferably, the pharmaceutical composition according to the invention can be administered by oral, intramuscular, intravenous, subcutaneous, transdermal, intraarterial, intraperitoneal, intrapulmonary, intracerobrospinal, intraarticular, intrasynovial, intrathecal, intraventricular, and/or inhalation routes, preferably, the composition according to the invention is administered orally.
In another aspect, the invention provides the use of an isolated nucleic acid molecule, vector, cell or pharmaceutical composition according to the invention in the manufacture of a medicament for the treatment of a cardiovascular disease. Preferably, the cardiovascular disease is selected from hypertension, myocarditis, myocardial hypertrophy, heart failure, myocardial infarction, cardiomyopathy, and myocardial fibrosis.
Preferably, the isolated nucleic acid molecule, vector, cell or pharmaceutical composition according to the invention can be used in combination with one or more, preferably one to three, further medicaments selected from the group consisting of ACE inhibitors, beta-receptor blockers, diuretics, mineralocorticoid receptor antagonists, renin inhibitors, calcium channel blockers, angiotensin II receptor antagonists, nitrates, digitalis compounds, inotropic and beta-receptor agonists, antihyperlipidemic agents, plasma HDL-raising agents for the treatment of cardiovascular diseases. Wherein the ACE inhibitor includes, but is not limited to, myco (captopril), Enalapril (Enalapril), Lisinopril (Lisinopril), Ramipril (Ramipril), Benazepril (Benazepril), Quinapril (Quinapril), Perindopril (Perindopril), Moexipril (Moexipril), Trandolapril (Trandolapril), Fosinopril (Fosinopril).
In another aspect, the invention provides a method for treating cardiovascular disease in a subject in need thereof, said method comprising administering to said subject a therapeutically effective amount of an isolated nucleic acid molecule, vector, cell or pharmaceutical composition according to the invention.
Term(s) for
The term "nucleic acid" as used herein includes "polynucleotides", "oligonucleotides", and "nucleic acid molecules", and generally means DNA or RNA polymers, which may be single-or double-stranded, synthetic, or obtained (e.g., isolated and/or purified) from a natural source; it may comprise natural, non-natural or altered nucleotides. In some embodiments, the nucleic acid does not comprise any insertions, deletions, inversions, and/or substitutions. However, as discussed herein, in some cases it may be suitable for the nucleic acid to comprise one or more insertions, deletions, inversions, and/or substitutions.
The term "hybridizes under stringent conditions" as used herein means that a nucleotide sequence specifically hybridizes to a target sequence (e.g., the sequence shown in SEQ ID NO: 1) in an amount detectably stronger than non-specific hybridization. Stringent conditions may include, for example, low salt and/or high temperature conditions, such as provided by about 0.02M to 0.1M NaCl or equivalent at a temperature of about 50 ℃ to 70 ℃.
As used herein, "sequence identity" refers to sequence similarity between two polynucleotide sequences. When a position in both compared sequences is occupied by the same base, for example if each position of two DNA molecules is occupied by adenine, then the molecules are identical at that position. The percent identity between two sequences is a function of the number of matching or homologous positions common to both sequences divided by the number of positions compared x 100.
The term "vector" as used herein refers to a recombinant expression vector incorporating a nucleic acid as described herein. The recombinant expression vector may be any suitable recombinant expression vector and may be used to transform or transfect any suitable host cell, including but not limited to plant expression vectors, animal expression vectors, viral vectors, such as retroviral vectors or lentiviral vectors. These vectors are well known to those skilled in the art and are commercially available.
The term "host cell" as used herein refers to any type of cell that can be transfected with a recombinant expression vector of the invention. The host cell may be a eukaryotic cell, such as a plant, animal, fungus or algae, or may be a prokaryotic cell, such as a bacterium or protozoa.
A variety of transfection techniques are known in the art, including, but not limited to, calcium phosphate co-precipitation, direct microinjection into cultured cells, electroporation, liposome-mediated gene transfer, lipid-mediated transduction, and nucleic acid delivery using high-speed microprojectiles.
As used herein, the term "Angiotensin Converting Enzyme (ACE)", also known as kininase ii or peptidyl-carboxypeptidase. Belongs to vascular endothelial cell membrane binding enzyme, which is obtained by cutting amino acid into two sections from the C end of peptide and converting the two sections, and can hydrolyze dipeptide residue at the C end of peptide chain. ACE has two main functions: 1) catalyzing the conversion of angiotensin I to angiotensin II; 2) inactivating bradykinin. The angiotensin converting enzyme is an ideal target for treating diseases such as hypertension, heart failure, type 2 diabetes, diabetic nephropathy and the like due to the two functions.
As used herein, "treating" includes treating a disease state in a mammal (particularly in a human), and includes: (a) inhibiting the disease state, i.e., arresting its development; and/or (b) alleviating, i.e., causing regression of, the disease state.
As used herein, the term "subject" refers to any human or non-human organism that may potentially benefit from treatment with the nucleic acid molecules, vectors, cells, or compositions comprising the same of the present invention. Exemplary subjects include subjects with cardiovascular disease, in particular, hypertension, myocarditis, myocardial hypertrophy, heart failure, myocardial infarction, cardiomyopathy.
