CN113801932A

CN113801932A - Reagent and kit for vascular calcification diagnosis and application

Info

Publication number: CN113801932A
Application number: CN202111080489.4A
Authority: CN
Inventors: 刘江华; 祖旭宇; 曹劲松
Original assignee: First Affiliated Hospital of University of South China
Current assignee: First Affiliated Hospital of University of South China
Priority date: 2021-09-15
Filing date: 2021-09-15
Publication date: 2021-12-17

Abstract

The invention belongs to the field of biomedicine, and particularly relates to a reagent and a kit for vascular calcification diagnosis and application of the reagent and the kit. A reagent or kit for diagnosis of vascular calcification, comprising: reagent No. one: rRNA PCR amplification reagents; reagent No. two: cDNA PCR amplification reagent; reagent No. three: a sample release agent. The invention has obvious advantages in the aspect of detection cost. The old method takes three steps to complete the detection, and takes about 6 hours. The optimized detection method is only one step, and the detection time is about 1.5 h. The invention has obvious advantages in detection time efficiency.

Description

Reagent and kit for vascular calcification diagnosis and application

Technical Field

The invention belongs to the field of biomedicine, and particularly relates to a reagent and a kit for vascular calcification diagnosis and application of the reagent and the kit.

Background

Vascular calcification (Vascular calcification) is a ubiquitous pathological change of diabetes, hypertension, atherosclerotic Vascular lesions and other Vascular injuries, is one of the important factors of high morbidity and high mortality of cardiovascular and cerebrovascular diseases, and is even considered as an index for accurately predicting adverse cardiovascular events. Vascular calcification has previously been thought to be the passive deposition of calcium salts within cells and the extracellular matrix. However, in recent years it has been found that vascular calcification is an active, highly regulated biological process, similar to bone formation. The vascular smooth muscle cell is a major constituent cell of the cardiovascular system, and is a key pathological process for the occurrence and development of vascular calcification, with the transformation from a contractile phenotype to an osteoblast-like phenotype. At present, a safe and effective treatment method for vascular calcification is still lacking clinically. When the vascular calcification focus is confirmed by imaging detection methods such as coronary angiography and dual-energy CT scanning technology, the vascular calcification of a patient is generally serious, the patient is not easy to cure radically, and the cost is expensive. Even the newly developed atherectomy or balloon angioplasty procedure is not ideal for treatment of calcified lesions that have already formed.

The prior art CN 105177147A discloses a plasma marker, a primer pair, a kit and application for vascular calcification diagnosis. Discloses a plasma miRNA marker miR-32-5p for vascular calcification diagnosis, which can be used for preparing a diagnostic kit and is used for clinical diagnosis and prevention detection of vascular calcification. However, the reagents for detection are conventional, and the extraction, reverse transcription and PCR detection are long, expensive and limited in accuracy.

Therefore, the method for detecting the miR-32 in the blood plasma efficiently, quickly and accurately is found, and has important significance for clinically and timely preventing and treating the vascular calcification.

Disclosure of Invention

The invention discloses a reagent for quickly diagnosing vascular calcification and application thereof in quickly and accurately detecting miR-32 content in blood plasma.

In order to achieve the purpose, the technical scheme provided by the invention is as follows:

a reagent or kit for diagnosis of vascular calcification, comprising:

reagent No. one: rRNA PCR amplification reagents;

reagent No. two: cDNA PCR amplification reagent;

reagent No. three: a sample release agent.

Preferably, the reagent III is 201101-A of Wuhanming Biotechnology GmbH.

Preferably, the first reagent and the second reagent are both Real time PCR reagents.

Preferably, the first reagent is

II Enzyme Mix in Multiplex Probe One-step qRT-PCR Supermix UDG AQ 322-01.

Preferably, the reagent No. two is TB

Premix Ex Taq^TMⅡ(Tli RNaseH Plus)RR820A。

Preferably, the kit for diagnosing vascular calcification further comprises conventional PCR reagents.

Preferably, the kit for diagnosing vascular calcification comprises 6-10 μ l of reagent No. two and 0.6-1.0 μ l of reagent No. one.

The second purpose of the invention is to provide the application of the reagent in preparing a vascular calcification diagnosis kit.

The third purpose of the invention is to provide the application of the reagent or the kit in preparing a vascular calcification diagnosis preparation.

The invention is further explained below:

a conventional One-Step detection Kit (such as Kangshi UltraSYBR One Step RT-qPCR Kit, product number: CW0659) can effectively complete the detection of miR-32 in high-expression miRNA samples such as cells and tissues, but is difficult to complete the effective detection of miR-32 with weak expression in blood plasma. The reagent II is used as a kit for detecting the probe by the one-step method, and the enzyme amplification activity of the kit is high and the specificity is strong. However, the length of the detected miR-32 is only 22bp, and the difficulty of inserting a fluorescent probe is high. In addition, miR-32 exists in a non-free state in plasma. Therefore, the applicant releases miR-32 in plasma through the reagent III, and ensures the requirements on the sensitivity and accuracy of miR-32 detection in plasma by combining the reagent II and the reagent I.

The invention has the beneficial effects that:

the third reagent releases miR-32 in the plasma, and the second reagent and the first reagent are combined, so that the requirements on the sensitivity and accuracy of miR-32 detection in the plasma are met.

In terms of detection cost: the old detection method needs three steps of extraction, reverse transcription and qRT-PCR, and the cost is about 100 yuan; after the method is optimized, qRT-PCR detection is completed only by directly loading samples, and the cost is 30 yuan/sample. Has obvious advantages in cost.

In terms of detection time: the old method takes three steps to complete the detection, and takes about 6 hours. The optimized detection method is only one step, and the detection time is about 1.5 h. Has obvious advantages in the detection time efficiency.

Drawings

FIG. 1 is an amplification curve of miR-32 of example 1;

FIG. 2 is a solubility curve for miR-32 of example 1;

FIG. 3 is an amplification curve of miR-32 of example 2;

FIG. 4 is a solubility curve for miR-32 of example 2;

FIG. 5 is the correlation analysis results of the data detected in example 1 and the data detected in example 2;

FIG. 6 is an amplification curve of the reference gene of example 3;

FIG. 7 is an amplification curve of miR-32 of example 3;

FIG. 8 is a reference gene melting curve of example 3;

FIG. 9 is a miR-32 solubility curve of example 3;

FIG. 10 is an amplification curve of the reference gene in example 4;

FIG. 11 is an amplification curve of miR-32 of example 4;

FIG. 12 is an amplification curve of the reference gene in example 5;

FIG. 13 is an amplification curve of miR-32 of example 5;

FIG. 14 is a melting curve of the reference gene in example 5;

FIG. 15 is a dissolution curve of miR-32 of example 5;

FIG. 16 is an amplification curve of the reference gene in example 6;

FIG. 17 is an amplification curve of miR-32 of example 6;

FIG. 18 is a melting curve of the reference gene in example 6;

FIG. 19 is a solubility curve for miR-32 of example 6;

Detailed Description

Example 1

First, research object

66 patients with confirmed coronary calcification by coronary angiography and dual-source CTC examination at the first hospital affiliated university of south china between 6 months in 2013 and 5 months in 2014 were selected. Excluding the end stage of the existing myocardial infarction history, coronary artery or peripheral artery revascularization history, liver and kidney insufficiency, thyroid or adrenal gland dysfunction, calcium metabolism abnormality, chronic infection (active tuberculosis, COPD persisting period), connective tissue disease, tumor, immune system disease or psychosis and other diseases. Coronary artery CTA was divided into coronary artery calcification group and control group according to the Agatston method score (CACS), wherein the coronary artery calcification score was equal to 8 patients with 0 score, i.e. non-coronary calcification group, and the coronary artery calcification score was greater than 8 patients with 0 score. Data collection and blood collection involved in the study were performed with informed consent of the subjects.

Second, research method

1. Plasma collection

All patients who were observed had about 3ml of arterial blood drawn at the time of operation and placed in a 10ml EDTA-K2 anticoagulation tube. After the specimen is collected and kept stand for 30 minutes, the specimen is centrifuged at 3000rpm for 10 minutes, supernatant plasma is taken and subpackaged in an EP tube, and the plasma is stored at the low temperature of-70 ℃.

2. Preparing a template: the serum is taken out of the refrigerator and dissolved, and then mixed with reagent III (sample releasing agent of Wuhanming Mingde Biotechnology GmbH; product No. 120030048-A) in a proper proportion, and then kept stand for 10min, centrifuged at 12000rpm for 5min, and kept at 4 ℃ for later use.

3. Configuring a qPCR reaction system:

wherein, the sequence of the forward primer for amplifying miR-32-5p is shown as SEQ ID NO.1(GGCGGCGGTA TTGCACATTA CTAA), the reverse primer is a universal reverse primer, and the sequence of the universal reverse primer is shown as SEQ ID NO.2(GCGCAATGCA TCGCATAGCA ACTGT). U6 is used as an internal reference gene, and the sequence of the internal reference U6 is shown as SEQ ID NO.3

(GTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTCCATATTTT), the PCR forward primer sequence of the internal reference U6 is shown as SEQ ID NO.4(TGGAACGCTTCACGAATTTGCG), and the reverse primer is shown as SEQ ID NO.5 (GGAACGATACAGAGAAGATAAGC).

4. The amplification reaction program (two-step process) was set up as follows:

stage 1: reverse transcription at 50 deg.C for 5min

Stage 2: pre-denaturation at 94 ℃ for 30sec

Stage 3: PCR reaction (40 cycles)

Denaturation at 94 ℃ for 5sec

Annealing at 60 ℃ for 30sec

5. Results and analysis of the study

As shown in the attached figures 1 and 2, the amplification curves of 5 clinical samples are smooth, have no miscellaneous peak, and present a significant S-type characteristic, and the Ct value is in an interval with high reliability (<32), which indicates that the system has a good amplification effect on miR-32 in plasma; the dissolution curve is unimodal, which shows that the binding specificity of the primer and the template is strong in the amplification system.

EXAMPLE 2 conventional Process

Plasma miRNA extraction

1.300. mu.l of plasma was added to 1ml of Trizol, and after homogenization, the mixture was left at room temperature for 5min to completely separate the nucleic acid-protein complex.

2. Adding 300 μ l chloroform, covering the tube, shaking vigorously for 15sec, and standing at room temperature for 5min

After centrifugation at 12,000rpm (13,400 Xg) for 15min at 3.4 deg.C, the sample will separate into three layers: yellow organic phase, intermediate layer and colorless aqueous phase, RNA is mainly in the aqueous phase, and the volume of the aqueous phase is about 50% of the lysate MZ reagent used. The aqueous phase was transferred to a new tube and subjected to the next step.

4. The volume of the transfer solution is measured, and absolute ethanol (for example, 215. mu.l of absolute ethanol is added to 500. mu.l of the transfer solution) which is 0.43 times the volume of the transfer solution is slowly added to the transfer solution, and the mixture is mixed (in this case, precipitation may occur). The resulting solution was transferred into the adsorption column miRspin together with the precipitate, centrifuged at room temperature at 12,000rpm (-13,400 xg) for 30sec, if the entire solution and mixture could not be added to the adsorption column miRspin at one time, transferred in two portions, centrifuged and discarded to the adsorption column miRspin, and the effluent was retained.

5. The volume of the effluent is measured, and absolute ethanol (for example, 525. mu.l of absolute ethanol is added to 700. mu.l of effluent) which is 0.75 times of the volume of the effluent is slowly added to the effluent, and the mixture is mixed (precipitation may occur). The resulting solution and precipitate were transferred to adsorption column miRelute together and centrifuged at room temperature at 12,000rpm (-13,400 xg) for 30sec, if the whole solution and mixture could not be added to adsorption column miRelute at one time, the transfer was done in two portions, the effluent was discarded after centrifugation, and the adsorption column miRelute was retained.

6. To the adsorption column miRelute was added 500. mu.l of deproteinized solution MRD, and the mixture was allowed to stand at room temperature for 2min, centrifuged at 12,000rpm (. about.13,400 Xg) at room temperature for 30sec, and the waste liquid was discarded.

7. To the adsorption column miRelute was added 500. mu.l of the rinsing solution RW, and the mixture was allowed to stand at room temperature for 2min, centrifuged at 12,000rpm (. about.13,400 Xg) at room temperature for 30sec, and the waste liquid was discarded.

8. Operation 6 is repeated.

9. The adsorption column, mirelulite, was placed in a 2ml collection tube and centrifuged at 12,000rpm (-13,400 Xg) for 1min at room temperature to remove residual liquid.

10. Transferring the adsorption column miRelute into a new RNase-Free 1.5ml centrifuge tube, adding 15-30 μ l RNase-Free ddH2O, standing at room temperature for 2min, centrifuging at room temperature of 12,000rpm (13,400 Xg) for 2min, and collecting pure miRNA.

II, miRNA reverse transcription

In a 1.0.2 ml enzyme-free EP tube, the following mixture was prepared:

2. the reaction procedure was as follows: reacting at 37 ℃ for 1h, reacting at 85 ℃ for 5min, and adding 90 mu l of double distilled water into the obtained reaction solution to obtain the required cDNA.

3. Diluting with 10. mu.l, and storing at-20 deg.C.

Third, qRT-PCR detection

1. Configuring a qPCR reaction system:

reagent composition	Volume (μ l)
		2×TB Green	5μl
Reverse transcription template	1μl
		Forward primer (10 μm)	0.4μl
Reverse primer (10 μm)	0.4μl
		ddH2O	3.2μl

Wherein, the sequence of the forward primer for amplifying miR-32-5p is shown as SEQ ID NO.1(GGCGGCGGTA TTGCACATTA CTAA), the reverse primer is a universal reverse primer, and the sequence of the universal reverse primer is shown as SEQ ID NO.2(GCGCAATGCA TCGCATAGCA ACTGT). U6 is used as an internal reference gene, the sequence of the internal reference U6 is shown as SEQ ID NO.3(GTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTCCATATTTT), the sequence of a PCR forward primer of the internal reference U6 is shown as SEQ ID NO.4(TGGAACGCTTCACGAATTTGCG), and the reverse primer is shown as SEQ ID NO.5 (GGAACGATACAGAGAAGATAAGC).

2. The reaction procedure is as follows

Stage 1: pre-denaturation at 94 ℃ for 30sec

Stage 2: PCR reaction (40 cycles)

Denaturation at 94 ℃ for 5sec

Annealing at 60 ℃ for 30sec

Third, research results and analysis

As shown in FIGS. 3 and 4, the amplification curves of 5 clinical samples (the same 5 clinical samples used in FIGS. 1 and 2) are smooth, have no miscellaneous peaks, and have a significant sigmoid characteristic, however, the Ct value is between 30 and 36, and the reliability is lower than that of the one-step method. The dissolution curve has a small peak in addition to a main peak, indicating that the binding specificity of the primer to the template is lower in this amplification system than in the one-step method.

Meanwhile, the data detected in example 1 and the data detected by the conventional method were subjected to correlation analysis, and the results are shown in fig. 5. The correlation coefficient of the two results was 0.845, which showed no significant difference between the two sets of data (P-0.3704). This shows that the method of the present invention has reliable detection sensitivity and accuracy, can replace the conventional method, and has obvious advantages in the aspects of detection cost and detection time. The conventional method needs three steps of extraction, reverse transcription and qRT-PCR, and the cost is about 100 yuan; after the method is optimized, qRT-PCR detection is completed only by directly loading samples, and the cost is 30 yuan/sample. Has obvious advantages in cost. The conventional method takes three steps to complete the detection, and takes about 6 hours. The optimized detection method is only one step, and the detection time is about 1.5 h. Has obvious advantages in the detection time efficiency.

Example 3

Study subjects, plasma collection and template preparation were consistent with example 1.

1. Configuring a qPCR reaction system (Kangta):

the primers and primers were as in example 1.

2. The amplification reaction program (three-step method) was set up as follows:

stage 1: reverse transcription at 45 deg.C for 10min

Stage 2: pre-denaturation at 95 ℃ for 5min

Stage 3: PCR reaction (40 cycles)

Denaturation at 95 ℃ for 15sec

Annealing at 60 ℃ for 30sec

Extension of 72 ℃ 30ses

Stage 4: dissolution Curve analysis

3. Analysis of results

As shown in FIGS. 6-9, the internal reference amplification curve is less clear, but the miR-32 amplification curve is cluttered. As can be seen from the dissolution curves, both dissolution curves were non-unimodal and disordered. The amplification system has poor amplification effect on miR-32 in plasma, and the binding specificity of the primer and the template is poor.

Example 4

1. Configuring a qPCR reaction system (Kangta):

the primers and primers were as in example 1.

stage 1: reverse transcription at 45 deg.C for 10min

Stage 2: pre-denaturation at 95 ℃ for 5min

Stage 3: PCR reaction (40 cycles)

Denaturation at 95 ℃ for 15sec

Annealing at 60 ℃ for 30sec

Extension of 72 ℃ 30ses

Stage 4: dissolution Curve analysis

3. Analysis of results

As shown in FIGS. 10 to 11, the amplification curves of the internal reference of the serum mixture at different addition levels were satisfactory, but there was no difference in the gradient. The amplification curve of miR-32 is messy, and the amplification value is high.

Example 5

Influence of adding only one reagent on detection effect

1. Configuring a qPCR reaction system:

the primers and primers were as in example 1.

2. The amplification reaction program (two-step process) was set up as follows:

stage 1: reverse transcription at 50 deg.C for 5min

Stage 2: pre-denaturation at 94 ℃ for 30sec

Stage 3: PCR reaction (40 cycles)

Denaturation at 94 ℃ for 5sec

Annealing at 60 ℃ for 30sec

Stage 4: dissolution Curve analysis

3. Analysis of results

As shown in the attached figures 12-13, the amplification curves of the internal reference and miR-32 are messy, and the amplification values are high.

The dissolution curves are similarly chaotic as shown in FIGS. 14-15. Indicating that no effective amplification and detection results could be obtained without the addition of reagent II. Indicating that the primer specificity is not strong.

Example 6

Influence of the reaction System

1. Configuring a qPCR reaction system:

the primers and primers were as in example 1.

2. The amplification reaction program (two-step process) was set up as follows:

stage 1: reverse transcription at 50 deg.C for 5min

Stage 2: pre-denaturation at 94 ℃ for 30sec

Stage 3: PCR reaction (40 cycles)

Denaturation at 94 ℃ for 5sec

Annealing at 60 ℃ for 30sec

Stage 4: dissolution Curve analysis

3. Analysis of results

As shown in FIGS. 16-17, the amplification curves of internal reference and miR-32 are relatively cluttered.

The dissolution curves are also relatively random, as shown in FIGS. 18-19. Under a 10-microliter reaction system, amplification occurs to miR-32 and internal reference, and a more regular peak value also occurs to a dissolution curve. However, the non-peak portions of the two curves still appear cluttered. Thus, the combination specificity of the primer and the template is poor in the amplification system.

SEQUENCE LISTING

<110> affiliated first hospital of southern China university

<120> reagent and kit for vascular calcification diagnosis and application

<130> 1

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 24

<212> DNA

<213> Artificial Synthesis

<400> 1

ggcggcggta ttgcacatta ctaa 24

<210> 2

<211> 25

<212> DNA

<213> Artificial Synthesis

<400> 2

gcgcaatgca tcgcatagca actgt 25

<210> 3

<211> 106

<212> DNA

<213> Artificial Synthesis

<400> 3

gtgctcgctt cggcagcaca tatactaaaa ttggaacgat acagagaaga ttagcatggc 60

ccctgcgcaa ggatgacacg caaattcgtg aagcgttcca tatttt 106

<210> 4

<211> 22

<212> DNA

<213> Artificial Synthesis

<400> 4

tggaacgctt cacgaatttg cg 22

<210> 5

<211> 23

<212> DNA

<213> Artificial Synthesis

<400> 5

ggaacgatac agagaagata agc 23

Claims

1. A reagent or kit for diagnosis of vascular calcification, comprising:

reagent No. one: rRNA PCR amplification reagents;

reagent No. two: cDNA PCR amplification reagent;

reagent No. three: a sample release agent.

2. The reagent or the kit according to claim 1, wherein the reagent III is 201101-A of Wuhanming Biotechnology GmbH.

3. The reagent or kit of claim 1, wherein the first reagent and the second reagent are both Real time PCR reagents.

4. The reagent or kit of claim 1, wherein the first reagent isTransScriptEnzyme Mix in II Multiplex Probe One-step qRT-PCR Supermix UDG AQ 322-01.

5. The reagent or kit of claim 1, wherein the reagent No. two is TB Green ® Premix Ex Taq^TMⅡ(Tli RNaseH Plus) RR820A。

6. The kit of claim 1, further comprising conventional PCR reagents.

7. The kit according to claim 6, wherein the kit for diagnosing vascular calcification comprises 6 to 10 μ l of reagent No. two and 0.6 to 1.0 μ l of reagent No. one.

8. Use of the reagent according to claim 1 for the preparation of a vascular calcification diagnostic kit.

9. Use of the reagent or kit according to claim 1 for the preparation of a diagnostic preparation for vascular calcification.