CN113817742A

CN113817742A - Aptamer combined with catalase and application

Info

Publication number: CN113817742A
Application number: CN202110969990.XA
Authority: CN
Inventors: 杜军; 王存理; 曹文刚; 吴慧
Original assignee: Hubei Qingke Biotechnology Co ltd; Tsingke Biotechnology Co Ltd
Current assignee: Hubei Qingke Biotechnology Co ltd; Tsingke Biotechnology Co Ltd
Priority date: 2021-08-23
Filing date: 2021-08-23
Publication date: 2021-12-21

Abstract

The invention discloses a nucleic acid aptamer combined with catalase, which is selected from any one or more of nucleic acid aptamers with sequences shown as SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO. 3. The invention also discloses a creatinine detection kit comprising the nucleic acid aptamer combined with catalase. The invention also discloses a creatinine detection method for non-diagnosis purposes.

Description

Aptamer combined with catalase and application

Technical Field

The invention relates to the technical field of clinical examination, in particular to a nucleic acid aptamer combined with catalase and application thereof.

Background

Aptamer (Aptamer) is a structured oligonucleotide sequence (DNA or RNA) obtained by using in vitro screening technology-index enrichment ligand phylogenetic evolution technology (SELEX), and has specific recognition capability and high affinity capability for corresponding target molecules (proteins, viruses, bacteria, cells, drugs and the like).

Creatinine of the formula C₄H₇N₃O, an end product of creatine metabolism in the human body, is mainly removed from the body by glomerular filtration. Serum creatinine is an effective index for evaluating the glomerular filtration function, and is commonly used in clinical indications for renal function monitoring and dialysis treatment of patients with renal failure. The main clinical detection methods of creatinine are a picric acid method and a sarcosine oxidase method, the picric acid method is gradually eliminated due to toxicity, poor interference resistance, instability and the like, and the sarcosine oxidase method gradually takes a leading position in clinical detection due to good accuracy, linearity, stability and the like.

The creatine oxidase method for measuring creatinine is the most widely used method for detecting creatinine in clinic at present, and the principle is that firstly, sarcosine oxidase and creatine amidinate hydrolase are used to convert endogenous creatine into a substance which cannot be catalyzed by creatinine enzyme in the first step, and H is generated at the same time₂O₂The second step, converting creatinine in the sample into creatine by creatinase, and generating H by creatine through catalytic reaction of sarcosine oxidase and creatine amidinohydrolase₂O₂While the second reagent is supplemented with a catalase inhibitor (usually 0.1% sodium azide), the reaction then produces H₂O₂Is not decomposable and can be quantified using the trinder's reaction to indirectly derive the concentration of creatinine in the sample. However, sodium azide is a highly toxic substance, and therefore, has a safety problem and causes inconvenience in detection.

Disclosure of Invention

In view of the above, it is necessary to provide an aptamer binding to catalase and use thereof, aiming at the problem of selection of a catalase inhibitor in the measurement of creatinine by the sarcosine oxidase method.

A nucleic acid aptamer capable of binding catalase, which is selected from any one or more of nucleic acid aptamers with sequences shown as SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO. 6.

A creatinine assay kit comprising the nucleic acid aptamer that binds catalase.

In one embodiment, the kit comprises an R1 reagent for transforming endogenous creatine, the R1 reagent comprising catalase.

In one embodiment, the kit further comprises a R2 reagent for converting creatinine, the R2 reagent comprising the nucleic acid aptamer that binds catalase of claim 1; preferably, the concentration of the catalase-binding aptamer in the R2 reagent is 1 to 100nmol/L, preferably 5 to 20 nmol/L.

In one embodiment, the kit further comprises a calcium dobesilate-binding interference reagent, preferably, the calcium dobesilate-binding interference reagent is selected from any one or more of the calcium dobesilate-binding aptamers as represented by SEQ ID No.1, SEQ ID No.2 or SEQ ID No. 3; more preferably, the calcium dobesilate inhibitor is present in the R1 reagent or the R2 reagent alone or in both the R1 reagent and the R2 reagent.

In one embodiment, the concentration of the calcium dobesilate-binding aptamer in the R1 reagent or R2 reagent is 1nmol/L to 100nmol/L, preferably 5nmol/L to 20 nmol/L.