As used herein, the term "therapeutically effective amount" is intended to include the amount of a nucleic acid molecule, vector, cell or composition comprising the same of the present invention that, when administered alone or in combination, benefits a subject.
As used herein, the phrase "complementary binding" or "complementarily binds" refers to two single strands base pairing with each other to form a detectable double strand. However, as long as a stable double strand can be formed, a certain percentage of mismatch between the two single strands is allowed. For example, in some embodiments, the duplex has a mismatch of about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50%.
In order to describe the present invention in more detail, the present specification provides the following embodiments, which are described in connection with the accompanying drawings, but the disclosed embodiments are not limited thereto. The method, use and small RNA of the present invention can be appropriately modified by those skilled in the art in combination with the common general knowledge in the art, so long as they can achieve the functions of the present invention, and they fall within the scope of the present invention.
Drawings
FIG. 1: the mouse is buried in a pump under the skin, and the slow-release angiotensin II is perfused for 14 days to establish a hypertension mouse model. The tail sleeve method is used for measuring the result of the systolic blood pressure of mice in the gavage XKC-sRNA-3 treatment group relative to the blood pressure of the NC-sRNA group.
Fig. 2A-2D: after 14 days of angiotensin II infusion, the results of the heart structure of mice in the gavage XKC-sRNA-3 treatment group relative to the NC-sRNA group were evaluated by a small animal ultrasound imaging system.
Fig. 3A-3F: after 14 days of angiotensin II infusion, the mouse cardiac hypertrophy, fibrosis and inflammation gene expression results were examined.
Fig. 4A-4B: mouse cardiomyocyte area was observed by Wheat Germ Agglutinin (WGA) staining.
Fig. 5A-5B: sirius Red (PSR) staining was used to observe collagen fiber deposition in the mouse heart.
Fig. 6A-6B: the dual-luciferase reporter gene detection system detects the target of XKC-sRNA-3.
Detailed Description
Example 1 preparation of Sphingoninol (d18:1) -XKC-sRNA-3 of Oryza sativa
Adding 300 mu L of nuclease-free water to 30nmol of small RNA XKC-sRNA-3 dry powder for dissolving, then adding 10 mu L of lipid solution of Sphingosine (Sphingosine) (d18:1), fully shaking and uniformly mixing, carrying out water bath at 90 ℃ for 15min, and cooling to room temperature to prepare a mixed solution containing the small RNA XKC-sRNA-3 and the Sphingosine (d18: 1).
Wherein the XKC-sRNA-3 is derived from Chinese medicine summer withered, and the sequence of the XKC-sRNA-3 is shown in SEQ ID NO:1 (GGGAUAAGGAUUGGCUCU).
In a similar manner, a negative control mixture was prepared in which the small RNA XKC-sRNA-3 was replaced with a nonsense control sequence (NC) for small RNA, and the rest of the procedure was as above.
Example 2 protective Effect of XKC-sRNA-3 on angiotensin II-induced hypertension
80 male C57BL/6J mice (supplied by Beijing Wittingle Bio Inc.) aged 8 weeks and weighing about 25g were randomly assigned to the following 10 groups:
the sham operation group: perfusing saline at 800ng/kg min for 14 days;
angiotensin II group: perfusing angiotensin II at a rate of 800ng/kg min for 14 days;
angiotensin II + NC-sRNA group: gavage mice at a dose of 10 nmol/mouse from day 2 to day 21 of angiotensin II infusion, negative control being a mixture containing sphingosine (d18:1) and NC (nonsense control sequence of small RNA);
angiotensin II + XKC-sRNA-3 group: mice were gavaged with a cocktail containing small RNA XKC-sRNA-3 and sphingosine (d18:1) prepared as described above at doses of 3 nmol/mouse, 10 nmol/mouse, 30 nmol/mouse from day 2 to day 14 of angiotensin II infusion.
Angiotensin II + captopril group: mice were gavaged at doses of 30 nmol/mouse and 2300 nmol/mouse from day 2 to day 14 of angiotensin II infusion.
Blood pressure was measured every other day from 2 days before the infusion of angiotensin II to 14 days after the end of the infusion, and was measured using a Kent non-invasive sphygmomanometer. Placing the mouse on a heating plate at 37 ℃ for 5 minutes, sleeving the tail of the mouse into the oversleeve after the tail artery of the mouse is fully expanded, inflating the animal after the animal is quiet, and loading a detection probe on the root of the tail of the mouse to measure the systolic pressure. Each mouse was measured 10 times and the average was recorded.
Results as shown in fig. 1, gavage XKC-sRNA-3 significantly reduced blood pressure levels in mice compared to NC-sRNA, and the dose was 30 nmol/time best at all, indicating statistical analysis with unpaired t test P <0.01, and statistical analysis with unpaired t test P <0.001, considered statistically significant. Indicating that XKC-sRNA-3 has a pressure-reducing effect at the animal level and shows a dose effect.
