CN113817821A - Colorectal tumorous lesion blood tRF marker and application thereof - Google Patents
Colorectal tumorous lesion blood tRF marker and application thereof Download PDFInfo
- Publication number
- CN113817821A CN113817821A CN202010557526.5A CN202010557526A CN113817821A CN 113817821 A CN113817821 A CN 113817821A CN 202010557526 A CN202010557526 A CN 202010557526A CN 113817821 A CN113817821 A CN 113817821A
- Authority
- CN
- China
- Prior art keywords
- trf
- colorectal
- blood
- gta
- agc
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 230000003902 lesion Effects 0.000 title claims abstract description 71
- 210000004369 blood Anatomy 0.000 title claims abstract description 48
- 239000008280 blood Substances 0.000 title claims abstract description 48
- 239000003550 marker Substances 0.000 title claims abstract description 16
- 208000001333 Colorectal Neoplasms Diseases 0.000 claims abstract description 71
- 238000001514 detection method Methods 0.000 claims abstract description 28
- 239000003153 chemical reaction reagent Substances 0.000 claims abstract description 25
- 238000010839 reverse transcription Methods 0.000 claims abstract description 22
- 230000004544 DNA amplification Effects 0.000 claims abstract description 15
- 238000002474 experimental method Methods 0.000 claims abstract description 8
- 208000003200 Adenoma Diseases 0.000 claims description 56
- 206010009944 Colon cancer Diseases 0.000 claims description 53
- 230000001613 neoplastic effect Effects 0.000 claims description 40
- 108091032973 (ribonucleotides)n+m Proteins 0.000 claims description 37
- 206010001233 Adenoma benign Diseases 0.000 claims description 28
- 238000000034 method Methods 0.000 claims description 9
- 108090000623 proteins and genes Proteins 0.000 claims description 8
- 238000009007 Diagnostic Kit Methods 0.000 claims description 7
- 238000011529 RT qPCR Methods 0.000 claims description 7
- 108091029842 small nuclear ribonucleic acid Proteins 0.000 claims description 7
- 238000011002 quantification Methods 0.000 claims description 5
- 239000002299 complementary DNA Substances 0.000 claims description 4
- 239000002773 nucleotide Substances 0.000 claims description 4
- 125000003729 nucleotide group Chemical group 0.000 claims description 4
- 230000001225 therapeutic effect Effects 0.000 claims description 4
- 108091028043 Nucleic acid sequence Proteins 0.000 claims description 3
- 238000005516 engineering process Methods 0.000 claims description 3
- 238000002123 RNA extraction Methods 0.000 claims 1
- 239000013614 RNA sample Substances 0.000 claims 1
- 239000012295 chemical reaction liquid Substances 0.000 claims 1
- 201000010989 colorectal carcinoma Diseases 0.000 claims 1
- 238000002203 pretreatment Methods 0.000 claims 1
- 238000012545 processing Methods 0.000 claims 1
- 239000000523 sample Substances 0.000 claims 1
- 238000003745 diagnosis Methods 0.000 abstract description 22
- 238000012216 screening Methods 0.000 abstract description 12
- 206010028980 Neoplasm Diseases 0.000 abstract description 7
- 201000010099 disease Diseases 0.000 abstract description 7
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 abstract description 7
- 230000009286 beneficial effect Effects 0.000 abstract description 2
- 238000010353 genetic engineering Methods 0.000 abstract description 2
- 230000002265 prevention Effects 0.000 abstract description 2
- 239000003814 drug Substances 0.000 abstract 1
- 230000035945 sensitivity Effects 0.000 description 14
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 8
- 230000003321 amplification Effects 0.000 description 8
- 238000003199 nucleic acid amplification method Methods 0.000 description 8
- 210000002966 serum Anatomy 0.000 description 7
- 108020004414 DNA Proteins 0.000 description 6
- 239000000243 solution Substances 0.000 description 5
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 4
- 102000004190 Enzymes Human genes 0.000 description 4
- 108090000790 Enzymes Proteins 0.000 description 4
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 4
- TWRXJAOTZQYOKJ-UHFFFAOYSA-L Magnesium chloride Chemical compound [Mg+2].[Cl-].[Cl-] TWRXJAOTZQYOKJ-UHFFFAOYSA-L 0.000 description 4
- 239000000090 biomarker Substances 0.000 description 4
- 201000011510 cancer Diseases 0.000 description 4
- 238000006243 chemical reaction Methods 0.000 description 4
- 239000006228 supernatant Substances 0.000 description 4
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 4
- 201000009030 Carcinoma Diseases 0.000 description 3
- 108020004566 Transfer RNA Proteins 0.000 description 3
- 239000008346 aqueous phase Substances 0.000 description 3
- 238000010804 cDNA synthesis Methods 0.000 description 3
- 238000002052 colonoscopy Methods 0.000 description 3
- 230000000875 corresponding effect Effects 0.000 description 3
- 238000011161 development Methods 0.000 description 3
- 239000000203 mixture Substances 0.000 description 3
- 239000008188 pellet Substances 0.000 description 3
- 230000001105 regulatory effect Effects 0.000 description 3
- 102000012406 Carcinoembryonic Antigen Human genes 0.000 description 2
- 108010022366 Carcinoembryonic Antigen Proteins 0.000 description 2