In one embodiment, the kit comprises R1 reagent and R2 reagent, the R1 reagent comprises sarcosine oxidase, creatine amidinohydrolase, calcium dobesilate-binding aptamer selected from the group consisting of any of SEQ ID No.1, SEQ ID No.2 or SEQ ID No.3, and the catalase, the R2 reagent comprises creatininase, 4-AA, peroxidase, and the catalase-binding aptamer of claim 1.

In one embodiment, the kit comprises R1 reagent and R2 reagent, the R1 reagent comprises sarcosine oxidase, creatine amidinohydrolase and the catalase, the R2 reagent comprises creatininase, 4-AA, peroxidase and the catalase-binding aptamer of claim 1 and the calcium dobesilate-binding aptamer selected from the group consisting of the sequences set forth in any of SEQ ID No.1, SEQ ID No.2 or SEQ ID No. 3.

In one embodiment, the kit comprises R1 reagent and R2 reagent, the R1 reagent comprising sarcosine oxidase, creatine amidinohydrolase, calcium dobesilate-binding aptamer selected from the group consisting of any of SEQ ID No.1, SEQ ID No.2 or SEQ ID No.3, and the catalase, and the R2 reagent comprising creatininase, 4-AA, peroxidase, and catalase-binding aptamer of claim 1, and calcium dobesilate-binding aptamer selected from the group consisting of any of SEQ ID No.1, SEQ ID No.2 or SEQ ID No. 3.

In one embodiment, each component of the R1 and R2 reagents can be present in separate packages or as a mixture of reagents.

In one embodiment, the kit further comprises any one or more of a preservative, a surfactant, a nuclease inhibitor, and ascorbate oxidase.

A method for detecting creatinine for non-diagnostic purposes comprising the steps of:

a. reacting a reagent containing sarcosine oxidase, creatine amidinohydrolase and catalase with a test sample to convert endogenous creatine in the test sample into a substance not catalyzed by creatinine enzyme, and generating H₂O₂Decomposing;

b. reacting a reagent containing creatininase and a catalase inhibitor with the detection sample mixture obtained in the step a, wherein the catalase inhibitor is selected from any one or more of nucleic acid aptamers capable of combining catalase and having the sequence shown as SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO. 6;

c. for H obtained in step b₂O₂And (5) carrying out quantitative detection.

In one embodiment, the method further comprises the following steps: adding one or more aptamer binding with calcium dobesilate selected from any one of the sequences shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 into the reactant in the step a and/or the step b.

The inventors screened three RNA sequences with excellent affinity for catalase: GGUCAAACCACACUUUGCCCCGCCCGCCGAUAC (SEQ ID NO. 4); GUGUGUCCCAAGGGGGGGGGACCCCAACACACU (SEQ ID NO. 5); GUUUAUAUCGCGCGACAAAGACCCG (SEQ ID NO. 6).

The inventor also finds that any one, any two or three of the three sequences can be used for detecting creatinine by a sarcosine oxidase method, and the nucleic acid aptamer combined with catalase is used in a detection reagent, so that the detection result shows that the nucleic acid aptamer has extremely strong catalase activity inhibition effect, can perfectly replace sodium azide, and can improve the detection accuracy and safety of creatinine.

Detailed Description

In order that the invention may be more fully understood, reference will now be made to the following description. The present invention may be embodied in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

Other than as shown in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients, physical and chemical properties, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about". Accordingly, unless indicated to the contrary, the numerical parameters set forth in the foregoing specification and attached claims are approximations that can be suitably varied by those skilled in the art in seeking to obtain the desired properties utilizing the teachings disclosed herein. The use of numerical ranges by endpoints includes all numbers within that range and any range within that range, for example, 1 to 5 includes 1, 1.1, 1.3, 1.5, 2, 2.75, 3, 3.80, 4, and 5, and the like.

The embodiment of the invention provides a nucleic acid aptamer capable of combining catalase, which is selected from any one or more of nucleic acid aptamers with sequences shown as SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO. 6.

The embodiment of the invention also provides a creatinine detection kit, which comprises one or more nucleic acid aptamers capable of combining with catalase and selected from any one of the sequences shown as SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO. 6.

In some embodiments, the kit comprises sarcosine oxidase, creatine amidinohydrolase, catalase, and creatinine.

Calcium dobesilate is a microvascular protectant and is widely applied to treatment of diabetes mellitus complicated with fundus oculi lesions. The drug exists in the human body as a basic prototype and is excreted via the kidneys and the intestinal tract. The amount and change of the drug concentration of the calcium dobesilate tablet in vivo are as follows: the product is orally taken by 500mg for healthy men, and the blood concentration reaches the peak value after about 4 hours, and the peak concentration is about 13 mu g/ml. The blood-brain barrier-free plasma protein has wide distribution in tissues, has a binding rate of 20-25% with plasma protein, and cannot penetrate the blood-brain barrier. Calcium dobesilate tablets are excreted mainly in the urine as they are, and about 50% of them are excreted in the urine within 24 hours after oral administration, of which only 10% are metabolites. 5 minutes after the intravenous administration of 500mg of the product, the blood concentration reaches the peak, and the peak concentration is 65 mug/ml. Approximately 75% is excreted in urine within 24 hours after the intravenous injection. The pharmacokinetic profile of the two-compartment model was consistent with a 4.1 hour beta cancellation half-life. In recent years, more and more clinical researches show that calcium dobesilate has serious negative interference on creatinine detection by a creatinine detection kit of a sarcosine oxidase method. The principle of detecting creatinine by using the calcium dobesilate interference creatinine detection kit by the sarcosine oxidase method has been studied by some scholars, but no exact interference mechanism is found at present due to the complex principle.

In some embodiments, the kit further comprises any one or more of the calcium dobesilate-binding aptamers selected from the group consisting of the nucleic acid aptamers having a sequence as shown in SEQ ID No.1, SEQ ID No.2, or SEQ ID No. 3.

The inventors screened three RNA sequences with excellent affinity for calcium dobesilate: AGCUUUUUGACCCAGAGAGUGAAAACC (SEQ ID NO.1), UUGCAAAAACCUGUGUGUGUGUUUUCC (SEQ ID NO.2), UUUUGGUGUGUACACACCCCCAAACUGUGUGU (SEQ ID NO. 3).

The inventor also finds that any one, any two or three of the three sequences can be used for detecting creatinine by a sarcosine oxidase method, and the detection result shows that the performance of resisting the interference of calcium dobesilate is unexpectedly good by using the aptamer combined with the calcium dobesilate in a detection reagent, and the aptamer still has excellent resistance to the calcium dobesilate which is up to 70 mu g/ml in a detection sample, so that the detection accuracy of the creatinine can be improved.

The aptamer combined with calcium dobesilate can be applied to creatinine detection kits of a sarcosine oxidase method and other kits with obvious interference on detection by calcium dobesilate, such as NEFA, UA and the like, and is also in the protection scope of the invention.

In some embodiments, the kit further comprises a hydrogen peroxide detection reagent. The hydrogen peroxide detection can be carried out by Trinder reaction, also called coupled end point colorimetry, which is based on hydrogen peroxide (H) generated by enzyme action of a detected substance₂O₂) In the presence of 4-aminoantipyrine (4-AA) and Peroxidase (POD), a red quinoneimine compound can be produced. The hydrogen peroxide detection reagent may include 4-AA and Peroxidase (POD).

In some embodiments, the kit further comprises a nuclease inhibitor. Nuclease inhibitors are degraded with aptamers. The nuclease inhibitor may be selected from DECP.

In some embodiments, the kit further comprises ascorbate oxidase to avoid the effect of ascorbic acid on hydrogen peroxide detection.

In some embodiments, the kit further comprises a preservative. The preservative may be neomycin sulfate and/or polyhexamine B.

The reagents in the kit can be separately packaged or divided into at least two parts according to the detection principle of creatinine.

The embodiment of the invention also provides a creatinine detection kit by a sarcosine oxidase method, which comprises an R1 reagent for converting endogenous creatine, wherein the R1 reagent comprises catalase.

In some embodiments, the kit further comprises a R2 reagent for converting creatinine, the R2 reagent comprising the nucleic acid aptamer that binds catalase.

In some embodiments, the kit comprises a calcium dobesilate interference agent. Preferably, the calcium dobesilate interference reagent is selected from any one or more of calcium dobesilate-binding aptamers of a sequence as shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3, the calcium dobesilate interference reagent is present in the R1 reagent or the R2 reagent alone or in both the R1 reagent and the R2 reagent

In some embodiments, the concentration of the aptamer binding to calcium dobesilate in the R1 reagent or R2 reagent is 1nmol/L to 100nmol/L, specifically 1nmol/L, 5nmol/L, 10nmol/L, 20nmol/L, 30nmol/L, 40nmol/L, 50nmol/L, 60nmol/L, 70nmol/L, 80nmol/L, 90nmol/L, 100 nmol/L. Preferably 5nmol/L to 20 nmol/L.

In a specific embodiment, the kit comprises R1 reagent and R2 reagent, the R1 reagent comprises sarcosine oxidase, creatine amidinohydrolase, calcium dobesilate-binding aptamer selected from the group consisting of any of SEQ ID No.1, SEQ ID No.2 or SEQ ID No.3, and the catalase, and the R2 reagent comprises creatininase, 4-AA, peroxidase, and catalase-binding aptamer selected from any one or more of the group consisting of SEQ ID No.4, SEQ ID No.5 or SEQ ID No. 6.

In a specific embodiment, the kit comprises R1 reagent and R2 reagent, the R1 reagent comprises sarcosine oxidase, creatine amidinohydrolase and the catalase, the R2 reagent comprises creatininase, 4-AA, peroxidase and a catalase-binding aptamer selected from any one or more of the sequences set forth in SEQ ID No.4, SEQ ID No.5 or SEQ ID No.6 and a calcium dobesilate-binding aptamer selected from any one of the sequences set forth in SEQ ID No.1, SEQ ID No.2 or SEQ ID No. 3.

In a specific embodiment, the kit comprises R1 reagent and R2 reagent, the R1 reagent comprises sarcosine oxidase, creatine amidinohydrolase, a calcium dobesilate-binding aptamer selected from the group consisting of any of SEQ ID No.1, SEQ ID No.2 or SEQ ID No.3, and the catalase and catalase, and the R2 reagent comprises creatininase, 4-AA, peroxidase, and a catalase-binding aptamer selected from any one or more of the group consisting of SEQ ID No.4, SEQ ID No.5 or SEQ ID No.6, and a calcium dobesilate-binding aptamer selected from the group consisting of any of SEQ ID No.1, SEQ ID No.2 or SEQ ID No. 3.

In some embodiments, the kit further comprises any one or more of a preservative, a surfactant, a nuclease inhibitor, and an ascorbate oxidase. These reagents are present in the R1 reagent or the R2 reagent alone or in both the R1 reagent and the R2 reagent.

In some embodiments, the sarcosine oxidase is present in the R1 reagent at a concentration of 5KU/L to 400 KU/L. Specifically, the concentration of sarcosine oxidase in the R1 reagent is 5KU/L, 10KU/L, 50KU/L, 100KU/L, 150KU/L, 200KU/L, 250KU/L, 300KU/L, 350KU/L, or 400 KU/L. Preferably, the concentration of sarcosine oxidase in the R1 reagent is 10KU/L to 30KU/L, and specifically, may be 10KU/L, 15KU/L, 20KU/L, 25KU/L or 30 KU/L.

In some embodiments, the creatine amidinohydrolase is present in the R1 reagent at a concentration of 5 to 400 KU/L. Specifically, the creatine amidinohydrolase is present in the R1 reagent at a concentration of 5KU/L, 10KU/L, 50KU/L, 100KU/L, 150KU/L, 200KU/L, 250KU/L, 300KU/L, 350KU/L, or 400 KU/L. Preferably, the concentration of creatine amidinohydrolase in the reagent R1 is 10KU/L to 30KU/L, and more specifically, it may be 10KU/L, 15KU/L, 20KU/L, 25KU/L or 30 KU/L.

In some embodiments, the catalase concentration is at a concentration of 100KU/L to 800KU/L in the R1 reagent.

In some embodiments, HPEPS buffer is included in reagent R1 at a concentration of 10mmol/L to 500mmol/L, e.g., 10mmol/L, 50mmol/L, 100mmol/L, 150mmol/L, 200mmol/L, 250mmol/L, 300mmol/L, 350mmol/L, 400mmol/L, 450mmol/L, 500 mmol/L. Preferably 50mmol/L to 100 mmol/L.

In some embodiments, trinder's reagent is included in the R1 reagent. Trinder's reagent may be specifically selected from TOOS. The concentration of the compound in the R1 reagent can be 0.1 mmol/L-20 mmol/L, preferably 1 mmol/L-5 mmol/L.

In some embodiments, a surfactant is included in the R1 reagent. The concentration thereof in the R1 reagent may be 0.01g/L to 10g/L, preferably 0.1g/L to 2 g/L. The surfactant may be a cholate. Sodium cholate is preferred.

In some embodiments, the concentration of the catalase-binding aptamer in the R2 reagent is 1nmol/L to 100nmol/L, specifically 1nmol/L, 5nmol/L, 10nmol/L, 20nmol/L, 30nmol/L, 40nmol/L, 50nmol/L, 60nmol/L, 70nmol/L, 80nmol/L, 90nmol/L, 100 nmol/L. Preferably 5nmol/L to 20 nmol/L.

In some embodiments, the concentration of the creatinine enzyme in the R2 reagent is between 10KU/L and 900 KU/L.

In some embodiments, a hydrogen peroxide detection reagent is included in the R2 reagent. The hydrogen peroxide detection reagent may include 4-AA and Peroxidase (POD). The concentration of 4-AA in the R2 reagent can be 0.1-20 mmol/L, preferably 1-5 mmol/L. The concentration of the peroxidase in the reagent R2 may be 1KU/L to 200KU/L, preferably 5KU/L to 20 KU/L.

The embodiment of the invention also provides a creatinine detection method with non-diagnosis purpose, which comprises the following steps:

a. reacting sarcosine oxidase, creatine amidinohydrolase and catalase with the test sample to convert endogenous creatine in the test sample to a substance not catalyzed by creatinine enzyme, and generating H₂O₂Is decomposed;

b. reacting creatininase and a catalase inhibitor with the detection sample mixture obtained in the step a, wherein the catalase inhibitor is selected from any one or more of nucleic acid aptamers capable of combining catalase and having the sequence shown as SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO. 6;

c. for H obtained in step b₂O₂Carrying out quantitative detection;

in some embodiments, further comprising: adding one or more aptamer binding with calcium dobesilate selected from any one of the sequences shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 into the reactant in the step a and/or the step b.

The creatinine detection method for non-diagnosis purposes can directly adopt the creatinine detection kit of the sarcosine oxidase method in any embodiment.

The following are specific examples.

1. Kit formulation design for different embodiments

Each example reagent was prepared using the formulation shown in table 1 (wherein √ indicates that the example contains the corresponding component and x indicates that it does not).

AGCUUUUUGACCCAGAGAGUGAAAACC(SEQ ID NO.1)；

UUGCAAAAACCUGUGUGUGUGUUUUCC(SEQ ID NO.2)；

UUUUGGUGUGUACACACCCCCAAACUGUGUGU(SEQ ID NO.3)；

GGUCAAACCACACUUUGCCCCGCCCGCCGAUAC(SEQ ID NO.4)；

GUGUGUCCCAAGGGGGGGGGACCCCAACACACU(SEQ ID NO.5)；

GUUUAUAUCGCGCGACAAAGACCCG(SEQ ID NO.6)。

TABLE 1 reagent formulations for the different examples

2. Interference of nucleic acid aptamers with detection

40 normal human serum samples were collected to ensure that the samples were free of significant hemolysis, turbidity and jaundice.

On Hitachi 7180, 12 test channels were set according to the parameters in Table 2, the first of which was a commercial on-the-market reagent, and the remainder were reagent channels from examples 1-11. After the reagent is placed, calibrating the 12 channels by using the Landau composite calibrator, testing by using the Landau composite quality control after calibration, and performing subsequent operation when the creatinine detection result is in time control.

TABLE 2 kit analysis methods and test parameters

The collected 40 samples were simultaneously examined using the above 12 channels, and the results (in. mu. mol/L) are shown in Table 3.

R in Table 3²A and b are parameters of a fitted curve of the detection result of the embodiment and the detection result of the commercial reagent, R²Is the square of the correlation coefficient and the fitting equation can be written as y ═ aX + b. Obviously, relative to the commercial reagentsIn the detection reagent of example 1, since any aptamer binding to catalase is not added, catalase keeps activity throughout the detection process, resulting in a serious decrease in detection result. On the other hand, the detection results of examples 2 to 11 were all improved by adding any one of the aptamers capable of binding to catalase to the R2 detection reagents, which indicates that the aptamers selected according to the present invention have a good catalase-inhibiting effect. And compared with the detection result of the commercial reagent, the examples 2 to 11 have good correlation with the commercial detection reagent and have small relative deviation, which shows that the addition of the catalase-binding aptamer of the present invention to the detection reagent does not adversely affect the original detection of the detection reagent.

TABLE 3 test results of 40 samples with different kits of examples

3. Repeatability verification of the kit

The samples No. 22 and No. 30 were used to examine the reproducibility of examples 1 to 11, and the results are shown in Table 4, in which the units of the data of each result are μmol/L.

TABLE 4 kit repeatability verification results

4. Preparing samples to be tested added with different interferents

After the experiment is finished, samples No.3, 5, 22, 25, 27 and 38 are mixed, and marked as a mixed sample 1 after being vibrated and uniformly mixed; samples No.1, 6, 11, 19, 30 and 39 were mixed, shaken and mixed, and labeled as mixed sample 2. Separately, a vitamin c solution with a concentration of 1000mg/dL, a bilirubin solution with a concentration of 400mg/dL, hemoglobin with a concentration of 4g/dL, chyle with a concentration of 60g/L, and calcium dobesilate with a concentration of 140. mu.g/ml were prepared. 12 clean 1.5ml EP tubes were taken and the samples were prepared according to the following table:

TABLE 5 formulation of Mixed sample 1 with interferents

Interfering substance

Physiological saline

Vitamin C

Bilirubin

Hemoglobin

Chyle

Calcium dobesilate

Amount of interferent added

20μL

Mixed sample 1 volume

380μL

Sample numbering

G1

G2

G3

G4

G5

G6

Final concentration of interferents

/

50mg/dL

20mg/dL

200mg/dL

3000mg/dL

70μg/ml

TABLE 6 formulation of Mixed sample 2 with interferents

Interfering substance

Physiological saline

Vitamin C

Bilirubin

Hemoglobin

Chyle

Calcium dobesilate

Amount of interferent added

20μL

Volume of mixed sample 2

380μL

Sample numbering

G7

G8

G9

G10

G11

G12

Final concentration of interferents

/

50mg/dL

20mg/dL

200mg/dL

3000mg/dL

70μg/ml

5. Detection of a test sample containing an interferent

The above samples G1-G12 were tested simultaneously using the reagents of examples 2-11 (since the reagent of example 1 did not inhibit catalase activity in the second reaction step, and had significant drawbacks, and the anti-interference test was not conducted, and the test results (. mu. mol/L) are shown in Table 7:

TABLE 7 detection results of the test samples containing the interferents using the kits of the different examples

The results in Table 7 show that the samples of G2-G6 and G8-G11 have the relative deviation of the detection result of the creatinine concentration controlled within +/-10% after the interference substances of vitamin c, bilirubin, hemoglobin and chyle are added into the samples of G1 and G7, which is within a reasonable error range, and the detection of the creatinine concentration is basically not influenced by the interference substances. While the results of example 2 show that the detection of creatinine concentration is significantly affected without the addition of an aptamer that binds calcium dobesilate, when calcium dobesilate is added as an interferent. The results of examples 3 to 11 show that the detection reagent can achieve a desired calcium dobesilate interference resistance effect by adding any aptamer capable of binding calcium dobesilate, and that the aptamer capable of binding calcium dobesilate can achieve a calcium dobesilate interference resistance effect whether added to the R1 reagent or the R2 reagent. The addition of the aptamer combined with calcium dobesilate results in small relative deviation of the detection result relative to a normal saline reference group, which indicates that the addition of the aptamer has no obvious influence on other performances of the reagent.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, so as to understand the technical solutions of the present invention specifically and in detail, but not to be understood as the limitation of the patent protection scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the patent of the invention is subject to the appended claims, and the description can be used for explaining the contents of the claims.

Sequence listing

<110> Ohwei Ongchu Biotech Co., Ltd

Beijing Qingke Biotechnology Co.,Ltd.

<120> nucleic acid aptamer binding catalase and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 27

<212> RNA

<213> Artificial Sequence

<400> 1

agcuuuuuga cccagagagu gaaaacc 27

<210> 2

<211> 27

<212> RNA

<213> Artificial Sequence

<400> 2

uugcaaaaac cugugugugu guuuucc 27

<210> 3

<211> 32

<212> RNA

<213> Artificial Sequence

<400> 3

uuuuggugug uacacacccc caaacugugu gu 32

<210> 4

<211> 33

<212> RNA

<213> Artificial Sequence

<400> 4

ggucaaacca cacuuugccc cgcccgccga uac 33

<210> 5

<211> 33

<212> RNA

<213> Artificial Sequence

<400> 5

guguguccca aggggggggg accccaacac acu 33

<210> 6

<211> 25

<212> RNA

<213> Artificial Sequence

<400> 6

guuuauaucg cgcgacaaag acccg 25

Claims

1. A catalase-binding aptamer selected from any one or more of the aptamers having the sequence shown in SEQ ID No.4, SEQ ID No.5 or SEQ ID No. 6.

2. A creatinine assay kit comprising the nucleic acid aptamer binding to catalase according to claim 1.

3. The creatinine assay kit according to claim 2, wherein said kit comprises R1 reagent for transforming endogenous creatine and said R1 reagent comprises catalase.

4. The creatinine detection kit according to claim 2, wherein said kit further comprises R2 reagent for converting creatinine, said R2 reagent comprising the nucleic acid aptamer binding to catalase according to claim 1; preferably, the concentration of the catalase-binding aptamer in the R2 reagent is 1 to 100nmol/L, preferably 5 to 20 nmol/L.

5. The creatinine assay kit according to claim 2, wherein said kit further comprises an anti-calcium dobesilate interference reagent, preferably said anti-calcium dobesilate interference reagent is selected from any one or more of the group of calcium dobesilate binding aptamers as defined in SEQ ID No.1, SEQ ID No.2 or SEQ ID No. 3; more preferably, the calcium dobesilate inhibitor is present in the R1 reagent or the R2 reagent alone or in both the R1 reagent and the R2 reagent.

6. The creatinine assay kit according to claim 5, wherein the concentration of said calcium dobesilate-binding aptamer in the R1 reagent or R2 reagent is 1 to 100nmol/L, preferably 5 to 20 nmol/L.

7. The creatinine assay kit according to claim 2, wherein said kit comprises R1 reagent and R2 reagent, said R1 reagent comprises sarcosine oxidase, creatine amidinohydrolase, calcium dobesilate-binding aptamer selected from the group consisting of the sequences shown in any of SEQ ID No.1, SEQ ID No.2 or SEQ ID No.3, and said catalase, said R2 reagent comprises creatininase, 4-AA, peroxidase, and catalase-binding aptamer according to claim 1;

alternatively, the kit comprises R1 reagent and R2 reagent, the R1 reagent comprises sarcosine oxidase, creatine amidinohydrolase and the catalase, the R2 reagent comprises creatininase, 4-AA, peroxidase and the catalase-binding aptamer of claim 1 and the calcium dobesilate-binding aptamer selected from the group consisting of a sequence as shown in any one of SEQ ID No.1, SEQ ID No.2 or SEQ ID No. 3;

alternatively, the kit comprises R1 reagent and R2 reagent, the R1 reagent comprising sarcosine oxidase, creatine amidinohydrolase, a calcium dobesilate-binding aptamer selected from the group consisting of any of SEQ ID No.1, SEQ ID No.2 or SEQ ID No.3 and the catalase, the R2 reagent comprising creatininase, 4-AA, peroxidase and the catalase-binding aptamer of claim 1 and a calcium dobesilate-binding aptamer selected from any of SEQ ID No.1, SEQ ID No.2 or SEQ ID No. 3.

8. The creatinine detection kit according to any one of claims 2 to 7, wherein the kit further comprises any one or more of a preservative, a surfactant, a nuclease inhibitor and ascorbic acid oxidase.

9. A method for detecting creatinine without diagnostic purposes, comprising the steps of:

c. for H obtained in step b₂O₂And (5) carrying out quantitative detection.

10. The method of creatinine detection according to claim 9, further comprising: adding one or more aptamer binding with calcium dobesilate selected from any one of the sequences shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 into the reactant in the step a and/or the step b.