Example 3 protective Effect of XKC-sRNA-3 on angiotensin II-induced cardiac injury
1. Mouse heart ultrasonic detection
1) And starting the small animal Doppler ultrasonic detection instrument. After the chest of the mouse is completely depilated, the mouse is anesthetized by 3% isoflurane and air mixed gas, and the mouse state is maintained by 1.5% isoflurane and air mixed gas (the heart rate of the mouse is maintained at about 450 BPM);
2) the ultrasonic probe is placed at the level of a mitral valve cord, the left ventricle is probed by M-type parathoracic long axis scanning (the probe frequency is 30MHz), the left ventricle anterior wall thickness (LVAW, d) at the end diastole, the left ventricle anterior wall thickness (LVAW, s) at the end systole, the left ventricle posterior wall thickness (LVPW, d) at the end diastole and the left ventricle posterior wall thickness (LVPW, s) at the end systole are measured, at least 3 cardiac cycles are continuously recorded, and the average value of 3 measurements is taken for recording.
As a result:
after 14 days of angiotensin II perfusion, the thickness of the left ventricular anterior wall in the diastolic phase of the mouse is evaluated by using a mouse ultrasonic imaging system, and as can be seen from fig. 2A, compared with the NC-sRNA group, gavage XKC-sRNA-3(30 nmol/mouse) remarkably reduces the thickness of the left ventricular anterior wall in the diastolic phase of the mouse, and the effect is superior to that of captopril with the same dose, which indicates that XKC-sRNA-3 can reverse the thickening of the left ventricular anterior wall in the diastolic phase caused by angiotensin II perfusion.
The animal ultrasonic imaging system evaluates the left ventricular posterior wall thickness of the mouse in the systolic phase, and as can be seen from fig. 2B, compared with the NC-sRNA group, intragastric XKC-sRNA-3(30 nmol/mouse) significantly reduces the left ventricular posterior wall thickness of the mouse in the systolic phase, and the effect is superior to that of captopril with the same dose, which indicates that the XKC-sRNA-3 has the function of reversing the left ventricular posterior wall thickening in the systolic phase caused by angiotensin II perfusion.
The thickness of the anterior wall of the left ventricle of the mouse in the systolic phase is evaluated by an animal ultrasonic imaging system, and as can be seen from fig. 2C, compared with the NC-sRNA group, the gavage XKC-sRNA-3(30 nmol/single) remarkably reduces the thickness of the anterior wall of the left ventricle of the mouse in the systolic phase, and the effect is superior to that of captopril with the same dose and effective dose (2300 nmol/single), which indicates that the XKC-sRNA-3 can reverse the thickening of the anterior wall of the left ventricle of the systolic phase caused by angiotensin II perfusion.
The animal ultrasonic imaging system evaluates the thickness of the left ventricular posterior wall of the mouse in diastole, and as can be seen from fig. 2D, compared with the NC-sRNA group, gavage XKC-sRNA-3(30 nmol/single) remarkably reduces the thickness of the left ventricular posterior wall of the mouse in diastole, and the effect is better than captopril with the same dose and effective dose (2300 nmol/single), which indicates that the XKC-sRNA-3 can reverse the left ventricular posterior wall thickening of the diastole caused by angiotensin II perfusion.
2. Detection of mouse cardiac myocardial hypertrophy, fibrosis and inflammation genes
1) On day 14 after surgery, the mice were sacrificed and the heart tissue was frozen in a freezer at-80 ℃;
2) taking out the frozen tissue sample, adding 1mL TRIzol into about 50mg of tissue, and fully cracking the tissue for 2min by a homogenizer;
3) total RNA extraction: 1mL of the tissue lysate was added with 200. mu.L of chloroform, mixed well, and then left at room temperature for 10min, and centrifuged at 12000rpm for 15min at 4 ℃. Sucking the upper aqueous phase into another centrifuge tube (note: neither sucking the middle interface nor touching the middle layer); adding isopropanol according to 0.6 time of the volume of the aqueous phase, reversing and mixing uniformly, standing at room temperature for 15min, centrifuging at 12000rpm for 15min at 4 ℃, and removing supernatant, wherein white RNA precipitates can be seen to sink at the bottom of the tube. 1mL of 750mL/L ethanol was added, the tube was gently shaken, and the suspension-precipitated, centrifuged at 12000rpm for 10min at 4 ℃. The supernatant was discarded, the residual liquid on the wall of the centrifuge tube was blotted, the tube cap was opened, and the tube was dried at room temperature. Based on the amount of RNA precipitated, H treated with 25-100. mu.L of DEPC2O lysis of the RNA sample. The concentration and purity of RNA are determined by using NanoDrop 2000;
4) reverse transcription of RNA into cDNA: adding DEPC-treated H to the extracted RNA sample based on the concentration of RNA determined by NanoDrop20002O, adjusting the concentration to 150 ng/. mu.L, and carrying out reverse transcription on the RNA into cDNA by the following reverse transcription system: template RNA (150 ng/. mu.L) 10. mu.L, 10 XT buffer 2.0. mu.L, 25 dNTP mix (100mM) 0.8. mu.L, 10 XDrandomer 2.0. mu.L, reverse transcriptase 1.0. mu.L, RNase inhibitor 1. mu.L, nucleic-free H2O1.2 mu L, placing the mixture into a PCR instrument for reaction after instantaneous centrifugation, wherein the reaction conditions are as follows: (1) at 25 ℃ for 10 min; (2) at 37 ℃ for 120 min; (3) 5min at 85 ℃; (4) terminating the reaction at 4 ℃;
5) quantitative PCR amplification reaction: the total volume of the qPCR reaction system is 10 mu L, and the qPCR reaction system comprises: mu.L of 2 XSSYBR Green Master Mix, 0.5. mu.L of forward primer (10. mu.M), 0.5. mu.L of reverse primer (10. mu.M), 1. mu.L of cDNA obtained by reverse transcription, 3. mu.L of RNase-free dH2And O. Using LightCycler 480 fluorescent quantitative PCR instrument, the PCR reaction conditions were: pre-denaturation at 95 ℃ for 5min, entering PCR amplification cycle: (1)95 ℃ for 10 s; (2)55 ℃ for 10 s; (3) at 72 deg.C for 20s for 40 cycles, and finally at 40 deg.C for 10 s. The forward primer and the reverse primer of the amplification reaction are both synthesized by Beijing Optimalaceae biotechnology, Inc. The primer sequences used were as follows:
Figure BDA0003270230840000101
Figure BDA0003270230840000111
finally, the relative expression amount is calculated by using a 2-delta Ct method.