- 102100034343 Integrase Human genes 0.000 description 2
- 238000012408 PCR amplification Methods 0.000 description 2
- 108010092799 RNA-directed DNA polymerase Proteins 0.000 description 2
- 238000002247 constant time method Methods 0.000 description 2
- -1 dNTPs Substances 0.000 description 2
- 238000000605 extraction Methods 0.000 description 2
- 238000012165 high-throughput sequencing Methods 0.000 description 2
- 229910001629 magnesium chloride Inorganic materials 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 238000002844 melting Methods 0.000 description 2
- 230000008018 melting Effects 0.000 description 2
- 238000002360 preparation method Methods 0.000 description 2
- 238000012163 sequencing technique Methods 0.000 description 2
- 229940126586 small molecule drug Drugs 0.000 description 2
- 238000010561 standard procedure Methods 0.000 description 2
- 238000012795 verification Methods 0.000 description 2
- 241000282326 Felis catus Species 0.000 description 1
- 102000011931 Nucleoproteins Human genes 0.000 description 1
- 108010061100 Nucleoproteins Proteins 0.000 description 1
- 238000007605 air drying Methods 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 239000000427 antigen Substances 0.000 description 1
- 108091007433 antigens Proteins 0.000 description 1
- 102000036639 antigens Human genes 0.000 description 1
- 239000000872 buffer Substances 0.000 description 1
- 150000001720 carbohydrates Chemical class 0.000 description 1
- 238000005119 centrifugation Methods 0.000 description 1
- YTRQFSDWAXHJCC-UHFFFAOYSA-N chloroform;phenol Chemical compound ClC(Cl)Cl.OC1=CC=CC=C1 YTRQFSDWAXHJCC-UHFFFAOYSA-N 0.000 description 1
- 238000004140 cleaning Methods 0.000 description 1
- 230000002596 correlated effect Effects 0.000 description 1
- 238000013211 curve analysis Methods 0.000 description 1
- 238000005947 deacylation reaction Methods 0.000 description 1
- 230000034994 death Effects 0.000 description 1
- 231100000517 death Toxicity 0.000 description 1
- 230000007812 deficiency Effects 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 239000003596 drug target Substances 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 238000010195 expression analysis Methods 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- 238000011902 gastrointestinal surgery Methods 0.000 description 1
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 1
- 238000011534 incubation Methods 0.000 description 1
- 231100000518 lethal Toxicity 0.000 description 1
- 230000001665 lethal effect Effects 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 238000002156 mixing Methods 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 108091027963 non-coding RNA Proteins 0.000 description 1
- 102000042567 non-coding RNA Human genes 0.000 description 1
- 239000000101 novel biomarker Substances 0.000 description 1
- 230000008506 pathogenesis Effects 0.000 description 1
- 230000001575 pathological effect Effects 0.000 description 1
- 239000012071 phase Substances 0.000 description 1
- 238000005191 phase separation Methods 0.000 description 1
- 238000012257 pre-denaturation Methods 0.000 description 1
- 238000001556 precipitation Methods 0.000 description 1
- 238000004445 quantitative analysis Methods 0.000 description 1
- 239000011535 reaction buffer Substances 0.000 description 1
- 238000003757 reverse transcription PCR Methods 0.000 description 1
- 239000003161 ribonuclease inhibitor Substances 0.000 description 1
- 230000001953 sensory effect Effects 0.000 description 1
- 238000005063 solubilization Methods 0.000 description 1
- 238000010200 validation analysis Methods 0.000 description 1
- 238000003260 vortexing Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of genetic engineering and tumor medicine, and particularly discloses a blood tRF marker for colorectal tumor lesion auxiliary diagnosis and application thereof, wherein the blood tRF marker is a combination of tRF-Tyr-GTA-081 and tRF-Ala-AGC-060; the blood tRF marker can be used for auxiliary diagnosis of colorectal tumorous lesions. The invention also discloses a kit for auxiliary diagnosis of colorectal tumorous lesions, which is used for detecting tRF-Tyr-GTA-081 and tRF-Ala-AGC-060 in blood and comprises detection reagents for detecting tRF-Tyr-GTA-081 and tRF-Ala-AGC-060, wherein the detection reagents comprise RNA reverse transcription primers and/or DNA amplification primers used in QPCR experiments. The blood tRF marker combination can be used for screening and diagnosing colorectal tumor lesions, has high detection success rate and good technical reproducibility, is beneficial to reflecting the disease states of asymptomatic high risk groups of the colorectal tumor lesions, and provides support for clinicians to quickly and accurately master the patient's conditions and timely adopt more personalized prevention and treatment schemes.
Description
Technical Field
The invention belongs to the field of genetic engineering and oncology, and relates to a novel blood tRF marker for colorectal tumorous lesions (including adenoma and colorectal cancer) and application thereof.
Background
According to the latest global cancer statistics, colorectal cancer (CRC) is the third most common cancer and the second most common lethal cancer worldwide. The number of new cases and deaths in colorectal cancer in china in 2015 was 39 and 19 million, respectively. Furthermore, this figure will continue to rise in the coming years. A recent study showed that about 85% of CRCs are likely transformed by adenomas. Furthermore, among the different types of adenomas, advanced adenomas have been shown to be the more significant risk factor for CRC. Therefore, in clinical applications, early screening and diagnosis of colorectal neoplastic lesions, including adenomas and CRC, is critical for subsequent treatment.
Colonoscopy is considered the gold standard for screening of colorectal neoplastic lesions. However, colonoscopy suffers from missed detection rate and incomplete coverage. In addition, in the city of China, the colonoscopy compliance rate of the high risk group with colorectal cancer is only about 15%. All of these burdens interfere with the early screening and diagnosis of colorectal neoplastic lesions. Although several tumor markers have been found, such as carcinoembryonic antigen (CEA) and carbohydrate antigen (e.g., CA19-9, CA74-2, etc.), etc., the sensitivity and specificity of diagnosis of colorectal neoplastic lesions, including adenomas and colorectal cancers, is limited, especially in the discovery of early stage colorectal neoplastic lesions and in the identification of aggressive, painless tumors. Therefore, the search for new markers with high specificity and good sensitivity is increasingly receiving attention at home and abroad. Therefore, there is an urgent need to establish a new colorectal tumor screening technique that is simple and easy to implement to improve compliance rates.
Transfer RNA (tRNA) is an important regulatory non-coding RNA involved in various disease processes. tRNAs are cleaved by specific enzymes to generate a variety of tRNA-derived fragments (tRNAs). There is increasing evidence that tRFs are involved in the development and progression of various diseases, including cancer. Therefore, tRFs can be used as biomarkers for colorectal neoplastic lesions.
At present, no stable biomarker for diagnosing colorectal neoplastic lesions (including adenoma and colorectal cancer) is reported, and if whole blood (including serum or plasma) tRFs abnormally expressed by colorectal neoplastic lesions (including adenoma and colorectal cancer) can be screened out as the biomarker, and a corresponding diagnostic kit is developed, the screening and diagnosis of colorectal neoplastic lesions (including adenoma and colorectal cancer) in China can be powerfully promoted.
Disclosure of Invention
In response to the problems and deficiencies of the prior art, the inventors hope to search a group of highly specific and sensitive tRFs highly correlated with colorectal neoplastic lesions (including adenoma and colorectal cancer) by separating and studying tRFs in patients with colorectal neoplastic lesions (including adenoma and colorectal cancer) and healthy human control whole blood (including serum or plasma) matched with the ages and sexes of patients with neoplastic lesions (including adenoma and colorectal cancer), and develop a diagnostic kit for colorectal neoplastic lesions (including adenoma and colorectal cancer) convenient for clinical application, provide data support for screening and diagnosing colorectal neoplastic lesions (including adenoma and colorectal cancer), and provide data support for finding novel small molecule drugs with potential therapeutic value.
In order to realize the purpose of the invention, the technical scheme adopted by the invention is as follows:
the invention provides a blood tRFs marker for auxiliary diagnosis of colorectal tumorous lesions (including adenoma and colorectal cancer), wherein the blood tRFs marker is a combination of tRF-Tyr-GTA-081 and tRF-Ala-AGC-060, and an amplification primer of the tRF-Tyr-GTA-081 is Forward:5'GAGTTCTACAGTCCGACGATCT 3'; reverse 5 'CTCTTCCGATCTAGATTTA CAGTC 3'. The amplification primer for detecting the tRF-Ala-AGC-060 is Forward 5'GTCCGACGATCTCCCCAGTA 3'; reverse 5 'TGTGCTCTTCCGATCTTGGT 3'.
The invention also provides application of the blood tRFs marker in preparation of an auxiliary diagnostic kit or reagent for colorectal tumorous lesions (including adenomas and colorectal cancer).
According to the above-mentioned application, preferably, the kit contains a detection reagent for detecting tRF-Tyr-GTA-081 and tRF-Ala-AGC-060.
According to the above-mentioned use, preferably, the detection reagent comprises an RNA reverse transcription primer and/or a DNA amplification primer.
The invention also provides a kit for auxiliary diagnosis of colorectal neoplastic lesions (including adenomas and colorectal cancers), which is used for detecting tRF-Tyr-GTA-081 and tRF-Ala-AGC-060 in blood.
According to the above kit, preferably, the kit comprises detection reagents for detecting tRF-Tyr-GTA-081 and tRF-Ala-AGC-060.
According to the above kit, preferably, the detection reagent comprises an RNA reverse transcription primer and/or a DNA amplification primer used in a QPCR experiment, the RNA reverse transcription primer being an oligo (dt) primer; the amplification primer of the tRF-Tyr-GTA-081 is Forward, namely 5'GAGTTCTACAGTCCGACGATCT 3'; reverse 5 'CTCTTCCGATCTAGATTTA CAGTC 3', i.e., as shown in SEQ ID NO.1 and SEQ ID NO. 2. The amplification primer for detecting the tRF-Ala-AGC-060 is Forward 5'GTCCGACGATCTCCCCAGTA 3'; reverse 5 'TGTGCTCTTCCGATCTTGGT 3', i.e. as shown in SEQ ID NO.3 and SEQ ID NO. 4.
According to the above kit, preferably, the kit further comprises a detection reagent for detecting an internal reference gene; the internal reference gene is SnRNA U6, the detection reagent of the internal reference gene comprises RNA reverse transcription primer and/or DNA amplification primer used in QPCR experiment, the RNA reverse transcription primer is oligo (dt) primer, and the nucleotide sequence of the DNA amplification primer used for detecting SnRNA U6 is Forward 5 'GCTTCGGCAGCACATATACTAAAAT 3'; reverse 5 'CGCTTCACGAATTTG CGTGTCAT 3', i.e., as shown in SEQ ID NO.5 and SEQ ID NO. 6.
According to the above kit, preferably, the kit further comprises a reverse transcription reaction reagent and a PCR amplification reagent, such as reverse transcriptase, a buffer, dNTPs, MgCl2, DEPC water, Taq enzyme and the like; standards and/or controls may also be included.
Specifically, the technical solution of the present invention to solve the problem includes:
(1) establishing a unified specimen library and a database: standard procedures (SOP) were used to collect blood samples meeting the standards and the system collected complete demographic and clinical data.
(2) Differential expression profiling of tRFs: selecting colorectal tumorous lesion (comprising adenoma and colorectal cancer) case tissues and corresponding colorectal cancer paracancerous tissue samples, detecting the expression profiles and the contents of tRFs in the tissue samples, analyzing the commonness and the characteristics of the colorectal tumorous lesion (comprising adenoma and colorectal cancer) case tissues and the corresponding colorectal cancer paracancerous tissue tRFs, and screening the differential expression tRFs; further large sample validation in tissues and whole blood was performed using the screened differentially expressed tRFs to identify tRFs in whole blood (both serum and plasma) associated with the pathogenesis of colorectal neoplastic lesions (including adenomas and colorectal cancer).
(3) Development of whole blood (including serum and plasma) tRFs screening and diagnostic kits: tRFs diagnostic kits were developed based on specific whole blood (including serum and plasma) tRFs in cases of colorectal neoplastic lesions (including adenomas and colorectal cancer) and healthy human controls.
Quantitative analysis of tRNAs in whole blood (including serum and plasma) in the step (2) can be completed by RT-PCR, QPCR, Solexa sequencing technology, Tapman low intensity array (TLDA) chip detection and the like. In a specific embodiment of the invention, verification is performed using QPCR.
Verification of differentially expressed tRFs by QPCR comprises the following specific operation steps:
(1) extracting total RNA of the sample;
(2) pretreating the RNA obtained in the step (1) and performing reverse transcription to obtain cDNA;
(3) performing amplification detection on the tRFs and the reference gene on a fluorescent real-time quantitative PCR instrument;
(4) the target bands were analyzed by melting curves and the Δ Δ CT method was used for relative quantification.
Compared with the prior art, the invention has the following positive beneficial effects:
(1) the invention adopts tRFs sequencing to carry out detection analysis on cases of colorectal neoplastic lesions (comprising adenomas and colorectal cancers) and tRFs expression profiles of samples of tissues beside the carcinoma, obtains tRFs differentially expressed in cases of colorectal neoplastic lesions (comprising adenomas and colorectal cancers) and tissues beside the carcinoma, verifies the differentially expressed tRFs in whole blood of a large group of people, and screens a blood tRFs marker combination (a combination of tRF-Tyr-GTA-081 and tRF-Ala-AGC-060) stably associated with the colorectal neoplastic lesions (comprising adenomas and colorectal cancers), wherein the blood tRFs marker combination can be used for clinical screening of colorectal neoplastic lesions (comprising adenomas and colorectal cancers) for AUC 0.801 and sensory 73.13 percent, is helpful for reflecting the disease state of asymptomatic high risk group of colorectal tumor lesion (including adenoma and colorectal cancer), and provides support for clinician to quickly and accurately master the disease state of patient and timely adopt more personalized prevention and treatment scheme.
(2) The blood tRFs is a novel biomarker which is stable, minimally invasive, easy to detect and accurate in quantification, so that the sensitivity of diagnosis of colorectal neoplastic lesions (including adenoma and colorectal cancer) is greatly improved by detecting the expression of tRF-Tyr-GTA-081 and tRF-Ala-AGC-060 in serum/plasma, a brand new situation is created for diagnosis and treatment of the colorectal neoplastic lesions (including adenoma and colorectal cancer), and reference is provided for development of biomarkers of other diseases.
(3) The kit is prepared by detecting RNA reverse transcription primers and DNA amplification primers of a blood tRFS marker combination (combination of tRF-Tyr-GTA-081 and tRF-Ala-AGC-060) related to the auxiliary diagnosis of colorectal neoplastic lesions (comprising adenoma and colorectal cancer), has high sensitivity, strong specificity, simple operation and convenient use, can be used for the auxiliary diagnosis of the colorectal neoplastic lesions (comprising adenoma and colorectal cancer) and the screening of asymptomatic high risk population of the colorectal neoplastic lesions (comprising adenoma and colorectal cancer), ensures that the diagnosis of the colorectal neoplastic lesions (comprising adenoma and colorectal cancer) is more convenient and easier, and lays a foundation for the clinical treatment effect evaluation for the rapid and accurate screening diagnosis of asymptomatic high risk population of the colorectal neoplastic lesions (comprising adenoma and colorectal cancer), and provides help for finding novel small molecule drug targets with potential therapeutic value.
Drawings
FIG. 1 is a graph of the results of tRFs high throughput sequencing of 5 pairs of abnormally expressed tRFs in adenomas, 5 pairs of colorectal carcinomas and their paired paraneoplastic tissues in accordance with one embodiment of the present invention;
FIG. 2 is a graph showing the expression of tRF-Tyr-GTA-081 and tRF-Ala-AGC-060 in the tissues of cases of colorectal neoplastic lesions (including adenomas and colorectal cancer);
FIG. 3 is a graph showing the expression of tRF-Tyr-GTA-081 and tRF-Ala-AGC-060 in whole blood of patients with colorectal neoplastic lesions (including adenomas and colorectal cancer) and healthy volunteers;
FIG. 4 is a ROC curve analysis of the combination of tRF-Tyr-GTA-081 and tRF-Ala-AGC-060 in colorectal neoplastic lesions as well as adenomas and colorectal cancers;
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The present invention will be described in further detail with reference to specific examples, but the scope of the present invention is not limited thereto.
The tRFs markers tRF-Tyr-GTA-081 and tRF-Ala-AGC-060 provided by the present invention for colorectal neoplastic lesions (including adenomas and colorectal cancers) were demonstrated by the following specific examples as diagnostic and prognostic markers for colorectal neoplastic lesions (including adenomas and colorectal cancers).
Example 1
This example screens 5 pairs of adenomas, 5 colorectal cancers and their paired paraneoplastic tissues for differentially expressed tRFs by high throughput sequencing. All adenomas, colorectal cancers, and paired paracancerous tissues and whole blood of patients were collected in gastrointestinal surgery and endoscope rooms of the Logos hospital affiliated to Shanghai medical university and confirmed by pathological examination. Patients informed and agreed to the samples for this study, and the study was approved and conducted by the ethical scientific committee of the london hospital.
As can be seen from FIG. 1, the expression level of 1 tRFs (tRF-Ala-AGC-060) was significantly up-regulated in the adenoma and colorectal cancer tissues, and 11 tRFs were significantly down-regulated in the adenoma and colorectal cancer tissues, including tRF-Tyr-GTA-081. The qPCR method examined the differential expression of tRF-Tyr-GTA-081 and tRF-Ala-AGC-060 in the tissues of adenoma and colorectal cancer, and the expression of tRF-Tyr-GTA-081 and tRF-Ala-AGC-060 was verified with the blood of healthy volunteers, the blood of adenoma and colorectal cancer patients.
The specific experimental procedure is as follows:
first, extraction of tissue RNA
1. Tissue homogenate
1ml of TRIZOL reagent was added to each 50-100mg of tissue sample, and homogenized with an electric homogenizer.
2. Two-phase separation
0.2ml of chloroform was added to 1ml of the TRIZOL reagent homogenate sample, and the tube was vigorously shaken for 15 seconds and then incubated at room temperature for 10 minutes. Centrifuge at 12,000rpm for 15 minutes at 4 ℃. After centrifugation, the mixed liquid will be separated into a lower red phenol chloroform phase, an intermediate layer and an upper colorless aqueous phase. The RNA was partitioned in the aqueous phase in its entirety.
3. RNA precipitation
The aqueous phase was transferred to a fresh centrifuge tube and mixed with an equal volume of isopropanol to precipitate the RNA therein, mixed well and incubated at room temperature for 10 minutes and then centrifuged at 12,000rpm at 4 ℃ for 10 minutes.
4. RNA cleaning
The supernatant was removed, 1ml of 75% ethanol was added, and the RNA pellet was washed. After shaking, the mixture was centrifuged at 7,500rpm at 4 ℃ for 5 minutes.
5. Re-solubilization of RNA pellets
The ethanol solution was removed and the RNA pellet was air dried for 5-10 minutes. RNase-free water was added, followed by incubation at 55 to 60 ℃ for 10 minutes. The RNA solution obtained was stored at-70 ℃.
6. Use of
ND-1000 determination of RNA concentration and purity.
Second, extraction of RNA from whole blood
1. Taking a whole blood sample from a refrigerator at minus 80 ℃, taking 300 mu l of whole blood, and adding 800 mu l of TRIzol LS;
2. shaking the EP tube up and down to mix the sample, standing for 5 minutes to make the nucleoprotein complex completely dissociate.
3. Adding 200 μ l chloroform, covering the tube cover, mixing well, and standing for 10 min.
Centrifuge at 12,000g for 15min at 4.4 ℃. The supernatant containing RNA was removed and transferred to a new EP tube.
5. 500. mu.l of isopropanol (TRIZOL: 3: 2) was added thereto, and the mixture was allowed to stand for 10 min. Centrifuge at 12000 Xg for 10min at 4 ℃ and discard the supernatant.
6. Adding 1ml of 75% ethanol (75% ethanol: TRIZOL ═ 4: 3), vortexing, centrifuging at 4 ℃ for 5min at 7500g, discarding the supernatant, and air-drying for 5-10 min.
7. Adding 20 mul DEPC water, and carrying out water bath at 55-60 ℃ for 10-15 min.
8. Use of
ND-1000 determination of RNA concentration and purity.
Thirdly, RNA pretreatment and cDNA synthesis.
Pretreatment of RNA
Mu.g of RNA was vortexed with 3. mu.L of Deacylation Reaction Buffer and 1. mu.L of RNase Inhibitor and incubated at 37 ℃ for 40 minutes. Then, 1. mu.L of Adaptor, 10. mu.L of Ligation Reaction and 3. mu.L of Ligation Enzyme Mix were mixed and incubated at 25 ℃ for 1 hour. The treated RNA was used for the subsequent cDNA synthesis.
Preparation of cDNA Synthesis reagent
Incubate for 1 hour at 50 ℃ in a thermal cycler.
Fourthly, qPCR verified the expression levels of tRF-Ala-AGC-060 and tRF-Tyr-GTA-081.
Taking cDNA obtained by reverse transcription as a template, and preparing a reaction solution according to the following qPCR reaction system:
all the indexes were carried out according to the following procedures: pre-denaturation at 95 deg.C for 10 min; 95 ℃ for 10 seconds; 60 ℃, 60 seconds, total 40 PCR cycles.
As can be seen in FIG. 2, the expression level of tRF-Ala-AGC-060 was significantly higher in the tissues of colorectal neoplastic lesions (including adenomas and colorectal cancer) than in the tissues adjacent to the carcinoma. tRF-Tyr-GTA-081 is expressed at significantly lower levels in tissues of colorectal neoplastic lesions (including adenomas and colorectal cancer) than in paraneoplastic tissues.
As can be seen in FIG. 3, the expression level of tRF-Ala-AGC-060 in whole blood of patients with colorectal neoplastic lesions (including adenomas and colorectal cancer) was significantly higher than that of healthy volunteers. tRF-Tyr-GTA-081 is expressed in whole blood of patients with colorectal neoplastic lesions (including adenomas and colorectal cancer) at significantly lower levels than healthy volunteers.
Example 2: tRF was analyzed for diagnostic value in colorectal neoplastic lesions including adenomas and colorectal cancer.
According to the qPCR results in example 1, the sensitivity of diagnosis was evaluated by plotting ROC curve using MedCalc software, and the judging ability of these 2 tRFs to the onset of colorectal tumorous lesions (including adenomas and colorectal cancer) was evaluated, and the results are shown in FIG. 4. When the tRF-Ala-AGC-060 alone was used as an index to distinguish colorectal neoplastic lesions from healthy controls, the AUC value was 0.626 and the sensitivity was 29.85%. When the tRF-Tyr-GTA-081 alone is used for distinguishing colorectal tumorous lesions from a healthy control group, the AUC value is 0.762, and the sensitivity is 52.24%. Based on the poor specificity of single tRFs, the Combination of two tRFs is used as tRFcombination, when the tRFcombination is used for distinguishing colorectal tumorous lesions from healthy control groups, the AUC value is 0.801, and the sensitivity is 73.13%, therefore, the combined use of the tRF-Ala-AGC-060 and the tRF-Tyr-GTA-081 can well distinguish healthy volunteers from colorectal tumorous lesions, and the diagnosis sensitivity of the colorectal tumorous lesions is higher than that of the tRFs singly used. Furthermore, we analyzed the diagnostic value of tRF combined diagnosis in adenoma and CRC, respectively. Among adenomas, tRF Combination distinguished the adenoma group from the healthy control group, with an AUC value of 0.777 and a sensitivity of 67.57%. In CRC, tRF Combination distinguished the CRC group from the healthy control group, with an AUC value of 0.847 and a sensitivity of 73.33%; while the traditional classical index of CRC, CA199, distinguished CRC from healthy controls, with AUC values of 0.656 and sensitivity at the optimal cut-off point of 60.00%. As can be seen from the results, the efficacy and sensitivity of the tRF Combination in diagnosing CRC are significantly better than the conventional index CA 199.
Example 3: manufacturing an auxiliary diagnostic kit for colorectal tumor lesions.
The manufacturing and operation process of the colorectal tumor lesion auxiliary diagnosis kit is based on tRF chip detection and QPCR quantitative detection technology. The colorectal tumorous lesion auxiliary diagnosis kit is applied to detecting tRF-Ala-AGC-060 and tRF-Tyr-GTA-081 in blood; the kit comprises detection reagents for detecting tRF-Ala-AGC-060 and tRF-Tyr-GTA-081; the detection reagent comprises an RNA reverse transcription primer and a DNA amplification primer used in the QPCR experiment, wherein the RNA reverse transcription primer is an oligo (dt) primer; nucleotide sequences of DNA amplification primers for detection of tRF-Ala-AGC-060 and tRF-Tyr-GTA-081. the amplification primer of the tRF-Tyr-GTA-081 is Forward:5'GAGTTCTACAGTCCGACGATCT 3'; reverse 5 'CTCTTCCGATCTAGATTTA CAGTC 3', i.e., as shown in SEQ ID NO.1 and SEQ ID NO. 2. The amplification primer for detecting the tRF-Ala-AGC-060 is Forward 5'GTCCGACGATCTCCCCAGTA 3'; reverse 5 'TGTGCTCTTCCGATCTTGGT 3', i.e., as shown in SEQ ID NO.3 and SEQ ID NO. 4. Further, the kit also comprises a detection reagent for detecting the internal reference gene SnRNA U6, wherein the detection reagent for detecting the internal reference gene SnRNA U6 comprises an RNA reverse transcription primer and a DNA amplification primer used in a QPCR experiment, and the nucleotide sequence of the RNA reverse transcription primer and the nucleotide sequence of the DNA amplification primer used for detecting the SnRNA U6 are Forward:5 'GCTTCGGCAGCACATATACTAAAAT 3'; reverse 5 'CGCTTCACGAATTTG CGTGTCAT 3', i.e., as shown in SEQ ID NO.5 and SEQ ID NO. 6. Further, the kit may contain conventional reverse transcription reagents and PCR amplification reagents, such as reverse transcriptase, dNTPs, MgCl2, double distilled water, Taq enzyme, etc., which are well known to those skilled in the art, and may further contain standards and controls.
The detection method of the kit comprises the following steps: (1) extracting total RNA of the sample; (2) pre-denaturing the extracted RNA and reverse transcribing into cDNA; (3) performing amplification detection on the tRF and the reference gene on a fluorescent real-time quantitative PCR instrument; (4) analyzing a target band through a melting curve, carrying out relative quantification by a delta CT method and the like; see example 1 for the specific operation of each step.
The kit has the value that only whole blood is needed, other tissue samples are not needed, the expression of tRF-Ala-AGC-060 and tRF-Tyr-GTA-081 is detected through the simplest and specific primers to assist in judging colorectal tumorous lesions, the kit is stable, convenient to detect and accurate in quantification, and sensitivity of disease diagnosis is greatly improved, so that the kit is put into practice and can help to guide clinical accurate diagnosis.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the present invention, but rather as the following description is intended to cover all modifications, equivalents and improvements falling within the spirit and scope of the present invention.
Sequence listing
<110> Shanghai medical university affiliated Longhua Hospital
<120> blood tRF marker for colorectal tumorous lesion and application thereof
<130> CNF2020139
<141> 2020-06-18
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gagttctaca gtccgacgat ct 22
<210> 2
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ctcttccgat ctagatttac agtc 24
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gtccgacgat ctccccagta 20
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tgtgctcttc cgatcttggt 20
<210> 5
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gcttcggcag cacatatact aaaat 25
<210> 6
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
cgcttcacga atttgcgtgt cat 23
Claims (9)
1. The application of the blood tRF marker in preparing an auxiliary diagnostic kit or reagent for colorectal tumorous lesions is characterized in that the blood tRF marker is a combination of tRF-Tyr-GTA-081 and tRF-Ala-AGC-060.
2. The use according to claim 1, wherein the neoplastic colorectal lesion is an adenoma or a colorectal carcinoma.
3. The use of claim 2, wherein the kit comprises detection reagents for detecting tRF-Tyr-GTA-081 and tRF-Ala-AGC-060.
4. The use of claim 3, wherein the detection reagent comprises RNA reverse transcription primers and/or DNA amplification primers used in QPCR experiments, wherein the RNA reverse transcription primers are oligo (dt) primers; the nucleotide sequences of the DNA amplification primers for detecting the tRF-Tyr-GTA-081 are shown as SEQ ID NO.1 and SEQ ID NO. 2; the nucleotide sequences of the DNA amplification primers for detecting tRF-Ala-AGC-060 are shown in SEQ ID NO.3 and SEQ ID NO. 4.
5. The use of claim 3, wherein the kit further comprises a detection reagent for detecting an internal reference gene; the internal reference gene is SnRNA U6, the detection reagent of the internal reference gene comprises RNA reverse transcription primer and/or DNA amplification primer used in QPCR experiment, the RNA reverse transcription primer is oligo (dt) primer, and the nucleotide sequence of the DNA amplification primer for detecting SnRNA U6 is shown as SEQ ID NO.5 and SEQ ID NO. 6.
6. A method for detecting tRF-Tyr-GTA-081 and tRF-Ala-AGC-060 in colorectal tumorous lesion tissue or blood for non-diagnostic and therapeutic purposes, comprising the steps of:
(1) blood and tissue sample collection and processing;
(2) RNA extraction;
(3) quantification, pre-treatment and reverse transcription of RNA: after the concentration of RNA is measured by using a spectrophotometer, an RNA sample is pretreated, then reverse transcription reaction liquid is prepared, and program parameters are set;
(4) and using cDNA obtained by reverse transcription as a template, and detecting and analyzing the expression levels of tRF-Tyr-GTA-081 and tRF-Ala-AGC-060 in tissues and blood samples by using a qPCR technology.
7. The method of detecting tRF-Tyr-GTA-081 and tRF-Ala-AGC-060 for the detection of colorectal tumorous lesion tissue or blood according to claim 6, characterized in that the colorectal tumorous lesion is an adenoma or a colorectal cancer.
8. The method of detecting tRF-Tyr-GTA-081 and tRF-Ala-AGC-060 for the detection of colorectal tumorous lesion tissue or blood according to claim 7, characterized in that said tissue comprises colorectal tumorous lesion tissue or tissues adjacent to colorectal cancer.
9. The method for detecting tRF-Tyr-GTA-081 and tRF-Ala-AGC-060 in colorectal tumorous lesion tissue or blood for non-diagnostic and therapeutic purposes according to claim 7, characterized in that said blood comprises the blood of colorectal tumorous lesion patients and the blood of healthy volunteers.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010557526.5A CN113817821A (en) | 2020-06-18 | 2020-06-18 | Colorectal tumorous lesion blood tRF marker and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010557526.5A CN113817821A (en) | 2020-06-18 | 2020-06-18 | Colorectal tumorous lesion blood tRF marker and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113817821A true CN113817821A (en) | 2021-12-21 |
Family
ID=78911557
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010557526.5A Pending CN113817821A (en) | 2020-06-18 | 2020-06-18 | Colorectal tumorous lesion blood tRF marker and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113817821A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016176446A2 (en) * | 2015-04-29 | 2016-11-03 | Geneoscopy, Llc | Colorectal cancer screening method and device |
| CN109999199A (en) * | 2019-03-21 | 2019-07-12 | 浙江大学 | Application of the tiRNA as drug target in colorectal cancer transfer treatment |
-
2020
- 2020-06-18 CN CN202010557526.5A patent/CN113817821A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016176446A2 (en) * | 2015-04-29 | 2016-11-03 | Geneoscopy, Llc | Colorectal cancer screening method and device |
| CN109999199A (en) * | 2019-03-21 | 2019-07-12 | 浙江大学 | Application of the tiRNA as drug target in colorectal cancer transfer treatment |
Non-Patent Citations (2)
| Title |
|---|
| HUIXUAN XU, ET AL: "The potential role of tRNAs and small RNAs derived from tRNAs in the occurrence and development of systemic lupus erythematosus", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 527, no. 2, pages 561 - 567 * |
| LI SIQI, ET AL: "Angiogenin promotes colorectal cancer metastasis via tiRNA production.", INTERNATIONAL JOURNAL OF CANCER, vol. 145, no. 5, pages 1395 - 1407 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111826444B (en) | Serum/plasma tsRNA marker related to pancreatic cancer, probe and application thereof | |
| CN109609633B (en) | Serum miRNA marker related to breast cancer auxiliary diagnosis and application thereof | |
| CN106119393B (en) | Plasma miRNA marker related to esophageal squamous carcinoma auxiliary diagnosis and application thereof | |
| CN106119392B (en) | Serum miRNA marker related to esophageal squamous carcinoma auxiliary diagnosis and application thereof | |
| CN105950753B (en) | One kind blood plasma miRNA marker relevant to adenocarcinoma of lung auxiliary diagnosis and its application | |
| CN109055557B (en) | Serum miRNA marker related to pancreatic cancer auxiliary diagnosis and application thereof | |
| CN108103198A (en) | A kind of and the relevant blood plasma miRNA marker of cancer of pancreas auxiliary diagnosis and its application | |
| CN109609634B (en) | Circulating miRNA marker related to endometrial cancer auxiliary diagnosis and application thereof | |
| CN107475363B (en) | Biomarker combination for non-small cell lung cancer, screening method of biomarker combination and application of biomarker combination | |
| CN110229899B (en) | Plasma marker combinations for early diagnosis or prognosis prediction of colorectal cancer | |
| CN108866187B (en) | Long-chain non-coding RNA marker related to lung cancer auxiliary diagnosis and application thereof | |
| Malik et al. | Comprehensive evaluation of microRNA as a biomarker for the diagnosis of hepatocellular carcinoma | |
| CN110257514B (en) | Novel esophageal cancer blood miRNA marker and application thereof | |
| CN111424085B (en) | Application of tRNA source fragment in preparation of breast cancer diagnostic reagent | |
| CN109593851B (en) | Plasma miRNA marker related to breast cancer auxiliary diagnosis and application thereof | |
| CN109593852B (en) | Serum miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof | |
| CN108796082B (en) | Use of long-chain non-coding RNAs | |
| CN108929910B (en) | Serum miRNA marker related to lung adenocarcinoma auxiliary diagnosis and application thereof | |
| CN108103199B (en) | Circulating miRNA marker related to ovarian cancer auxiliary diagnosis and application thereof | |
| CN106086178B (en) | Serum miRNA marker related to gastric cancer auxiliary diagnosis and application thereof | |
| CN106350582B (en) | Serum miRNA marker related to lung squamous carcinoma auxiliary diagnosis and application thereof | |
| CN113817821A (en) | Colorectal tumorous lesion blood tRF marker and application thereof | |
| CN109536612B (en) | Plasma miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof | |
| CN111286538B (en) | Circulating miRNA and carcinoembryonic miRNA markers related to pan-tumor auxiliary diagnosis and application thereof | |
| CN111304322B (en) | Preparation method of kit for joint detection of esophageal cancer by four novel circRNAs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |