CN113817779A

CN113817779A - Breeding method for obtaining pseudo male fish parent determined by XX/XY sex in large scale and application thereof

Info

Publication number: CN113817779A
Application number: CN202110274222.2A
Authority: CN
Inventors: 殷战; 翟刚; 舒婷婷; 娄气永; 贺江燕; 姜冬火; 钱雪桥; 石闯; 黄建飞; 贾景怡
Original assignee: Institute of Hydrobiology of CAS
Current assignee: Institute of Hydrobiology of CAS
Priority date: 2021-03-15
Filing date: 2021-03-15
Publication date: 2021-12-21
Anticipated expiration: 2041-03-15
Also published as: CN113817779B

Abstract

The invention provides a breeding method for obtaining pseudo-male fish parents determined by XX/XY sex in a large scale and application thereof. According to the method, by utilizing a CRISPR/Cas9 system to specifically cut a cyp17a1 gene of fish, an effective mutant F1 generation cyp17a1 heterozygous son fish (cyp17a1+/-) is obtained, selfing is carried out, a pseudo male fish of a cyp17a1 homozygote (cyp17a1-/-XX) of an XX sex inheritance type is screened out through sex markers, and the pseudo male fish is hybridized with a heterozygote female fish (cyp17a1+/-XX), the ratio of the number of the pseudo male fish (cyp17a1-/-XX) in a population is up to 50%, so that the effect of expanding the number of the pseudo male fish parent population on a large scale is achieved. The breeding method provided by the invention effectively realizes the expanding propagation and simple screening of the number of the pseudo male fish populations, improves the production efficiency of sex determination control breeding, and provides more backup parents for obtaining full female fish subsequently. The method has strong applicability, has wide adaptability and expansibility in aquaculture of economic fishes, and greatly expands the application range of the method in the field of fish sex determination breeding.

Description

Breeding method for obtaining pseudo male fish parent determined by XX/XY sex in large scale and application thereof

Technical Field

The invention relates to the technical field of gene editing, also relates to the technical field of fish sex control breeding, and particularly relates to a breeding method for obtaining pseudo male fish parents determined by XX/XY sex in a large scale and application thereof.

Background

The development of aquaculture industry becomes an indispensable part of the world, and the yield of freshwater fish in China is increasing day by day. In aquatic fishes, there are wide sexual differences in individual size, external shape and color characteristics, which are called as amphipathicity or gender dimorphism of fishes. Many fishes show remarkable amphipathic profile on important production traits such as individual size, for example, female yellow river carp grows remarkably faster than male, and the economic value of the production traits is closely related to sex. Therefore, the development of a parthenocarpic fish breeding technique is of great significance in the fish farming industry.

In the aquaculture fishes determined by XX/XY sex and shaped in two sex, the obtaining of the colony of single sex can greatly improve the culture yield, such as all female carps, all female mandarin fishes and the like. In the conventional methods for producing all female carps and all female mandarin fishes, hormone (e.g., methyltestosterone) is often used for treatment, thereby inducing the inversion of XX sex-inherited female fishes into physiological male fishes (pseudo-male fishes). For example: the invention patent with the application number of CN201911147886.1 discloses a large-scale cultivation method of all-female spotted maigre. The method comprises the following steps: (1) inducing the gynogenesis diploid of the nibea albiflora; (2) inducing and identifying pseudo-male fish; and (3) mating the pseudo male fish with the normal female fish to produce the full female fish in a large scale. The method is based on the gynogenesis technology of the spotted maigre, the production of pseudo-male fish is induced by adopting aromatizing enzyme inhibitor to carry out trozole, and then the mating of the pseudo-male fish and normal female fish is utilized to obtain the all-female spotted maigre fry. However, in the above method, the use of hormone-related substances often causes water pollution, fish body residue, unstable sex development of drug-induced parent fish, and is limited to large-scale application, and the like, and therefore, it is difficult to popularize in the production practice of propagation expansion, which brings an obstacle to parthenocarpy.

In view of the above, there is a need to develop a method for obtaining pseudo-male fish in large scale and high proportion for XX/XY sex-determined aquaculture fish, which has important value and productive significance for sex-controlled breeding of aquaculture fish and culture of unisexual groups.

Disclosure of Invention

The invention aims to provide a breeding method for obtaining pseudo-male fish parents determined by XX/XY sex in a large scale and application thereof.

In order to realize the aim, the invention provides a breeding method for obtaining pseudo-male fish parents determined by XX/XY sex in a large scale, which comprises the steps of knocking out a catalytic enzyme coding gene of a sex steroid hormone synthetic pathway of fish by adopting a gene editing technology, blocking the sex steroid hormone synthetic pathway of the fish, screening to obtain heterozygote female fish and pseudo-male fish of XX sex genetic type with effective mutation, and hybridizing the pseudo-male fish and the heterozygote female fish, thereby obtaining a high pseudo-male population and enlarging the number of the pseudo-male fish parent population in a large scale.

As a further improvement of the invention, the gene coding for the catalytic enzyme of the sex steroid hormone synthesis pathway includes but is not limited to one of the key catalytic enzyme coding genes such as cyp17a1, cyp19a1, hsd17b and the like.

As a further improvement of the present invention, the method comprises the steps of:

s1, knocking out cyp17a1 gene in fish by using a gene editing technology to obtain an F0 generation;

s2, hybridizing the F0 generation male fish with a wild type female fish to obtain an effective mutant F1 generation cyp17a1 heterozygous child fish, wherein the genotype of the heterozygous child fish is cyp17a1 +/-;

s3, selfing the F1 generation cyp17a1 heterozygous daughter fish to obtain an F2 generation;

s4, screening and obtaining a cyp17a1 homozygous daughter fish without male markers and with the XX sex genotype, wherein the carp is expressed as a physiological male, is marked as a pseudo-male fish, and has the genotype of cyp17a1-/-XX in the F2 generation;

s5, hybridizing heterozygous female fish with the genotype of cyp17a1+/-XX and the pseudo-male fish with the genotype of cyp17a 1-/-XX;

s6, obtaining the F3 generation high pseudo-male population after artificial spawning induction and insemination, wherein all the F3 generation male fishes are pseudo-male fishes with the genotype of cyp17a1-/-XX, and thus obtaining the pseudo-male parent population in a large scale.

As a further improvement of the present invention, in step S6, the F3 generation male fish accounts for 50% of the total number of the F3 generation population, and the method for screening the F3 generation male fish comprises: in the F3 generation population, the individuals extruded white semen through the abdomen were judged as the F3 generation male fish.

As a further improvement of the invention, the gene editing technology is to specifically cut the fish cyp17a1 gene by using a CRISPR/Cas9 system to realize the editing of the fish cyp17a1 gene.

As a further improvement of the invention, in step S1, the specific process of knocking out cyp17a1 gene in fish by using gene editing technology to obtain F0 generation is as follows:

p1, designing a fish cyp17a1 gene editing target site based on a CRISPR/Cas9 system;

p2, designing a corresponding primer according to the fish cyp17a1 gene editing target site, and synthesizing RNA containing an amplified fragment of the fish cyp17a1 gene editing target site, which is marked as gRNA;

p3, preparing an injection mixture of gRNA and Cas9 mRNA according to a predetermined ratio to obtain an injection mixture edited by the cyp17a1 gene, and performing microinjection of fertilized eggs of fish from the injection mixture edited by the cyp17a1 gene (this step may also be performed to directly obtain a carp homozygous for cyp17a1 in S3 due to the improvement of targeted editing efficiency, and the steps of obtaining a carp 17a1 +/-heterozygote and selfing in S2 and S3 are omitted);

p4, breeding the injected fish fertilized eggs to sexual maturity to obtain F0 generation.

As a further improvement of the invention, the fish cyp17a1 gene editing target site is positioned on the exon 1 of the cyp17a1 gene and is divided into a first target site and a second target site, and the gene sequences of the first target site and the second target site are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2.

As a further improvement of the invention, in step S2, the process for obtaining the F1 generation cyp17a1 heterozygous offspring fish with effective mutation is as follows: carrying out target detection fragment amplification and sequencing on the fish individuals in the F1 generation, detecting the mutation condition in the F1 generation, and screening out the F1 generation with effective mutation; in the detection primers designed by the target detection fragment amplification and sequencing process aiming at F1 generation fish individuals, the sequence of the forward primer is shown as SEQ ID NO.3, and the sequence of the reverse primer is shown as SEQ ID NO. 4.

As a further improvement of the invention, in step P2, in designing a corresponding primer according to the fish cyp17a1 gene editing target site, the sequence of the forward primer of the first target site is shown as SEQ ID NO.5, the sequence of the forward primer of the second target site is shown as SEQ ID NO.6, and the sequence of the universal reverse primer of the first target site and the second target site is shown as SEQ ID NO. 7.

As a further improvement of the invention, in step S4, the pseudo-male fish is a male fish with normal spermary structure and spermatogenesis, but without secondary male sex characteristics (globularis of the gill cover and genital nodules of the pectoral fin); the screening process of the pseudo-male fish comprises the following steps: screening out the cyp17a1 homozygous child fish of XX sex inheritance by means of sex marking.

As a further improvement of the invention, the fish is aquaculture economic fish.

As a further improvement of the invention, the fish is an aquaculture economic fish of male heterogametic genetic determinant (i.e., XX/XY sex genetic determinant).

As a further improvement of the invention, the fish is a carp.

In order to realize the purpose, the invention also provides the application of the breeding method for obtaining the pseudo-male fish parent determined by XX/XY sex in large scale. The breeding method for obtaining the XX/XY sex-determined pseudo-male fish parent in a large scale is applied to the fields of sex-determined breeding of aquaculture economic fish and large-scale breeding of pseudo-male fish parent population.

The invention has the beneficial effects that:

1. the breeding method for obtaining XX/XY sex-determined pseudo-male fish parents in a large scale provided by the invention specifically cuts the Cyp17a1 gene (important sex steroid hormone synthesis pathway catalyzing enzyme coding gene) of fish by utilizing the CRISPR/Cas9 system, blocks the sex steroid hormone synthesis pathway of fish, thereby realizing sex-determined breeding, wherein Cyp17a1 is an important catalyzing enzyme in the sex steroid hormone synthesis process, and catalyzes the process of converting progestogen into androgen and estrogen. By gene editing cyp17a1, levels of estrogen and androgen can be significantly reduced; estrogen levels are reduced, thereby preventing development towards the female, while androgen levels are only associated with the secondary sexual characteristics and reproductive behavior of the male, and thus, development of the testis and spermatogenesis are not affected. By the above principle, the cyp17a1 homozygote can develop into a male fish with normal spermary structure and spermatogenesis, but without secondary male sex characteristics, regardless of whether the sex genotype is XX or XY. Firstly, obtaining effective mutant F1 generation cyp17a1 heterozygous fish, carrying out selfing, screening pseudo male fish of a cyp17a1 homozygote (cyp17a1-/-XX) with an XX sex inheritance type through sex markers, and carrying out hybridization on the pseudo male fish and a heterozygote female fish (cyp17a1+/-XX), so that a pseudo male fish population (cyp17a1-/-XX) with the number accounting for up to 50% can be obtained, and the effect of expanding the number of the pseudo male fish parent population on a large scale is achieved. The breeding method effectively realizes the expanding propagation and simple screening of the number of the pseudo male fish populations, improves the production efficiency and provides more backup parents for subsequently obtaining full female fish.

2. The breeding method for obtaining the pseudo-male fish parent determined by XX/XY sex in large scale has strong applicability, has wide adaptability and expansibility in aquaculture economic fish, and greatly expands the application range of the method in the field of sex determination breeding of aquaculture economic fish and the field of large-scale culture of pseudo-male fish parent population.

3. The breeding method for obtaining the XX/XY sex-determined pseudo-male fish parents in a large scale is beneficial to quickly and accurately obtaining the pseudo-male fish for production practice, establishes a foundation for developing the parthenocarpy breeding work of aquaculture fishes and the research on reproductive development and sex differentiation genetics, and effectively overcomes the technical defects of water body pollution, fish body residue, unstable drug-induced parent fish sex development, limitation to large-scale application and the like caused by combination of gynogenesis and drug treatment; meanwhile, the method for obtaining the pseudo-male fish by heterozygote selfing optimizes the technical difficulties of low pseudo-male fish proportion, complicated identification process and the like.

Drawings

FIG. 1 is a schematic flow chart of a breeding method for obtaining pseudo-male fish parents determined by XX/XY sex in large scale according to the present invention.

FIG. 2 is a schematic diagram of two target sites in exon 1 of cyp17a1 gene provided by the present invention (the yellow labeled sequence is the target site, and the red ATG character is the initiation codon).

FIG. 3 is an agarose gel electrophoresis of synthesized gRNAs at two target sites of cyp17a1 gene provided by the present invention (DNA Marker in the first lane, synthesized gRNAs in lanes 2 and 3).

FIG. 4 is a graph of individual sequencing peaks of cyp17a 1F 1 provided by the invention (upper graph, cyp17a1+/+ is a graph of individual sequencing peaks of a control group, and lower graph, cyp17a1 +/-is a graph of individual sequencing peaks of cyp17a 1F 1 mutation).

FIG. 5 is a sequence comparison chart of cyp17a 1F 2 individuals provided by the invention (cyp17a1+/+ is the detection result of individuals in the control group, cyp17a 1-/-is the detection result of individuals with cyp17a 1F 2 mutations, and red boxes are two target sites).

Fig. 6 is an anatomical diagram of 8-month-old cyp17a1 heterozygote (cyp17a1+/-XX) and a pseudo-male fish (cyp17a1-/-XX) provided by the invention and a gonad section diagram (in fig. 6, a is an anatomical diagram of a female fish heterozygote cyp17a1, a is a gonad section diagram of a female fish heterozygote cyp17a1, B is an anatomical diagram of a pseudo-male fish in fig. 6, and B is a gonad section diagram of a pseudo-male fish in fig. 6).

FIG. 7 shows the genetic scheme (including actual proportions) of hybridization between the cyp17a1 heterozygote (cyp17a1+/-XX) and the pseudo-male fish (cyp17a1-/-XX) provided by the invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be described in detail with reference to the accompanying drawings and specific embodiments.

It should be noted that, in order to avoid obscuring the present invention with unnecessary details, only the structures and/or processing steps closely related to the aspects of the present invention are shown in the drawings, and other details not closely related to the present invention are omitted.

In addition, it is also to be noted that the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.

Referring to fig. 1, the present invention provides a breeding method for obtaining pseudo-male fish parents determined by XX/XY sex in large scale, comprising the following steps:

s4, screening and obtaining cyp17a1 homozygous son fish of the XX sex genotype in the F2 generation, wherein the carp is expressed as a physiological male and is marked as a pseudo-male fish, and the genotype is cyp17a 1-/-XX;

s6, obtaining pseudo-male fish parent populations in F3 generations of high pseudo-male populations after artificial induced spawning and insemination, wherein all male fishes are pseudo-male fishes with genotypes of cyp17a1-/-XX, and thus obtaining the pseudo-male fish parent populations in a large scale.

Preferably, in step S6, the F3 generation male fish accounts for 50% of the total number of the F3 generation fish, and the method for screening the F3 generation male fish comprises: the fish in the F3 generation was judged to be male fish in the F3 generation by squeezing white semen through the abdomen.

Preferably, the gene editing technology is to specifically cut the fish cyp17a1 gene by using a CRISPR/Cas9 system to realize the editing of the fish cyp17a1 gene.

Preferably, in step S1, the specific process of knocking out cyp17a1 gene in fish by using gene editing technology to obtain F0 generation is as follows:

p3, preparing an injection mixture of gRNA and Cas9 mRNA according to a preset proportion to obtain an injection mixture edited by the cyp17a1 gene, and performing microinjection on the injection mixture edited by the cyp17a1 gene to fertilized fish eggs.

Preferably, the fish cyp17a1 gene editing target site is located on the exon 1 of the cyp17a1 gene and is divided into a first target site and a second target site, and the gene sequences of the first target site and the second target site are respectively shown as SEQ ID No.1 and SEQ ID No. 2.

Preferably, in step S2, the process for obtaining the efficiently mutated F1 generation cyp17a1 heterozygous offspring fish is: carrying out target detection fragment amplification and sequencing on the fish individuals in the F1 generation, detecting the mutation condition of the F1 generation, and screening out the effective mutated F1 generation; in the detection primers designed by the target detection fragment amplification and sequencing process aiming at F1 generation fish individuals, the sequence of the forward primer is shown as SEQ ID NO.3, and the sequence of the reverse primer is shown as SEQ ID NO. 4.

Preferably, in step P2, in designing a corresponding primer according to the fish cyp17a1 gene editing target site, the sequence of the forward primer of the first target site is shown as SEQ ID No.5, the sequence of the forward primer of the second target site is shown as SEQ ID No.6, and the sequence of the universal reverse primer of the first target site and the second target site is shown as SEQ ID No. 7.

Preferably, in step S4, the pseudo-male fish is a male fish with normal spermary structure and spermatogenesis, but without secondary sex characteristics of males; the screening process of the pseudo-male fish comprises the following steps: screening out the cyp17a1 homozygous child fish of XX sex inheritance by means of sex marking.

Preferably, the fish is an aquaculture economic fish.

Preferably, the fish is an aquaculture economic fish of male heterozygosis genetic determinant (XX/XY sex genetic determinant).

Preferably, the fish is a carp.

Example 1

The embodiment 1 of the invention provides a breeding method for obtaining pseudo-male fish parents determined by XX/XY sex in a large scale, which comprises the following steps:

s1, obtaining an injection mixture edited by the cyp17a1 gene, injecting the injection mixture into the embryo of the fish, knocking out the cyp17a1 gene in the fish by using a gene editing technology, and obtaining an F0 generation;

s11, searching for a cyp17a1 gene editing target site by using an http:// ZiFiT. paratners. org/ZiFiT/Disclearmer. aspx online tool, wherein the gene target site is positioned on the exon 1 of the cyp17a1 gene and is divided into a first target site and a second target site, and the sequences of the first target site and the second target site are TGGCTTTTCTGTTCATGCC and CCAAGCCTCCCATCACTCCC (as shown in SEQ ID NO.1, SEQ ID NO.2 and the sequence marked in FIG. 2);

s12, designing corresponding primers according to the fish cyp17a1 gene editing target site (as shown in Table 1, the sequence of the forward primer of the first target site is shown as SEQ ID NO.5, the sequence of the forward primer of the second target site is shown as SEQ ID NO.6, and the sequence of the universal reverse primer of the first target site and the second target site is shown as SEQ ID NO. 7). By using the primer, pUC19-gRNA-scaffold plasmid is used as a template to synthesize an amplified fragment containing the fish cyp17a1 gene editing target site, and RNA is synthesized and is marked as gRNA1 and gRNA 2; the method specifically comprises the following steps: synthesizing gRNAs containing the 2 cyp17a1 target sites by using a TranscriptAId T7 high yield Transcription Kit of Thermo company, respectively marking as gRNA1 and gRNA2, detecting by running agarose gel after synthesis (as shown in figure 3), measuring the concentration, diluting to 500 ng/mu L, and placing at-80 ℃ for later use;

table 1 shows primers for gRNA1 and gRNA2 as target sites for synthesizing cyp17a1

S13, Cas9 mRNA is transcribed from the pXT7-Cas9 vector, specifically: cas 9-capped mRNA was synthesized using the Invitrogen mMESSAGE mMACHINE mRNA transcription synthesis kit. After the concentration is measured, the solution is diluted to 500 ng/mu L and is placed at minus 80 ℃ for standby;

s14, formulating an injection mixture of gRNA and Cas9 mRNA, formulation ratios such as shown in table 2;

table 2 shows the injection mixture of gRNA and Cas9 mRNA

Sample (I)	Volume (μ L)
		gRNA1(500ng/μL)	2
gRNA2(500ng/μL)	2
		Cas9 mRNA	4
Water (W)	2
		In total	10

S15, injecting the mixture edited by the cyp17a1 gene into 1-or 2-cell carp embryos by using a microinjector, wherein the injection volume is 1.0 nL;

s16, raising the injected fish eggs to sexual maturity to obtain F0 generation, specifically cutting the cyp17a1 gene to edit the cyp17a1 gene, and inactivating the cyp17a1 gene on the F0 generation due to mutation to cause the final function loss.

S2, artificially inseminating male carps of the F0 generation and wild female carps after induced spawning by using compound chorionic gonadotrophin B for injection, hybridizing to obtain F1 generation, carrying out PCR on genomes of the F1 generation, and detecting the mutation condition of filial generation, wherein the primer sequences are shown in Table 3 (the sequence of a forward primer is shown as SEQ ID No.3, and the sequence of a reverse primer is shown as SEQ ID No. 4); a significantly mutated F1 generation cyp17a1 heterozygous fish with the genotype cyp17a1 +/-was obtained and the sequencing resulted in the generation of a double peak starting at the first target (as shown in FIG. 4).

Table 3 shows target point mutation detection primers of cyp17a1

And S3, selfing the F1 generation cyp17a1 heterozygous daughter fish containing the effective mutation to obtain F2 generation.

S4, in the F2 generation, heterozygote female fish (cyp17a1+/-XX) and pseudo male fish (cyp17a1-/-XX) are obtained by screening.

Referring to FIG. 6, after the individuals of cyp17a1-/-XX and cyp17a1+/-XX in the F2 generation were subjected to dissection and gonad section analysis, respectively, the individuals of cyp17a1-/-XX showed obvious spermary structure and spermatogenesis, and they were found to have obviously developed into male fish; while clear follicular structures were seen in individuals cyp17a1 +/-XX.

S5, carrying out artificial induced spawning and insemination on heterozygote female fish with the genotype of cyp17a1+/-XX obtained in the step S4 and the pseudo male fish with the genotype of cyp17a 1-/-XX.

S6, breeding F3 generation population obtained after artificial induced spawning and insemination to 8 months of age, as shown in figure 7, all F3 generation male fishes are pseudo male fishes with genotypes of cyp17a1-/-XX, the theoretical amount accounts for 50%, and the actual statistics is 48.1%. Thus, a large scale increase of the population number of pseudo-male parents for the production of all-female fish is achieved.

It should be noted that, as will be understood by those skilled in the art, the female heterozygote fish (cyp17a1+/-XX) in the above step S5 can also be obtained from the heterozygote fish of the F1 generation cyp17a1, which is effectively hybridized with the pseudo-male fish (cyp17a1-/-XX), without limitation.

Comparative example 1

Selecting cyp17a1 +/-heterozygote carp to self-copulate as a control group, and carrying out statistics on the number and proportion of individuals of each genotype of genetic separation. As shown in Table 4, the ratio of the pseudo-male carp cyp17a1-/-XX in the selfed progeny of heterozygous carp of carp with the F2 generation sample group 1 and the F2 generation sample group 2, cyp17a1+/-XX is only 14% (italics and bold numbers in Table 4) through experimental data statistics of 2 years.

Table 4 shows the number and ratio of individuals of each genotype in the selfed progeny (F2) of the cyp17a1 heterozygote

Referring to fig. 7, when the heterozygous carp with cyp17a1+/-XX provided in example 1 is hybridized with the pseudo-male carp with the genotype of cyp17a1-/-XX, the ratio of the pseudo-male carp in offspring, cyp17a1-/-XX, can be increased to about 50%, and the selection is convenient, and the individual who can extrude white semen through the abdomen in the offspring group is judged to be the pseudo-male carp. Compared with the traditional cyp17a1 +/-heterozygote selfing method provided by the comparative example 1, the breeding method provided by the invention is more convenient and stable, and the pseudo-male fish parents can be obtained in a large scale.

It should be noted that the skilled person will understand that the method provided by the present invention is not only suitable for breeding diploid carps in example 1, but also for breeding of other ploidy XX/XY sex-determined economical fish for aquaculture.

It should be noted that, in other embodiments, the gene encoding the catalytic enzyme of the sex steroid hormone synthesis pathway may be one of other key catalytic enzyme encoding genes such as cyp19a1 and hsd17b, and the gene encoding gene is knocked out by gene editing technology, so that the function of blocking the sex steroid hormone synthesis pathway of fish can be achieved.

In conclusion, the invention provides a breeding method for obtaining pseudo-male fish parents determined by XX/XY sex in large scale and application thereof. According to the method, by utilizing a CRISPR/Cas9 system to specifically cut a cyp17a1 gene of fish, an F1 generation cyp17a1 heterozygous fish with effective mutation is obtained, selfing is carried out, a pseudo male fish of a cyp17a1 homozygote (cyp17a1-/-XX) with an XX sex inheritance type is screened out through a sex marker, or a pseudo male fish of a cyp17a1 homozygote (cyp17a1-/-XX) with an XX sex inheritance type screened out through the sex marker is directly obtained by improving the working efficiency of the CRISPR/Cas9 system, and is hybridized with a heterozygote female fish (cyp17a1+/-XX), a pseudo male fish population (cyp17a1-/-XX) with the number accounting for up to 50% can be obtained, and the effect of large-scale expansion of the number of the pseudo male fish parent is achieved. Compared with the traditional method, the experiment shows that the ratio of the pseudo-male fish population provided by the invention is far higher than that of a control experiment group, the number of the pseudo-male fish population is effectively expanded and the pseudo-male fish population is simply screened, the production efficiency is improved, and more backup parents are provided for obtaining full female fish subsequently. The method provided by the invention has strong applicability, has wide adaptability and expansibility in the aquaculture economic fish, and greatly expands the application range of the method in the field of sex determination breeding of the aquaculture economic fish.

Although the present invention has been described in detail with reference to the preferred embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the spirit and scope of the present invention.

SEQ ID NO.1

TGGCTTTTCTGTTCATGCC

SEQ ID NO.2

CCAAGCCTCCCATCACTCCC

SEQ ID NO.3

CCGATGACACTTAGATAGTTG

SEQ ID NO.4

CATGTTGGCTGCAGTGATACTC

SEQ ID NO.5

TAATACGACTCACTATAGGGCATGAACAGAAAAGCCAGTTTTAGA GCTAGAAATAGC

SEQ ID NO.6

TAATACGACTCACTATAGGGGAGTGATGGGAGGCTTGGGTTTTAG AGCTAGAAATAGC

SEQ ID NO.7

AGCACCGACTCGGTGCCACT。

Sequence listing

<110> institute of aquatic organisms of Chinese academy of sciences

<120> breeding method for obtaining pseudo male fish parent determined by XX/XY sex in large scale and application

<141> 2021-03-15

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tggcttttct gttcatgcc 19

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ccaagcctcc catcactccc 20

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccgatgacac ttagatagtt g 21

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

catgttggct gcagtgatac tc 22

<210> 5

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

taatacgact cactataggg catgaacaga aaagccagtt ttagagctag aaatagc 57

<210> 6

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

taatacgact cactataggg gagtgatggg aggcttgggt tttagagcta gaaatagc 58

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

agcaccgact cggtgccact 20

Claims

1. A breeding method for obtaining pseudo-male fish parents determined by XX/XY sex in large scale is characterized in that: the breeding method for obtaining pseudo-male fish parents determined by XX/XY sex in large scale comprises the steps of knocking out catalytic enzyme encoding genes of sex steroid hormone synthetic pathways of fishes by adopting a gene editing technology, blocking the sex steroid hormone synthetic pathways of the fishes, screening to obtain heterozygote female fishes with effective mutation and pseudo-male fishes with XX sex hereditary types, and hybridizing the pseudo-male fishes and the heterozygote female fishes to obtain a high pseudo-male population and enlarge the number of the pseudo-male parent population in large scale.

2. The breeding method for obtaining pseudo-male fish parents of XX/XY sex determination in large scale according to claim 1, wherein: the gene encoding the catalytic enzyme of the sex steroid hormone synthesis pathway comprises but is not limited to one of a gene encoding cyp17a1 catalytic enzyme, a gene encoding cyp19a1 catalytic enzyme, and a gene encoding hsd17b catalytic enzyme.

3. A breeding method for obtaining pseudo-male fish parents of XX/XY sex determination on a large scale according to claim 2, characterized in that: the method comprises the following steps:

s4, screening male-marker-free cyp17a1 homozygous fish of the XX sex genotype, which are expressed as physiological males, and are marked as pseudo-males, in the F2 generation, wherein the genotype is cyp17a 1-/-XX;

4. The breeding method for obtaining XX/XY sex-determined pseudo-male fish parents in large scale according to claim 3, characterized in that: in step S6, the F3 generation male fish accounts for 50% of the total number of the F3 generation population, and the screening method of the F3 generation male fish is as follows: in the F3 generation population, the individuals extruded white semen through the abdomen were judged as the F3 generation male fish.

5. A breeding method for obtaining pseudo-male fish parents of XX/XY sex determination in large scale according to claim 3, characterized in that: the gene editing technology is used for specifically cutting fish cyp17a1 gene by using a CRISPR/Cas9 system, so that the fish cyp17a1 gene is knocked out.

6. A breeding method for obtaining pseudo-male fish parents of XX/XY sex determination in large scale according to claim 5, characterized in that: in step S1, the specific process of knocking out cyp17a1 gene in fish using gene editing technology to obtain F0 generation is as follows:

p3, preparing an injection mixture of gRNA and Cas9 mRNA according to a preset proportion to obtain an injection mixture edited by the cyp17a1 gene, and performing microinjection on the injection mixture edited by the cyp17a1 gene to obtain fertilized fish eggs;

7. The breeding method for obtaining pseudo-male fish parents of XX/XY sex determination on a large scale according to claim 5, characterized in that: the fish cyp17a1 gene editing target site is positioned on the exon 1 of the cyp17a1 gene and is divided into a first target site and a second target site, and the gene sequences of the first target site and the second target site are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2.

8. The breeding method for obtaining XX/XY sex-determined pseudo-male fish parents in large scale according to claim 3, characterized in that: in step S2, the process of obtaining the efficiently mutated F1 generation cyp17a1 heterozygous offspring fish is: carrying out target detection fragment amplification and sequencing on the fish individuals in the F1 generation, detecting the mutation condition of the F1 generation, and screening out the effective mutated F1 generation; in the detection primers designed by the target detection fragment amplification and sequencing process aiming at F1 generation fish individuals, the sequence of the forward primer is shown as SEQ ID NO.3, and the sequence of the reverse primer is shown as SEQ ID NO. 4.

9. The breeding method for obtaining pseudo-male fish parents of XX/XY sex determination on a large scale according to claim 5, characterized in that: in step P2, in designing corresponding primers according to the fish cyp17a1 gene editing target site, the sequence of the forward primer of the first target site is shown as SEQ ID NO.5, the sequence of the forward primer of the second target site is shown as SEQ ID NO.6, and the sequence of the universal reverse primer of the first target site and the second target site is shown as SEQ ID NO. 7.

10. The breeding method for obtaining XX/XY sex-determined pseudo-male fish parents in large scale according to claim 3, characterized in that: in step S4, the pseudo-male fish is a male fish with normal spermary structure and spermatogenesis, but without secondary sex characteristics of males; the screening process of the pseudo-male fish comprises the following steps: screening out the cyp17a1 homozygous child fish of XX sex inheritance by means of sex marking.

11. The breeding method for obtaining pseudo-male fish parents of XX/XY sex determination on a large scale according to claim 1, characterized in that: the fish is a male heterotopic genetic determinant and is an aquaculture economic fish.

12. The method for realizing fish sex control breeding according to claim 8, wherein the method comprises the following steps: the fish is Cyprinus Carpio.

13. Use of a breeding method for the large-scale acquisition of XX/XY sex-determined pseudo-male fish parents according to any one of claims 1 to 12, characterized in that: the breeding method for obtaining the XX/XY sex-determined pseudo-male fish parent in a large scale is applied to the fields of sex-determined breeding of aquaculture economic fish and large-scale breeding of pseudo-male fish parent population.