3. Mouse heart paraffin section WGA staining
1) Fixing and dehydrating: the heart of the mouse is taken and placed on a 4% paraformaldehyde room temperature shaking table for fixation for 24 hours, the heart is placed in an embedding frame according to the number, and the heart is washed by running water and embedded by wax. Paraffin dewaxing and slicing: according to the proportion of 30% ethanol (10min) → 50% ethanol (10min) → 75% ethanol (10min) → 85% ethanol (10min) → 95% ethanol (10min) → absolute ethanol (10min), ddH2Soaking the tissue in isobutanol at 4 ℃ overnight after O cleaning;
2) embedding, slicing and baking: soaking the tissue in paraffin liquid at 58 deg.C for 1 hr the next day, and embedding the heart tissue in paraffin embedding machine; placing the paraffin tissue block in a slicer slot, setting the slice thickness to be 5 mu m, starting slicing, adhering and flattening the unfolded slices without wrinkles by using a glass slide, and placing the slices on a baking sheet machine for baking for 1h at 60 ℃;
3) dewaxing: xylene I (20min) → xylene ii (20min) → absolute ethanolic I (10min) → absolute ethanolic ii (10min) → 95% ethanol (5min) → 90% ethanol (5min) → 80% ethanol (5min) → 70% ethanol (5min), ddH → ethanol (5min) → 70% ethanol (5min), and2o cleaning;
4) antigen retrieval: then placing the glass slide in a pressure cooker with 0.01M sodium citrate buffer (pH 6.0), slowly pressurizing, soaking the glass slide in the buffer for five minutes without covering the lid of the pot, and then locking the lid; removing the heat source 10 minutes after the valve is lifted, putting the valve into cold water, and opening the cover after the valve is sunk;
5) dyeing: drawing circles around the tissue by using a histochemical pen, dripping 50 mu of LWGA-AF488W working solution into each circle, and incubating for 15min at room temperature; rinsing (5min)3 times with PBS;
6) sealing: sealing with neutral gum, and sealing at room temperature for over 24 hr;
7) photographing and counting: a fluorescence channel is excited at 488nm by using a confocal microscope, after the fluorescence channel is adjusted to be a (40X) ocular visual field, the cross section of the myocardial cell is selected for photographing, 5 different visual fields are randomly selected for each pathological section, 20 cells are randomly selected for each visual field, and the average cell area size is counted by using Image Pro 10.
4. Mouse heart paraffin section PSR staining
1) Fixing and dehydrating: the heart of the mouse is taken and placed on a 4% paraformaldehyde room temperature shaking table for fixation for 24 hours, the heart is placed in an embedding frame according to the number, and the heart is washed by running water and embedded by wax. Paraffin dewaxing and slicing: according to the proportion of 30% ethanol (10min) → 50% ethanol (10min) → 75% ethanol (10min) → 85% ethanol (10min) → 95% ethanol (10min) → absolute ethanol (10min), ddH2Soaking the tissue in isobutanol at 4 ℃ overnight after O cleaning;
2) embedding, slicing and baking: soaking the tissue in paraffin liquid at 58 deg.C for 1 hr the next day, and embedding the heart tissue in paraffin embedding machine; placing the paraffin tissue block in a slicer slot, setting the slice thickness to be 5 mu m, starting slicing, adhering and flattening the unfolded slices without wrinkles by using a glass slide, and placing the slices on a baking sheet machine for baking for 1h at 60 ℃;
3) dewaxing: xylene I (20min) → xylene ii (20min) → absolute ethanolic I (10min) → absolute ethanolic ii (10min) → 95% ethanol (5min) → 90% ethanol (5min) → 80% ethanol (5min) → 70% ethanol (5min), ddH → ethanol (5min) → 70% ethanol (5min), and2o cleaning;
4) staining with hematoxylin staining solution for 15min, and differentiating with acidic differentiation solution for 30-60 s; washing with tap water once and washing with distilled water three times;
5) dyeing the sirius red dyeing liquid drop for 1h, and slightly washing with running water to remove the dyeing liquid on the surface of the slice;
6) dehydrating and sealing: putting the slices into 95% ethanol I (5min) → 95% ethanol II (5min) → absolute ethanol I (5min) → absolute ethanol II (5min) → xylene I (5min) → xylene II (5min), taking out the slices from xylene after dehydration, airing, sealing the slices with neutral gum, airing for 24h, observing by a microscope, and carrying out image acquisition and analysis.
As a result:
the results of expression of mouse cardiac hypertrophy markers ANP and BNP after 14 days of angiotensin II infusion are shown in fig. 3A-3B, where gavage XKC-sRNA-3(30 nmol/BNP) significantly reduced the expression of mouse cardiac hypertrophy markers ANP and BNP compared to the NC-sRNA group, and the effect was superior to captopril at the same dose and at an effective dose (2300 nmol/BNP), indicating that the statistical analysis result P was <0.001, unpaired t test. The XKC-sRNA-3 can obviously reduce the expression of myocardial hypertrophy marker genes ANP and BNP.
The expression results of mouse heart fibrosis related genes Col1a1 and Col3a1 after 14 days of angiotensin II infusion are shown in fig. 3C-fig. 3D, in which gavage XKC-sRNA-3(30 nmol/min) significantly reduced the expression of mouse heart fibrosis gene Col1a1 compared to the NC-sRNA group, and the effect was superior to captopril at the same dose and at the effective dose (2300 nmol/min), indicating that the statistical analysis result P was <0.05, indicating that the statistical analysis result P is <0.01, and the unpaired t test. The XKC-sRNA-3 can obviously reduce the expression of myocardial fibrosis genes Col1a1 and Col3a 1.
The results of expression of mouse cardiac inflammation-related genes IL-6 and MCP-1 after 14 days of angiotensin II infusion are shown in fig. 3E-fig. 3F, where gavage XKC-sRNA-3(30 nmol/min) significantly reduced the expression of mouse cardiac myocardial inflammation-related genes IL-6 and MCP-1 compared to the NC-sRNA group, and the effect was superior to captopril at the same dose and at an effective dose (2300 nmol/min), indicating a statistical analysis result P <0.05, indicating a statistical analysis result P <0.01, unpaired t-test. The XKC-sRNA-3 can obviously reduce the expression of myocardial inflammation related genes IL-6 and MCP-1.
After 14 days of angiotensin II infusion, mice cardiomyocyte area was observed by WGA staining as shown in fig. 4A and 4B, where gavage XKC-sRNA-3(30 nmol/mouse) significantly reduced mouse cardiomyocyte cross-sectional area compared to the NC-sRNA group and the effect was superior to the same dose of captopril, indicating a statistical analysis result P <0.01, unpaired t-test. The result shows that in the pathological level of mice, XKC-sRNA-3 can effectively improve the increase of the myocardial cell area caused by angiotensin II perfusion, and has an improvement effect on myocardial hypertrophy caused by angiotensin II perfusion.
14 days after angiotensin II infusion, mice were observed for cardiac collagen fiber deposition by PSR staining, as shown in FIGS. 5A and 5B, in which XKC-sRNA-3(30 nmol/mouse) significantly reduced the area of mouse myocardial fibrosis compared to the NC-sRNA group, and the effect was superior to that of the same dose of captopril, representing a statistical analysis result P <0.01, unpaired t-test. The result shows that in the pathological level of mice, XKC-sRNA-3 can effectively reduce the deposition of cardiac collagen fibers caused by angiotensin II perfusion and has the function of improving myocardial fibrosis.
Example 4 Dual-luciferase reporter Gene detection System validation of target of XKC-sRNA-3
Sample preparation
1) 1d before transfection, HEK293T cells in logarithmic growth phase were trypsinized and diluted to 1X 10 in DMEM medium5The density of each cell/mL, the cells are evenly mixed and then are distributed into 48-hole plates, each hole is 0.3mL, and the cells are placed into a cell culture box at 37 ℃ for culture;
2) after cells adhere to the wall for at least 12 hours, transfecting XKC-sRNA-3 by RNAi MAX, transfecting NC by a control group, wherein the final concentration is 100 nmol/L;
3) after transfection of XKC-sRNA-324 h, psiCHECK was transfected with Lipofectamine TM 2000TM2 vector, respectively transfecting 3 'UTR wild type plasmid and 3' UTR mutant type plasmid, namely, after XKC-sRNA-324 h transfection, respectively transfecting wild type plasmid with ACE gene 3 'UTR and mutant type plasmid with ACE gene 3' UTR seed region mutation by using Lipofectamine 2000. mu.L of Lipofectamine TM 2000 and 300ng of psiCHECK were added to each wellTM-2 a carrier;
4) after 48h of transfection, the dual luciferase activity was detected, the specific steps are as follows.
Dual luciferase Activity assay
The operation steps are described by referring to a double-luciferase reporter gene detection kit of Promega (Beijing) Biotechnology Limited
1) Taking out all reagents from-20 ℃, dissolving at 4 ℃, and balancing to room temperature;
2) prepare 1 XPLB solution (passive lysis buffer) according to the experimental amount, dilute 5 XPLB to 1 XPLB with deionized water. The medium in 48-well plates was carefully discarded, and 100. mu.L of 1 × passive lysis buffer was added to each well. The cells were lysed on a shaker at room temperature for 15-25min to fully lyse the cells. Sucking the cell lysate into an EP tube by using a pipettor, and centrifuging for 5min at room temperature of 8000 rpm;
3) taking a white and opaque special 96-well plate, and sequentially adding 10 mu L of cell lysis supernatant into each well;
4) preparing luciferase detection reagents II and Stop according to the requirements of experimental dosage&
Figure BDA0003270230840000141
A reagent;
5) measuring the activity of the dual-luciferase by using a Promega dual-luciferase gene reporter system instrument;
6) and after the detection of the instrument is finished, recording respective numerical values of the dual-luciferase, and shutting down the cleaning instrument.
As a result:
the results of detecting the target gene of XKC-sRNA-3 small RNA by using a dual-luciferase reporter gene detection system are shown in FIGS. 6A and 6B, and XKC-sRNA-3 targets the sequence UCCUGCCCUGUCCCUGUCCCC (SEQ ID NO:16) of the 3' UTR of ACE gene (NCBI of ACE gene is numbered as NM-000789.4), which indicates that XKC-sRNA-3 plays a role in reducing blood pressure by targeting the region and becomes a potential drug for treating human hypertension and organ injury.
Sequence listing
<110> institute of basic medicine of Chinese academy of medical sciences
<120> a small RNA and its use in the treatment of cardiovascular diseases
<130> 300278CG
<160> 16
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> RNA
<213> Herbs
<400> 1
gggauaagga uuggcucu 18
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> primer_bind
<222> (1)..(20)
<223> Mus-ANP-For
<400> 2
gtacagtgcg gtgtccaaca 20
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> primer_bind
<222> (1)..(21)
<223> Mus-ANP-Rev
<400> 3
tctcctccag gtggtctagc a 21
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> primer_bind
<222> (1)..(21)
<223> Mus-BNP-For
<400> 4
gaggtcactc ctatcctctg g 21
<210> 5
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> primer_bind
<222> (1)..(22)
<223> Mus-BNP-Rev
<400> 5
gccatttcct ccgacttttc tc 22
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> primer_bind
<222> (1)..(20)
<223> Mus-Col1a1-For
<400> 6
gagcggagag tactggatcg 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> primer_bind
<222> (1)..(20)
<223> Mus-Col1a1-Rev
<400> 7
tactcgaacg ggaatccatc 20
<210> 8
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> primer_bind
<222> (1)..(24)
<223> Mus-Col3a1-For
<400> 8
acagcaaatt cacttacaca gttc 24
<210> 9
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> primer_bind
<222> (1)..(19)
<223> Mus-Col3a1-Rev
<400> 9
ctcattgcct tgcgtgttt 19
<210> 10
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> primer_bind
<222> (1)..(21)
<223> Mus-IL-6-For
<400> 10
ctgcaagaga cttccatcca g 21
<210> 11
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> primer_bind
<222> (1)..(23)
<223> Mus-IL-6-Rev
<400> 11
agtggtatag acaggttggt ctg 23
<210> 12
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> primer_bind
<222> (1)..(25)
<223> Mus-MCP-1-For
<400> 12
cccaaagaag ctgtagtttt tgtca 25
<210> 13
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> primer_bind
<222> (1)..(20)
<223> Mus-MCP-1-Rev
<400> 13
acccattcct tcttggggtc 20
<210> 14
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> primer_bind
<222> (1)..(22)
<223> Mus-GAPDH-For
<400> 14
acaactttgg tatcgtggaa gg 22
<210> 15
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> primer_bind
<222> (1)..(19)
<223> Mus-GAPDH-Rev
<400> 15
gccatcacgc cacagtttc 19
<210> 16
<211> 21
<212> RNA
<213> Intelligent (Homo sapiens)
<400> 16
uccugcccug ucccuguccc c 21

Claims (10)

1. An isolated nucleic acid molecule comprising or consisting of the sequence:
A) SEQ ID NO: 1;
B) and SEQ ID NO:1, having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% sequence identity;
C) and SEQ ID NO:1 to at least 10, preferably at least 9, at least 8, at least 7, at least 6, at least 5, at least 4, at least 3, at least 2, at least 1 nucleotide substitutions, deletions or additions,
D) is capable of hybridizing to SEQ ID NO:1, or
E) Is capable of hybridizing to SEQ ID NO:16, or a nucleotide sequence shown in the figure.
2. The isolated nucleic acid molecule of claim 1, which reduces the expression of cardiac hypertrophy markers ANP and BNP, reduces the expression of cardiac fibrosis related genes Col1a1 and Col3a1, and reduces the expression of cardiac inflammation related genes IL-6 and MCP-1 by targeting the 3' UTR of angiotensin converting enzyme.
3. The isolated nucleic acid molecule according to any one of claims 1 or 2, which is an RNA molecule or a DNA molecule, preferably which is a small RNA molecule of 18-24 nucleotides in length, preferably which is a small RNA molecule of 19, 20, 21, 22, 23, or 24 nucleotides in length.
4. A vector comprising the nucleic acid molecule of any one of claims 1-3.
5. A host cell transfected with the vector of claim 4.
6. A pharmaceutical composition comprising the nucleic acid molecule of any one of claims 1-3, and a sphingoid lipid and derivatives thereof; preferably, the sphingoid lipid is sphingosine (d18: 1); preferably, the nucleic acid molecule is present in an amount of 0.1-1000. mu.M, preferably 3.0. mu.M-100. mu.M; the sphingosine (d18:1) content is 0.01-1000mg/ml, preferably 0.3-100 mg/ml.
7. The pharmaceutical composition according to claim 6, further comprising one or more pharmaceutically acceptable adjuvants, excipients and/or stabilizers, preferably for oral, intramuscular, intravenous, subcutaneous, transdermal, intra-arterial, intraperitoneal, intrapulmonary, intracerobrospinal, intraarticular, intrasynovial, intrathecal, intraventricular, and/or inhalation route administration.
8. Use of the nucleic acid molecule of any one of claims 1-3, the vector of claim 4, the host cell of claim 5, or the pharmaceutical composition of claim 6 or 7 in the manufacture of a medicament for treating a cardiovascular disease.
9. Use according to claim 8, wherein the cardiovascular disease is selected from hypertension, myocarditis, myocardial hypertrophy, heart failure, myocardial infarction, cardiomyopathy, myocardial fibrosis.
10. The use according to claim 8 or 9, wherein the medicament further comprises one or more other medicaments selected from ACE inhibitors, beta-receptor blockers, diuretics, mineralocorticoid receptor antagonists, renin inhibitors, calcium channel blockers, angiotensin II receptor antagonists, nitrates, digitalis compounds, inotropic and beta-receptor agonists, antihyperlipidemic agents and plasma HDL-raising agents.
CN202111110039.5A 2021-09-18 Small RNA and application thereof in treatment of cardiovascular diseases Active CN113846098B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111110039.5A CN113846098B (en) 2021-09-18 Small RNA and application thereof in treatment of cardiovascular diseases

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111110039.5A CN113846098B (en) 2021-09-18 Small RNA and application thereof in treatment of cardiovascular diseases

Publications (2)

Publication Number Publication Date
CN113846098A true CN113846098A (en) 2021-12-28
CN113846098B CN113846098B (en) 2024-06-25

Family

ID=

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023143480A1 (en) * 2022-01-28 2023-08-03 中国医学科学院基础医学研究所 Small rna drug for inhibiting activity of cancer cells

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2228444A1 (en) * 2009-03-09 2010-09-15 Julius-Maximilians-Universität Würzburg microRNA for diagnostic and therapeutic purposes in cardiovascular diseases
CN102886050A (en) * 2012-07-16 2013-01-23 中国科学院动物研究所 Application of miRNA-489 and medicinal composition
CN102921021A (en) * 2012-11-26 2013-02-13 中国科学院动物研究所 MiRNA-361 (micro-ribonucleic acid-361) and application of antisense nucleotide thereof
DE102012101557A1 (en) * 2012-02-27 2013-08-29 Charité Universitätsmedizin Berlin Use of microRNAs or genes as markers for the identification, diagnosis and therapy of individual non-ischemic cardiomyopathies or memory diseases of the heart
WO2013188787A1 (en) * 2012-06-15 2013-12-19 The General Hospital Corporation INHIBITORS OF MICRORNAs THAT REGULATE PRODUCTION OF ATRIAL NATRIURETIC PEPTIDE (ANP) AS THERAPEUTICS AND USES THEREOF
US20160145615A1 (en) * 2013-06-17 2016-05-26 Ucl Business Plc Agonists of ddah1 for treating endothelial dysfunction
CN109810981A (en) * 2019-02-19 2019-05-28 上海交通大学医学院附属第九人民医院 Polynucleotide and its application in cardiovascular disease diagnosis and treatment
CN110546261A (en) * 2017-03-29 2019-12-06 中国医学科学院基础医学研究所 Small RNAs and their use for prevention and/or treatment of fibroproliferative disorders and/or syndromes
CN111826431A (en) * 2019-04-16 2020-10-27 中国人民解放军军事科学院军事医学研究院 Biomarkers and targets for diagnosis and treatment of cardiovascular diseases and application thereof
CN111971072A (en) * 2018-03-29 2020-11-20 中国医学科学院基础医学研究所 Extraction of plant source decoction, artificial preparation of natural plant and its related products

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2228444A1 (en) * 2009-03-09 2010-09-15 Julius-Maximilians-Universität Würzburg microRNA for diagnostic and therapeutic purposes in cardiovascular diseases
DE102012101557A1 (en) * 2012-02-27 2013-08-29 Charité Universitätsmedizin Berlin Use of microRNAs or genes as markers for the identification, diagnosis and therapy of individual non-ischemic cardiomyopathies or memory diseases of the heart
WO2013188787A1 (en) * 2012-06-15 2013-12-19 The General Hospital Corporation INHIBITORS OF MICRORNAs THAT REGULATE PRODUCTION OF ATRIAL NATRIURETIC PEPTIDE (ANP) AS THERAPEUTICS AND USES THEREOF
CN102886050A (en) * 2012-07-16 2013-01-23 中国科学院动物研究所 Application of miRNA-489 and medicinal composition
CN102921021A (en) * 2012-11-26 2013-02-13 中国科学院动物研究所 MiRNA-361 (micro-ribonucleic acid-361) and application of antisense nucleotide thereof
US20160145615A1 (en) * 2013-06-17 2016-05-26 Ucl Business Plc Agonists of ddah1 for treating endothelial dysfunction
CN110546261A (en) * 2017-03-29 2019-12-06 中国医学科学院基础医学研究所 Small RNAs and their use for prevention and/or treatment of fibroproliferative disorders and/or syndromes
CN111971072A (en) * 2018-03-29 2020-11-20 中国医学科学院基础医学研究所 Extraction of plant source decoction, artificial preparation of natural plant and its related products
CN109810981A (en) * 2019-02-19 2019-05-28 上海交通大学医学院附属第九人民医院 Polynucleotide and its application in cardiovascular disease diagnosis and treatment
CN111826431A (en) * 2019-04-16 2020-10-27 中国人民解放军军事科学院军事医学研究院 Biomarkers and targets for diagnosis and treatment of cardiovascular diseases and application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
LIN HE等: "Profiling microRNAs in the testis during sexual maturationstages in Eriocheir sinensis", ANIMAL REPRODUCTION SCIENCE, vol. 162, pages 56 *
张文等: "心肌损伤标志物在小儿病毒性心肌炎诊断中的应用进展", 临床和实验医学杂志, vol. 8, no. 11, pages 119 - 120 *
贾禹;曾智;: "MicroRNA与心血管疾病的研究进展", 心血管病学进展, no. 05, pages 724 - 728 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023143480A1 (en) * 2022-01-28 2023-08-03 中国医学科学院基础医学研究所 Small rna drug for inhibiting activity of cancer cells

Similar Documents

Publication Publication Date Title
CN104072584B (en) Peptides for promoting angiogenesis and a use thereof
CN111918858B (en) Application of compound or traditional Chinese medicine extract in preparation of nucleic acid delivery reagent and related product thereof
EP1512415A1 (en) Decoy composition for treating and preventing inflammatory disease
CN112251421B (en) EZH2 variable shear body and application thereof
WO2024045251A1 (en) Small interfering rna for treating neovascular retinal diseases and dna tetrahedral complex thereof
Che et al. Effect of miR-124 on neuronal apoptosis in rats with cerebral infarction through Wnt/β-catenin signaling pathway.
CN106222173B (en) Effect of circRNA MNCR in regulating myocardial cell necrosis and myocardial ischemia injury
CN111184856A (en) Application of small molecular polypeptide TP-7 in preparation of medicine for treating chronic kidney disease
CN107385033B (en) PiRNA-5938 and application of antisense nucleic acid thereof in diagnosis and treatment of ischemic heart diseases
CN101310779A (en) Device and medicinal preparation containing neuroregulation protein
Ouyang et al. MicroRNA-183-3p up-regulated by vagus nerve stimulation mitigates chronic systolic heart failure via the reduction of BNIP3L-mediated autophagy
CN113846098B (en) Small RNA and application thereof in treatment of cardiovascular diseases
CN113846098A (en) Small RNA and application thereof in treatment of cardiovascular diseases
WO2016070798A1 (en) Drug for inhibiting adipose cell differentiation and insulin resistance
CN114432332B (en) Application of circUTRN in preparation of heart failure treatment medicine, recombinant vector and heart failure treatment medicine
KR20220150857A (en) Vascular leakage blocking effect of primaquine diphosphate and its targets usp1
CN111705061B (en) Antisense nucleotide of piRNA-P1 and piRNA-P1 related to heart disease, application and medicament
Zou et al. Vascular Endothelial Growth Factor Receptor 1 Facilitates the Effect of Macrophages on Human Umbilical Vein Endothelial Cells Migration by Regulating the M1 Polarization
CN115137740B (en) Application of miRNA-497b or miRNA-5106 in preparation of medicines for treating ischemic myocardium
CN112877431B (en) Use of snoRNA-U41 in detection and treatment of pancreatic cancer
CN103463620A (en) Application of anti-inflammatory protein TIPE2 in preparation of medicines used for treating atherosclerosis
CN109706241A (en) A kind of drug and its screening, preparation method for treating dilated cardiomyopathy
US20240091306A1 (en) Peptides endowed with angiogenic activity
CN115137728B (en) Application of alcohol compound 1 in preparation of medicine for treating pulmonary hypertension
Zhou et al. Ang (1-7) improves cardiac function after resuscitation from cardiac arrest

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant