CN113774078B - Recombinant pichia pastoris strain, construction method and application thereof - Google Patents

Abstract

The invention provides a recombinant Pichia pastoris strain, a construction method and application thereof. A method for constructing recombinant pichia pastoris strain producing fatty acid, comprising: constructing a polypeptide having the sequence of SEQ ID NO:1, a sgRNA expression vector pPICZ-Cas9-gFAA1 of a targeting nucleotide sequence; the sgRNA expression vector pPICZ-Cas9-gFAA1 is introduced into a Pichia pastoris strain, and KpFAA1 genes in the Pichia pastoris strain are knocked out. The invention also provides a construction method of the fatty alcohol synthesis recombinant Pichia pastoris strain and an alpha-olefin synthesis recombinant Pichia pastoris strain. The invention realizes the synthesis of the Pichia pastoris fatty acid derivative for the first time, especially the high-efficiency biosynthesis from methanol to fatty acid, expands the green conversion path of methanol, and explores the application potential of Pichia pastoris in the field of microbial cell factories.

Description

Recombinant pichia pastoris strain, construction method and application thereof

Technical Field

The invention belongs to the application fields of microbial genetic engineering and metabolic engineering, and particularly relates to a construction method, optimization and application of recombinant Pichia pastoris for producing fatty acid derivatives by utilizing methanol.

Background

The current world rapid-growing urban construction and industrialization process results in unprecedented dependence on fossil fuels, with increasing demands for liquid transportation fuels year by year. Currently, one third of the world's energy comes from petroleum feedstocks, the remainder from coal, natural gas, nuclear, hydroelectric and renewable energy (BP, 2014), while about 80% of liquid fuels come from the rapid consumption of petroleum (Floudas et al, comp. Chem., eng., 2012, 41:24-51.) reserves of petroleum resources and the problem of climate change due to greenhouse gas emissions from fossil fuel use have become one of the biggest challenges facing modern society, also contributing to the search for inexpensive renewable energy sources that can replace fossil fuels. Fuel ethanol is currently the most predominant biofuel, which can drastically reduce carbon dioxide emissions, however it presents food and economic problems, as well as the low energy density and hygroscopicity of fuel ethanol itself limit its widespread use (Hu et al open. Biol., 2019, 9: 190049.).

Fatty acid derivatives such as fatty alcohols, alkanes and alkenes, which have similar high energy density and combustion characteristics to the liquid fuels currently used, can be used as aviation and heavy truck fuels, and are a better alternative to petroleum resources than bioethanol (Sheng et al front. In addition, fatty acids and derivatives thereof are also important chemical materials, such as fatty acids, which can be used to make detergents and surfactants; fatty alcohols are widely used in the production of pharmaceuticals, cosmetics, detergents and skin care products; alpha-olefins are important feedstocks for the preparation of aviation fuels and high-end lubricating oils (Liu et al, microb. Cell. Face., 2016, 15:129; zhou et al, nat. Energy., 2018, 3:925-935.). BCC Research reports show that the global natural fatty acid market is approaching $135 billion in 2018, and this data will increase to $175 billion by 2023, with a Composite Annual Growth Rate (CAGR) of 5.4% during 2018-2023. The market size of fatty acid derivatives will increase from 69 billion dollars in 2018 to nearly 95 billion dollars in 2023 with a annual compound growth rate of 6.4% (BCC Research LLC, 2018).

Because of the structural characteristics of fatty acids and derivatives thereof, chemical synthesis methods have complex processes and high cost, and the number of natural biological sources is very limited, so that development of novel efficient production processes is needed to meet the increasing demands, and along with development of synthetic biology and metabolic engineering, a microbial cell factory is used as a production platform of fatty acids and derivatives thereof to gradually become an efficient and economic supplementary method. There is also a great deal of research currently being focused on this area, developing production platforms for different strains, such as Saccharomyces cerevisiae, E.coli, rhodococcus, etc. In E.coli, the precursor supply and consumption processes are balanced by modularized transcriptional level regulation of synthetic genes, and the protein translation efficiency is improved by modification of ribosome binding site of enzyme, and the final yield of fatty acid can reach 8.6 g/L (Xu et al Nat. Comm., 2013, 4:1409.) by fed-batch fermentation of engineering strains. In Saccharomyces cerevisiae, 1g/L fatty acid yield was achieved at shake flask fermentation level by integrating cytoplasmic citrate cleavage pathway, enhancing acetyl CoA supply, knocking out fatty acid beta oxidation pathway gene, etc., fed-batch fermentation in a bioreactor, yielding 10.4. 10.4 g/L (Zhou et al Nat. Comm., 2016, 7:11709.). On the basis, the carbon source flow to acetyl coenzyme A process is further enhanced, the transformation of coenzyme NADPH, ATP supply and the like is enhanced, and the saccharomyces cerevisiae is completely transformed into oleaginous yeast by combining with a laboratory adaptive evolution means, so that the yield of fed-batch fatty acid reaches 33.4 g/L (Yu et al cell., 2018, 174 (6): 1549-1558). In rhodococcus, firstly, by optimizing culture conditions, 82.9. 82.9 g/L of triacylglycerol can be produced, then acyl-CoA synthetase is knocked out, lipase specific folding enzyme and three lipases are overexpressed, and engineering bacteria can produce 50.2. 50.2 g/L of free fatty acid (Kim et al Nat. Chem. Biol., 2019, 15 (7): 721-729.).

The existing production substrate of fatty acid and derivatives thereof is mainly glucose, and although the glucose is an optimal carbon source of microorganisms, the glucose is derived from grains and is greatly influenced by geographical climate, economy and other factors. There is therefore a need to find a cheaper raw material for production as an alternative. Methanol is the simplest monohydric alcohol, mainly from the catalytic synthesis of by-products and natural gas in the coal chemical industry, and has mature production process, and is a renewable resource with wide sources and low cost (Price et al PNAS, 2016, 113:12691-12696.). Because the energy structure of China is characterized by oil deficiency, gas deficiency and coal enrichment, the productivity and yield of the domestic methanol are greatly increased in recent years. Compared with the conventional fermentation substrate saccharides, the methanol has stronger reducing power, can provide more driving force for the synthesis of heterologous products (Whitaker et al, curr. Opin. Biotechnol., 2015, 33:165-175.) and has the characteristics of low price, high volume and high energy efficiency, so that the methanol becomes a potential raw material, the existing methanol conversion route is greatly expanded by the biological refining of the methanol, and the clean utilization of coal resources is realized.

Pichia pastoris is a natural methylotrophic yeast, can grow rapidly in a methanol culture medium, can realize high-density culture, and has a mature heterologous protein expression system, so that the Pichia pastoris is a microorganism cell factory chassis with great potential. However, studies on the production of fatty acids and derivatives thereof, particularly methanol, in pichia pastoris as a substrate have not been reported. Therefore, the invention aims to construct a high-yield strain for producing fatty acid by converting methanol of pichia pastoris, on one hand, the routes of methanol utilization and fatty acid production are widened, and on the other hand, the application potential and prospect of pichia pastoris as a microbial cell factory are explored.

Disclosure of Invention

The invention aims to provide a construction method, optimization and application of Pichia pastoris for producing fatty acid, fatty alcohol and alpha-olefin.

According to the first aspect of the invention, a construction method of a Pichia pastoris strain with high fatty acid yield is provided, the capacity of producing fatty acid by cells can be remarkably improved, and the accumulation amount of fatty acid is more than 1.1 g/L.

The construction method comprises the following steps: constructing a polypeptide having the sequence of SEQ ID NO:1, a sgRNA expression vector pPICZ-Cas9-gFAA1 of a targeting nucleotide sequence; introducing the sgRNA expression vector pPICZ-Cas9-gFAA1 into a Pichia pastoris strain, and knocking out the Pichia pastoris strainKpFAA1And (3) a gene.

Wherein the pichia pastoris strain incorporates a Cas9 protein.

Optionally, the construction method further comprises: constructing a polypeptide having the sequence of SEQ ID NO:2, a sgRNA expression vector pPICZ-Cas9-gFAA2 of a targeting nucleotide sequence; introducing the sgRNA expression vector pPICZ-Cas9-gFAA2 into a Pichia pastoris strain, and knocking out the Pichia pastoris strainKpFAA2And (3) a gene.

Optionally, the construction method further comprises: constructing a polypeptide having the sequence of SEQ ID NO:3, a sgRNA expression vector pPICZ-Cas9-gPOX1 of a targeting nucleotide sequence; introducing the sgRNA expression vector pPICZ-Cas9-gPOX1 into a Pichia pastoris strain, and knocking out the Pichia pastoris strain KpPOX1And (3) a gene.

In one embodiment, the gene encoding the acyl-CoA synthetase is knocked outKpFAA1AndKpFAA2gene encoding acyl-CoA oxidaseKpPOX1

Further, the specific steps of the technical scheme are as follows: to seamlessly knock out genesKpFAA1For example, the gene editing of pichia pastoris in the present invention is primarily based on autonomously constructed CRISPR/Cas9 systems. First, a targeting gene is constructedKpFAA1The target sequence of 20 bp of the sgRNA expression vector pPICZ-Cas9-gFAA1 is a nucleotide sequence shown as SEQ ID No. 1; second, constructing donor DNA fragments, and amplifying the genes respectivelyKpFAA11000 bp sequences are respectively arranged at the upstream and downstream of the coding region, and a complete donor DNA fragment is obtained by a method of overlap extension PCR; thirdly, transforming, through an electrotransformation mode, gRNA expression vectors pPICZ-Cas9-gFAA1 and donor DNA are transformed into wild Pichia pastoris GS115, standing and culturing the wild Pichia pastoris GS115 at 30 on a YPD plate containing bleomycin for 3 days, and the transformant is subjected to YPD-zeocin ⁺ The liquid medium of (2) is cultured overnight, PCR verification is carried out, and the strain is preserved or the next experiment is carried out after the correct transformant is lost through plasmid. Knock-out geneKpFAA2AndKpPOX1(20 bp targeting sequences the nucleotide sequences shown as SEQ ID No.2 and SEQ ID No. 3) the editing process of other genes hereinafter were carried out according to similar procedures.

In one implementationIn the example, a recombinant strain of Pichia pastoris is provided, which utilizes glucose or methanol to efficiently synthesize fatty acid, the original strain is GS115, and the acyl-CoA synthetase is knocked out (from geneKpFAA1 KpFAA2Coding) and acyl-CoA oxidase (derived from a gene)KpPOX1Encoding).

In one embodiment, a recombinant strain of Pichia pastoris is provided for efficient synthesis of fatty acids using methanol, starting strain GS115, over-expressing genes from Pichia pastorisKpRAD52And knock out the fatty acyl-CoA synthetase geneKpFAA1

Further, it is identified thatKpFAA1 KpFAA2AndKpPOX1the sequence of the gene in Pichia pastoris (the nucleotide sequences shown as SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6 respectively) and the function.

Further, in a basic salt culture medium with 20 g/L glucose as a carbon source, inoculating and knocking outKpFAA1 KpFAA2AndKpPOX1pichia pastoris of the gene, and fatty acid fermentation experiments are carried out. Its parameters are set to initial inoculation OD ₆₀₀ At 0.1, the fermentation conditions were as follows: the liquid loading amount is 20 ml/100 ml,220 rpm,30 , and the fermentation time is 72-96 hours. Further, pichia pastoris was found and identified to accumulate mainly fatty acid species C16:1, C16, C18:2, C18:1 and C18.

In one example, the strain was fermented 96. 96 h in basal medium containing 20 g/L glucose with shake flask level fatty acid production reaching 1.1. 1.1 g/L, fatty acid species including C16:1, C16, C18:2, C18:1 and C18.

Further, in a basic salt culture medium with 20 g/L methanol as a carbon source, inoculating and knocking outKpFAA1 KpFAA2AndKpPOX1pichia pastoris of the gene, and fatty acid fermentation experiments are carried out. Its parameters are set to initial inoculation OD ₆₀₀ At 0.2, the fermentation conditions were as follows: the liquid loading amount is 20 ml/100 ml,220 rpm,30 , and the fermentation time is 96-120 h. The result proves that the recombinant pichia pastoris can grow and metabolize by taking methanol as the only carbon source and energy source, and can produce about 600 mg/L fatty acid and fatThe acid species is the same as glucose.

In one example, the strain was fermented 120 h in a basal medium containing 20 g/L methanol, and shake flask level fatty acid yields reached 577 mg/L, fatty acid species including C16:1, C16, C18:2, C18:1, and C18.

According to a second aspect of the present invention, there is provided a strategy for increasing the supply of acetyl-CoA precursor and coenzyme NADPH in Pichia pastoris, over-expressing a mouse-derived citrate lyase (derived from a gene MmACLCoding), isocitrate dehydrogenase 2 (derived from the gene endogenous to pichia pastorisKpIDP2Coding), a citrate transporter derived from Saccharomyces cerevisiae (from a geneScYHM2Encoding). Thereby improving the fatty acid yield of pichia pastoris.

In one example, recombinant Pichia strains with high fatty acid production overexpressed both the citrate lyase MmAcl from mice, the citrate transporter ScYhm2 of Saccharomyces cerevisiae, and the endogenous cytoplasmic isocitrate dehydrogenase KpIDP2 of Pichia pastoris, enabling the capacity of Gao Bichi yeast to utilize methanol to produce fatty acids.

Alternatively, the pichia pastoris strain HIS4 site incorporates the protein KpRad52.

Optionally, the Pichia pastoris strain knocks out genesKpFAA1

Alternatively, the recombinant pichia pastoris strain is overexpressed by a geneMmACLThe coded citrate lyase includes gene derived from mouseMmACLIntegration into the Pichia pastoris, preferably into the yeast genome PNSI-2 site.

Alternatively, the recombinant pichia pastoris strain is overexpressed by a geneKpIDP2Coded isocitrate dehydrogenase 2 comprising a gene derived from Pichia pastorisKpIDP2Overexpression of the gene, preferably integration into the PNSI-3 site, is performed.

Alternatively, the recombinant pichia pastoris strain is overexpressed by a geneScYHM2The encoded citrate transporter includes gene derived from Saccharomyces cerevisiaeScYHM2Integration into the Pichia pastoris, preferablyIntegration into the PNSI-4 site.

In a specific embodiment, the implementation steps of the above technical scheme are as follows:

(1) GeneMmACLIs over-expressed by (2)

The specific flow is consistent with the first aspect of the invention, wherein the constructed sgRNA expression vector is pPICZ-Cas9-gPNSI-2, and the 20 bp targeting sequence is a nucleotide sequence shown as SEQ ID No. 7. Second, construction of a donor DNA for chromosomal integration, including homology arms of 1000 bp on both sides of the site and an exogenous gene expression cassette P _AOX1 -MmACL-T _FAA1 . Further, genesMmACLThe gene source is artificial synthesis, and the nucleotide sequence is shown as SEQ ID No. 8.

(2) GeneKpIDP2AndScYHM2is over-expressed by (2)

The specific procedure is consistent with the first aspect of the invention described above, wherein the sgRNA expression vectors constructed are pPICZ-Cas9-gPNSI-3 (wherein the nucleotide sequence of the targeting sequence of 20 bp is shown as SEQ ID No. 9) and pPICZ-Cas9-gPNSI-4 (wherein the targeting sequence of 20 bp is shown as the nucleotide sequence of SEQ ID No. 10). Further, it is identified that KpIDP2The sequence in Pichia pastoris (the nucleotide sequence of which is shown as SEQ ID No. 11) and functions. GeneScYHM2Obtained by amplification of Saccharomyces cerevisiae CENPK-113 genome (its sequence is shown as nucleotide sequence of SEQ ID No. 12).

In a third aspect of the present invention, there is provided a recombinant pichia pastoris strain producing fatty acids, constructed according to the method of the first aspect of the present application or according to the method of the second aspect of the present application.

In a fourth aspect of the present application, there is provided a construction method of a pichia pastoris strain for producing fatty alcohols, comprising: the carboxylic acid reductase MmCar and cofactor AnNpgA, alcohol dehydrogenase Scadh5, acyl-CoA reductase FaCoar were overexpressed in Pichia pastoris to construct fatty alcohol synthesis pathways.

Optionally, the pichia pastoris strain HIS4 site is integrated withKpRAD52And (3) a gene.

Optionally, the saidPichia pastoris strain seamless knock-out fatty aldehyde dehydrogenase geneKpHFD1

Alternatively, the Carboxylic acid reductase gene of Mycobacterium marinumMmCARIs integrated into the PNSI-2 locus of the recombinant Pichia pastoris strain to overexpress the carboxylate reductase MmCar.

Alternatively, a cofactor protein derived from Aspergillus nidulans AnnpgAThe gene was integrated into the PNSI-3 locus of the recombinant Pichia pastoris strain to overexpress the cofactor protein AnNpgA.

Alternatively, saccharomyces cerevisiae is used as the sourceScADH5The gene was integrated into the PNSI-4 locus of the recombinant Pichia strain to overexpress the alcohol dehydrogenase Scadh5.

Optionally, the codons are optimizedFaCoARThe gene is integrated into PNSI-5 locus of the recombinant Pichia pastoris strain to overexpress acyl-CoA reductase FaCoar.

In one embodiment, the wild-type Pichia pastoris GS115 overexpression gene is in the basal cellKpRAD52And knock out fatty aldehyde dehydrogenase geneKpHFD1Sum geneKpFAA1Further over-expressing a carboxylate reductase gene on the basal cellMmCARCofactor genesAnnpgAAlcohol dehydrogenase geneScADH5Fatty acyl-coa reductase geneFaCoARA fatty alcohol yield of 75.8 mg/L can be achieved.

In one embodiment, the 4 key genes, the carboxylate reductase genes, of the fatty alcohol synthesis pathway are synthesized by means of the CRISPR/Cas9 systemMmCARCofactor genesAnnpgAAlcohol dehydrogenase geneScADH5And an acyl-CoA reductase geneFaCoARIntegration into PNSI-2, PNSI-3, PNSI-4 and PNSI-5 sites. Wherein,MmCAR AnnpgAandFaCoARoptimizing according to the codon preference of pichia pastoris, and sequentially adopting the optimized sequences as SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, and a nucleotide sequence shown in seq id no.

The specific procedure is consistent with the first aspect of the invention, wherein the sgRNA expression vector is constructed as pPICZ-Cas9-gPNSI-5 (wherein the targeting sequence of 20 bp is the nucleotide sequence shown as SEQ ID No. 16).

Further, to increase fatty alcohol yield, genes responsible for catalyzing fatty aldehydes to fatty acids are introducedKpHFD1Seamless knockout was performed.

GeneKpHFD1The specific flow of seamless knockout is consistent with the content of the first aspect of the invention, wherein the constructed sgRNA expression vector is pPICZ-Cas9-gHFD1, and the 20 bp targeting sequence is shown in SEQ ID NO:17, and a nucleotide sequence shown in seq id no. At the same time, genes were identifiedKpHFD1Sequences in Pichia pastoris (nucleotide sequence shown as SEQ ID NO: 18) and function.

According to a fifth aspect of the present application, there is provided a recombinant pichia pastoris strain synthesized from fatty alcohol constructed according to the construction method of the fourth aspect of the present application.

According to a sixth aspect of the present application, there is provided a method of constructing a recombinant Pichia pastoris strain for -olefin synthesis, the fatty acid decarboxylase gene being a critical step in the processPfUndB(the nucleic acid sequence of which is shown as SEQ ID NO: 19) and cofactor protein gene thereofCamA(the nucleic acid sequence of which is shown as SEQ ID NO: 20) and CamB(the nucleic acid sequence of which is shown as SEQ ID NO: 21) was codon optimized. Overexpression of genes in high fatty acid-producing strainsPfUndBAnd two cofactor protein genes thereofCamAAndCamBthe biosynthesis of 15 carbon and 17 carbon alpha-olefins in Pichia pastoris is realized for the first time.

Further, targeting the cofactor protein with the decarboxylase for peroxisome expression increases the alpha-olefin by a factor of two.

Further, two other codon-suitability-optimized fatty acid decarboxylase genes are overexpressed in chassis cells containing cofactor proteins CamA and CamBPpUndA(the nucleic acid sequence of which is shown as SEQ ID NO: 22) andJeOleT(the nucleic acid sequence is shown as SEQ ID NO: 23), and the biosynthesis of alpha-olefin in Pichia pastoris is realized.

In one embodiment, the gene is knocked out as described in the first aspect of the present applicationKpFAA1The recombinant pichia pastoris strain producing fatty acid is used as an original strain, so that the recombinant pichia pastoris strain overexpresses cofactor eggsWhite geneCamAAndCamBfurther over-expression of fatty acid decarboxylase genesPfUndB PpUndAOr (b)JeOleTOne or more of (a)

According to a seventh aspect of the present application there is provided a construction method according to the first or second aspect of the present application, a recombinant pichia pastoris strain for fatty acid production according to the third aspect of the present application, a construction method according to the fourth aspect of the present application, a recombinant pichia pastoris strain for fatty alcohol synthesis according to the fifth aspect of the present application, and use of the recombinant pichia pastoris strain for cell mass cultivation of the sixth aspect of the present application.

According to an eighth aspect of the present application there is provided a construction method according to the first or second aspect of the present application, a recombinant Bi Basi d erythro strain producing fatty acids according to the third aspect of the present application, a construction method according to the fourth aspect of the present application, a recombinant pichia pastoris strain synthesizing fatty alcohols according to the fifth aspect of the present application and the use of a recombinant pichia pastoris strain synthesizing alpha-olefins according to the sixth aspect of the present application in the synthesis of fatty acids and/or fatty alcohols and/alpha-olefins.

The beneficial effects that this application can produce include:

1) The application provides a construction method of a recombinant Bi Basi d erythrocyte strain for producing fatty acid, which comprises the steps of firstly knocking out fatty acyl-CoA synthetase (from genes) in a fatty acid beta oxidation pathwayKpFAA1KpFAA2Coding) and acyl-CoA oxidase (derived from a gene)KpPOX1Code) can greatly improve the accumulation capacity of pichia pastoris fatty acid, 96 h can be fermented in a shake flask containing 20 g/L glucose as a basic component medium, the yield of the fatty acid can reach 1.1 g/L, and the types of the fatty acid are mainly C16:1, C16, C18:2, C18:1 and C18. In order to explore the green conversion of a carbon resource, fatty acid fermentation with methanol as the only carbon source is performed, and the yield can reach 577 mg/L. By overexpressing the citrate lyase Aclp from mice, the citrate transporter Yhm of Saccharomyces cerevisiae and the endogenous cytoplasmic isocitrate dehydrogenase gene Idp2 of Pichia pastoris, the synthesis of acetyl-CoA in the cytoplasm is enhanced and to some extent The cell reducing power NADPH is supplemented. The final yield of fatty acid produced by methanol conversion is improved by 2.4 times compared with the control through the synergistic effect of a plurality of enzymes.

2) The application also provides a construction method of the fatty alcohol synthesis recombinant Bi Basi erythrocyte strain, which enables genes to be formed through a chromosome integration wayMmCAR npgA ADH5AndFaCoARthe fatty aldehyde dehydrogenase Hfd1 endogenous in the pichia pastoris is overexpressed and knocked out in the recombinant Bi Basi denominator strain, the synthesis of fatty alcohol is realized in the pichia pastoris for the first time, the yield of fatty alcohol under the glucose condition reaches 75.8mg/L, and the synthesis of fatty alcohol is also realized when methanol is taken as the sole carbon source.

3) The application also provides a construction method of the alpha-olefin synthesis recombinant Bi Basi d erythrocyte strain, which expresses fatty acid decarboxylase UndB, undA or OleT by a free vector in a high-yield fatty acid chassis cell with chromosome integrated cofactor proteins CamA and CamB, and realizes the synthesis of the alpha-olefin for the first time.

4) The invention realizes the synthesis of the Pichia pastoris fatty acid derivative for the first time, particularly the efficient biosynthesis of methanol to fatty acid, expands the green conversion path of methanol, and explores the application potential of the Pichia pastoris in the field of microbial cell factories

Drawings

FIG. 1 is a schematic representation of the process of construction of sgRNA in the Pichia pastoris CRISPR/Cas9 system.

FIG. 2 shows the construction of a Pichia pastoris strain for high fatty acid production.

FIG. 3 is a schematic representation of a metabolic engineering strategy to promote accumulation of Pichia pastoris fatty acids.

FIG. 4 shows fermentation of Pichia pastoris fatty acid under minimal medium conditions with 20 g/L glucose as substrate.

FIG. 5 shows fermentation of Pichia pastoris fatty acid with 20 g/L methanol as substrate in basal medium.

FIG. 6 shows an overexpressed geneMmACL KpIDP2AndScYHM2effect on fatty acid production.

FIG. 7 shows fatty alcohol synthesis strain construction.

FIG. 8 shows fermentation of Pichia pastoris fatty alcohol under basal medium conditions with 20 g/L glucose as substrate.

FIG. 9 shows fermentation of Pichia pastoris fatty alcohol in basal medium with 20 g/L methanol as substrate.

FIG. 10 shows a schematic of the construction of the alpha-olefin synthesis pathway.

FIG. 11 shows a gas chromatogram of the analysis of recombinant Pichia pastoris synthesized alpha-olefin products.

Detailed Description

The following non-limiting examples will enable those of ordinary skill in the art to more fully understand the invention and are not intended to limit the invention in any way. In the following examples, unless otherwise specified, all experimental methods used are conventional and all materials, reagents and the like are commercially available from biological or chemical companies.

Example 1

Construction of Pichia pastoris strains with high fatty acid yield

(1) Gene editing CRISPR/Cas9 system construction

The starting strain Pichia pastoris (Komagataella phaffii GS 115) was given by the university of North America Cai Menghao. The construction process of the sgRNA expression vector is shown in FIG. 1, and all the sgRNA expression vectors used in the invention are completely identical except for the 20 bp targeting sequence. Obtaining a pPICZ-Cas9 plasmid skeleton through PCR amplification, and simultaneously respectively introducing enzyme cutting sites KpnI and SpeI at two ends of the skeleton to facilitate the replacement of a gRNA part sequence of a subsequent experiment; next, P was amplified by two long primers, respectively _HTX1 And a sgRNA portion fused by overlap extension PCR to form a complete sgRNA expression cassette. Wherein the primers of the amplification sequences on both sides are immobilized as HTX1-Cas9-F (GGAGTACTTCTTGTCCATCGTTTCGACTAGTTGTTGTAGTTTTAATATAGTTTGAGTATGAGATGGAACTC) and AOX1t-Kpn-ARS-R (AAACGTCAAATCATAATCAGCACTAGGTACCGCACAAACGAACGTCTCACTTAATCTTC), and the reverse complementary sequences of 6bp in gRNA20 bp and HH are changed by a pair of long primers in the middle, and HTX1-Cas9-F and gFAA1-R (GTTTCGTCCTCACGGACTCATCAGTGAACGTTTGATTTGTTTAGGTAACTTGAAC TGGATGTATTAGTTTGG) amplification of P _HTX1 Part, gFAA1-F (CGTTCACTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCTGAACGACATGAAGACAACAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT) amplified the sgRNA part with AOX1 t-Kpn-ARS-R. Genes obtained after fusionKpFAA1The sgRNA expression cassette and the vector skeleton are connected through T4 DNA ligase, and are transformed into escherichia coli, and further PCR identification and sequencing verification are carried out to obtain the correct recombinant sgRNA plasmid for subsequent experiments.

The sgRNA expression vector involved in the present invention includes pPICZ-Cas9-gFAA1 (targeting gene)KpFAA1) pPICZ-Cas9-gFAA2 (targeting gene)KpFAA2) pPICZ-Cas9-gPOX1 (targeting gene)KpPOX1) pPICZ-Cas9-gPNSI2 (targeting chromosomal site PNSI 2), pPICZ-Cas9-gPNSI3 (targeting chromosomal site PNSI 3) and pPICZ-Cas9-gPNSI4 (targeting chromosomal site PNSI 4).

The Donor DNA construction is shown in FIG. 2. Firstly, respectively amplifying 1000 bp sequences on the upstream and downstream of a target gene coding region or a target site as homology arms, and then sequentially connecting all parts of the DONOR DNA by a fusion PCR (polymerase chain reaction) mode to obtain the complete DONOR DNA for a subsequent electrotransformation experiment to obtain a gene editing effect.

(2) Construction of high fatty acid-producing Strain

The synthesis and catabolic pathways of fatty acids in yeast cells are shown in FIG. 3, the fatty acids are synthesized via acetyl CoA via carbon chain extension, and applicants have found that by blocking the activation step of fatty acids in the beta-oxidation pathway of Saccharomyces cerevisiae fatty acids, i.e., knocking out acyl CoA synthetase (from the geneKpFAA1AndKpFAA4coding) and acyl-CoA oxidase (derived from a gene)KpPOX1Encoding) can be used to obtain a certain amount of fatty acid accumulation and prevent degradation of fatty acids. By comparing nucleotide and protein sequences, the corresponding acyl-CoA synthetase is found in Pichia pastorisKpFAA1AndKpFAA2) And acyl-CoA oxidaseKpPOX1

Based on the above, to construct a pichia pastoris strain with high fatty acid production, we first performed on the following with the aid of CRISPR-Cas9 gene editing systemKpFAA1 KpFAA2The single knockout and the double knockout of two genes are carried out, and the strain PC101 is respectively constructedKpFAA1Singly knock out), PC102 #KpFAA2Single knockout) and PC103KpFAA1AndKpFAA2double knockout). Subsequently, further steps were performed on the basis of the PC101 and PC103 strainsKpPOX1Seamless knockout of the gene resulted in engineering strains PC105 and PC106, respectively. This series of strains was used for subsequent testing of fatty acid productivity.

Example 2

Fatty acid fermentation of recombinant pichia pastoris strains

(1) Culture medium

YPD medium: 20 g/L glucose, 20 g/L peptone, 10 g/L yeast powder;

fermentation medium (basal medium): (NH) ₄ ) ₂ SO ₄ 2.5 g/LKH ₂ PO ₄ 14.4 g/LMgSO ₄ 7H ₂ O0.5 g/L, histine 40 mg/L, add about 800 mL ddH ₂ O, stirring and dissolving, regulating pH to 5.6 with KOH, fixing volume to 950 mL, and regulating pH to 115 ^o C, sterilizing for 30 min. After sterilization, 2 mL trace metal solutions and 1 mL vitamin solution were added. Different kinds of carbon sources, including 20 g/L glucose or 20 g/L methanol, were added to the fermentation medium for fatty acid fermentation.

(2) Fermentation process and conditions

Strain activation, 3 single colonies were picked from YPD streak plates in 3/15 mL YPD medium, or in Deft-G medium, 220 rpm,30 ^o C, shake culturing overnight, not more than 20 h; inoculating by fermentation according to initial OD ₆₀₀ =0.1 (inoculated in Deft-G medium), or OD ₆₀₀ =0.2 (shift-M medium). Conical flask with liquid loading of 20 mL/100 mL, 220 rpm,30 ^o And C, fermenting under the condition of C. Site-directed sampling was used for biomass (expressed as absorbance at 600 nm) and fatty acid yield analysis.

(3) Fatty acid synthesis

Successful construction is obtainedKpFAA1 KpFAA2AndKpPOX1after seamless gene knockout, we first performed under the conditions of Deft-G medium Fermentation experiments of fatty acids were performed. The experimental results are shown in FIG. 4. The fermentation process 96 h is finished, the biomass is basically not different under the condition of glucose culture, and the end point OD value is about 15, regardless of the wild type strain or the engineering strain. In terms of fatty acid accumulation, the number of the fatty acid accumulated was increased by a certain amount in comparison with the wild type strain, with the number of the knocked-out genes being increased, and the fatty acid yield was more than 1 g/L. In the Pichia pastoris, the types of fatty acids accumulated in the Pichia pastoris are mainly C16:1, C16, C18:1, C18:2 and C18, wherein three kinds of fatty acids of C16, C18:1 and C18:2 are taken as main materials, and the fatty acids account for more than 80% of the total yield of the fatty acids.

Subsequently, we performed fatty acid fermentation experiments on the Deft-M medium, the results of which are shown in FIG. 5. The initial carbon source amount is 10 g/L methanol, and 10 g/L methanol is added when about 48 h is fermented and cultured. The biomass of the Pichia pastoris engineering strain with the gene knocked out in the fermentation process 120 h is approximately similar no matter how many genes are knocked out, and the DO value reaches about 9. The wild type strain was similar to glucose medium in terms of fatty acid yield, with only small amounts of fatty acid accumulated. Knock-out KpFAA1After the gene, more fatty acid accumulation is obtained, the yield exceeds 200 mg/L,KpFAA1 KpFAA2andKpPOX1the triple knockout strain obtained the maximum fatty acid yield under methanol culture conditions, reaching 577 mg/L. During methanol culture, the main types of accumulated fatty acids are consistent with glucose, namely C16:1, C16, C18:1, C18:2 and C18, wherein the proportion of C16:1 is slightly increased. The invention realizes the efficient synthesis of the one-carbon resource methanol to the long-chain fatty acid for the first time.

Example 3

Enhancement of the acetyl-CoA synthetic pathway

acetyl-CoA is a very important intermediate of basal energy metabolism and is also a direct precursor for the synthesis of fatty acid compounds by yeast cells. A substantial increase in fatty acid synthesis may lead to intracellular acetyl-coa deficiency. In addition to the entry of pyruvate from the glycolytic pathway into mitochondria to acetyl-CoA, a set of citrate lyase (ACL) systems, lines, are present in microorganismsThe citrate produced in the granules can cross the inner mitochondrial membrane and be broken down in the cytosol by the action of citrate lyase, yielding acetyl-coa and oxaloacetate. Applicants have found that overexpression of the citrate lyase gene derived from mice MmACLWhen the fatty acid yield is increased by 19.4%. In Saccharomyces cerevisiaeYHM2The gene coded protein is responsible for transporting the citric acid in mitochondria into cytoplasm, simultaneously transporting alpha-ketoglutarate in cytoplasm into mitochondria to participate in citric acid circulation, and overexpressing genesYHM2Also beneficial to fatty acid synthesis (Yu et al cell., 2018, 174:1549). Since fatty acid biosynthesis consumes a large amount of cellular reducing NADPH, especially when methanol is used as a substrate, a strong pentose phosphate pathway is lacking, intracellular NADPH is severely deficient, which may be one of the reasons for lower production of methanol as a substrate than glucose. Isocitrate dehydrogenase 2 (derived from GeneIDP2Code) is responsible for the conversion of cytoplasmic citrate to alpha-ketoglutarate, with the production of an NADPH, which allows the circulation of citric acid inside and outside the mitochondria, also favoring the production of fatty acids (Yu et al cell., 2018, 174:1549.). Therefore, we overexpress the citrate lyase gene from mice in Pichia pastorisMmACLCitric acid trans-mitochondrial membrane transporter gene derived from saccharomyces cerevisiaeScYHM2Isocitrate dehydrogenase gene derived from Pichia pastoris endogenous KpIDP2

Since Pichia pastoris belongs to non-traditional yeast, the repair process is mainly non-homologous end connection, and homologous recombination is difficult to occur, and therefore, the over-expression initial strain of the exogenous gene is enhanced by homologous recombination (high expressionKpRAD52The nucleotide sequence of the gene is shown as SEQ ID No. 24) and the engineering strain improves the gene editing efficiency. The starting strain GS115 used was a His auxotrophic strain, and thereforeHIS4The gene can be used as a target point of gene overexpression. First, similar to example 1, the HTX1 promoter portion was amplified using primers HTX1-Cas9-F and gHIS4-R (GTTTCGTCCTCACGGACTCATCAGAACGAGTTTGATTTGTTTAGGTAACTTGAACTGGATGTATTAGTTTG), gHIS4-1-F (CTCGTTCTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCAACGAGAGCAGACTACACCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT) amplifying the sgRNA fraction with AOX1 t-Kpn-ARS-R. Genes obtained after fusionHIS4The sgRNA expression cassette and the vector skeleton are connected through T4 DNA ligase to construct the sgRNA expression vector pPICZ-Cas9-gHIS4 (wherein the targeting sequence of 20 bp is a nucleotide sequence shown as SEQ ID No. 25).

When constructing an integrated Donor DNA, a pair of primers PpRad52-GAPp-F (TTCAATCAATTGAACAACTATCAAAACACAATGTCTTTCGATGACGCTGAGC) are first used

PCR amplification with PpRad52-AOX1t-R (AGGCAAATGGCATTCTGACATCCTCTTGATTAATTCGAAGCTGGAGAGTTTTCTTTTCCT) to obtain Pichia pastoris endogenousKpRAD52The gene sequence is subjected to overlap extension PCR and promoter P _GAP And terminator T _AOX1 Fusion to obtain the Rad52 protein expression cassette. Then the homologous arm region sequences of 1000 bp respectively at the upstream and downstream of the Pichia pastoris HIS4 gene are obtained by the same PCR amplification method, and the complete sequence is obtained again by the fusion PCR methodKpRAD52The gene overexpresses the donor DNA, and subsequent transformation and identification steps are the same as in example 1, thereby obtaining a pichia pastoris recombinant strain that overexpresses the Rad52 protein and thereby enhances homologous recombination.

Based on the above, knockout is carried outKpFAA1. The engineering strain uses methanol as the only carbon source to carry out fatty acid fermentation performance detection, the fermentation conditions and the detection method are consistent with the embodiment 2 of the invention, and the result is shown in figure 6. Overexpression of genes alone at PNSI-2 locusMmACLDuring the process, the synthesis path of acetyl coenzyme A in cytoplasm is enhanced, and the yield of fatty acid is increased by 19.1% compared with that of the original strain, and reaches 206 mg/L. Continuing to overexpress the gene on the basisKpIDP2The supply of cellular NADPH is compensated to a certain extent, and the yield of fatty acid is improved by 24.3 percent compared with that of PC 115. Finally, the citric acid transporter ScYHM2 of the saccharomyces cerevisiae from an over-expression source enhances the upstream step of acetyl coenzyme A, strengthens the citric acid transport and metabolic process of cytoplasm and mitochondria, ensures that the yield of fatty acid reaches 410 mg/L in the key point of the fermentation process, improves the metabolism transformation in the last step by 60.5 percent, and is 2.4 times of the yield of the original strain.

Example 4

Synthesis of fatty alcohol from pichia pastoris

(1) Construction of fatty alcohol Synthesis Strain

Saccharomyces cerevisiae (Zhouet al J. Am. chem. Soc., 2016, 138 (47): 15368-15377.) was previously constructed in the laboratory to produce fatty alcohols, on the basis of which we selected 4 key genes of the fatty alcohol synthesis pathway, the alcohol dehydrogenase geneScADH5Fatty acyl-coa reductase geneFaCoARCarboxylic acid reductase geneMmCARCofactor genesAnnpgAExpression (FIG. 7) was performed, and it was desirable to be able to achieve the synthesis of fatty alcohols in Pichia pastoris. At the same time, the key genes are selectedFaCoAR(the nucleotide sequence is shown as SEQ ID NO: 13),MmCAR(nucleotide sequence is shown as SEQ ID NO: 14) andnpgA(the nucleotide sequence is shown as SEQ ID NO: 15) the codon optimization is carried out. The FAA1 gene of Pichia pastoris is knocked out firstly by means of a Pichia pastoris CRISPR-Cas9 system established in the early stage of a laboratory so as to realize accumulation of fatty acid, and the knocking-out method is the same as that of the embodiment 1. Also, the basis of laboratory preliminary study is used for geneKpHFD1Seamless knockouts are made that catalyze the reverse reaction of fatty aldehydes to fatty acids. Can effectively prevent fatty aldehyde from being reoxidized after knocking out, and increase the supply of precursor substances for fatty alcohol synthesis. Thus, before constructing fatty alcohol pathway, first to KpHFD1Knocking out genes to obtain the recombinant chassis strain. Finally, the 4 genes are integrated into PNSI-2, PNSI-3, PNSI-4 and PNSI-5 sites by complete expression cassettes, and a fatty alcohol synthesis pathway in Pichia pastoris is constructed.

(2) Fatty alcohol fermentation experiment of Pichia pastoris

The fermentation process and parameters were essentially the same as in example 2, and after obtaining the correct recombinant strain, fermentation analysis of the fatty alcohol production of the strain was first performed in a basal medium containing 20 g/L glucose, and 2ml of fermentation broth was taken at the end of the 72 h fermentation and analyzed. As shown in FIG. 8, the constructed recombinant Pichia pastoris strain successfully realizes the biosynthesis of fatty alcohol, and the main fatty alcohol products are C16-1-OH, C16-OH, C18-1-OH and C18-OH, wherein the yield of C18-1-OH can be close to 30 mg/L, so that the recombinant Pichia pastoris strain is the fatty alcohol with the highest yield, and the total fatty alcohol yield of Pichia pastoris reaches 76 mg/L, so that the recombinant Pichia pastoris strain is the highest yield in Pichia pastoris at present.

The potential of recombinant pichia pastoris for producing fatty alcohol by taking methanol as a substrate is also explored, and fermentation analysis of fatty alcohol production of recombinant pichia pastoris strains is carried out in a basic component culture medium containing 20 g/L methanol. As shown in FIG. 9, the constructed recombinant Pichia pastoris strain also successfully realizes the synthesis of fatty alcohol by using methanol, and compared with the glucose culture condition, the main fatty alcohol product type has no C16-1-OH detected, and the other three fatty alcohols can be successfully detected. When the recombinant strain methanol is used as a carbon source, the total yield of fatty alcohol is about 3 mg/L.

Example 5

Synthesis of alpha-olefin by pichia pastoris

Long-chain (C12-C20) alpha-olefins are mono-olefins with double bonds at molecular chain ends, and are important raw materials for preparing various chemical products such as aviation fuels, plasticizers, high-performance synthetic lubricating oil, detergents, fragrances and the like. The recombinant pichia pastoris strain with high fatty acid yield is successfully constructed in the early stage, the embodiment further converts the fatty acid into alpha-olefin, and the pichia pastoris is expanded to be used as a product catalog of a microbial cell factory. Pre-laboratory screening to a sourcePseudomonas fluorescens Pf-5Fatty acid decarboxylase genes of (2)PfUndBThe Saccharomyces cerevisiae engineering bacteria with the exogenesis introduced into the high-yield fatty acid can realize the biosynthesis of long chain alpha-olefin (Zhou et al ACS. Synth. Biol., 2018, 7:584-590.).

The high-yield fatty acid strain PC101 constructed in the earlier stage is taken as an initial strain, and the cofactor protein gene is overexpressedCamAAndCamBP _ADH2 the driving expression is integrated into PNSI-3 and PNSI-4 sites to construct chassis cells. Fatty acid decarboxylase genesPfUndB PpUndAAnd JeOleTFrom the strong promoter P _GAP Expression was driven, integrated into PNSI-5 sites (as shown in FIG. 10), and the correct recombinant strain was screened for use in alpha-olefin fermentation detection experiments. The fermentation conditions were the same as in example 2, with an initial inoculation OD of 0.1 at 30in a basal medium containing 20 g/L glucose, 220 72 h were cultured at rpm. After fermentation, 5 mL broth was collected, centrifuged to remove supernatant, and resuspended in 1 mL ddH2O and lyophilized. Chloroform was used: methanol=2: 1 as extractant, 1 mg/L hexadecane as internal standard, and gas chromatography to detect alpha as olefin yield. The supernatant was extracted with 2. 2 ml, 1. 1 ml of n-hexane containing 1. 1 mg/L hexadecane as an internal standard, and the product was analyzed by gas chromatography.

As a result of the experiment, as shown in FIG. 11, a fatty acid decarboxylase gene was expressedPfUndBAnd cofactor protein genes thereofCamAAndCamBthe synthesis of alpha-olefins was successfully detected by pichia pastoris strains. The gas chromatographic analysis results show that the alpha heptaolefin of the 1-pentadecene and the 1-heptadecene respectively show peaks at 18.4 min and 20.7 min, which are consistent with the standard substance. The product was then subjected to GC-MS detection, further verifying that the peak was indeed the target product.

Since the direct precursor of alpha-olefins is a fatty acid and peroxisomes are one of the main sites where beta oxidation of fatty acids occurs, it is possible to further increase the yield of alpha-olefins by targeting the synthetic pathway of alpha-olefins to peroxisomes. The localization expression of peroxisome can be realized by adding short peptide SKL at the C end of protein. Therefore, the experiment constructs a alpha-olefin synthesis path of the targeted peroxisome by connecting SKL positioning short peptide at the C end of cofactor protein and three fatty acid decarboxylases through GGGS, and the targeted peroxisome can be found out by fermentation detection, so that the yield of the alpha-olefin can be improved by the targeted peroxisome, thereby PfUndBFor example, the alpha-olefin yield is doubled, reaching about 2.5 mg/L. Furthermore, since PfUndB is a membrane chimeric protein, some of the product is transported to the outside of the cell, whereas production of the product -olefin is not detected by the outside of the cell when the recombinant strain of PpUndA is fermented. The catalytic effect of PfUndB was the best among the three decarboxylases.

The example results confirm that the pichia pastoris can realize the synthesis of alpha-olefin through expressing fatty acid decarboxylase and cofactor protein for the first time, verify that various fatty acid decarboxylase can play a role in the pichia pastoris, explore the feasibility of developing the pichia pastoris as a high-efficiency microbial cell factory for producing fatty acid derivatives, and lay an experimental foundation.

The foregoing description is only a few examples of the present application and is not intended to limit the present application in any way, and although the present application is disclosed in the preferred examples, it is not intended to limit the present application, and any person skilled in the art may make some changes or modifications to the disclosed technology without departing from the scope of the technical solution of the present application, and the technical solution is equivalent to the equivalent embodiments.

Sequence listing

<110> institute of chemical and physical of Dalian of academy of sciences of China

<120> a recombinant Pichia pastoris strain, construction method and application thereof

<130> DD200234I

<141> 2020-06-08

<160> 25

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> An artificial sequence

<400> 1

tgaacgacat gaagacaaca 20

<210> 2

<211> 20

<212> DNA

<213> An artificial sequence

<400> 2

gctaggtcag aagagggcaa 20

<210> 3

<211> 20

<212> DNA

<213> An artificial sequence

<400> 3

aaaatcttgg gactttccgg 20

<210> 4

<211> 2106

<212> DNA

<213> An artificial sequence

<400> 4

atggtgtttc aagtaaatgt tcctgtgggc gaagctagaa agggtgaaac agctcccaga 60

agatactaca aggttaaaga tgcagcggtg ctcaaaccga gtgactgtaa cccgaaaact 120

gaaactgttt acgattactt ggttgaaatg tttgaacgac atgaagacaa caaggctatg 180

gcttggaggg atctcgttga tattcatact gagaagaaga aggtcaacaa aatgattgat 240

ggtgagctaa aaaatattga aaaagaatgg caatattacg aattaagtga ttacaaattt 300

atcacttaca aagagctgaa atcgataatt tttgaatatg gccggggcct tgtggaatta 360

ggtatcaagc cgaatcagga ggaacggctg catatatatg cttcaacatc acacaagtgg 420

ttccaaacat atttggcaac tcaaactcaa aacattccaa tagtaactgc gtatgacacc 480

ctcggtgaaa gtggtttaac tcattcttta gtgcagacag gttctgtggc gattttcacc 540

aacaatgacc ttcttcacac tctcatcaac ccgttgaaga aagcggtttc ggtgcgtttt 600

attatccaca ctgaaaaact tgattccagt gacaagagat atggtggaaa actttaccag 660

gatgctcaag tcgcaattga tgagatcaag agaactcatc ccgatatcaa gttcatctca 720

tatgatgaaa tagttgcctt aggccgaggc tccaagttga atgctattcc tcccaaagct 780

gatgaccttt cgtgtattat gtacacatca ggatctacag gcactcccaa aggtgtggtt 840

ttaagtcata gaaacgtact tgccggtatt ggtggtgcct ccactttagt tcctagaagc 900

ctaattaatg ggaaagaccg aatcattgca tttcttccat tggcccatat ttttgagtta 960

gtatttgaat tgatctcctt gtggtggggt ggatgtttag ggtatgctaa cgtgaagact 1020

ttgactgatg cttccatccg aaattgccaa tccgacctga aggccttcaa accaacgatc 1080

atggttggtg ttgctgctgt ttgggagtcg gttagaaaag gtattcttga tcagctgaac 1140

aaatcccctt ttctattaca aaaagtattt tggggagcct acaaaagcaa acaagcaatg 1200

aagtactgcc atattcctgg cacttcaatt attgatgcgg taatttttcg caaggtaaag 1260

gctgctactg gtggtgaaat tcgccttctg cttaacggtg gatcacccat ttctgcggat 1320

acccaacgat ttatcacaaa ccttcttgct cccatgctct taggttacgg tttaacagag 1380

acagttgcta atacatgtat cacggatatc gacaactttg agtttgatgt tgccggtgca 1440

ttgactggcg ctgttaccgt caaattaata gacgttccag aagctggtta ttttgcaaag 1500

aataaccaag gagaagtgtt gattcaggga gcatgtgtta caaaagagta ctataagaat 1560

gagcaagaaa ctgcaagtgt ttttgattac gaaaaaggtt ggttcagtac tggtgatatt 1620

ggagaatgga cgtcgtcggg gcagctaaaa gtaatagacc gtaagaaaaa tctgattaaa 1680

acactgaatg gtgagtatat cgctttggaa aagatagagt ccgtatatcg atctaacagc 1740

tatattcata atgtttgctg ctatgctgat cagaataaat ccaaaccagt agcaatcgct 1800

gttccaaacg agaccacgtt gcgcaagctt gctgttcaac tgaagctagc aagcgctgtt 1860

gatgaggtcg acttagcaaa ggtagtccac gattctaaat tgatctccaa agtacaccaa 1920

tctcttctgg agacggctaa gcagcaaggt ctaactggaa tagaattgat tcagggtgtc 1980

gttattttgg atgaagaatg gactcctcag aatgggtttg taacctcagc tcaaaaattg 2040

caacgcaaga aaattttgga gagtgtcaag gatcgtgtcg atgaagtata taggcaaaac 2100

agttga 2106

<210> 5

<211> 2226

<212> DNA

<213> An artificial sequence

<400> 5

atgtcacatc tcaaaaagat ccaggatagg actccggtcg agagtttgtc acctcaggac 60

aaaaaggaaa tcaagtcgct ctttgacagt ctgccattgc cctcttctga cctagctaac 120

tcctacgcag tcccagggtc agccaaaact ggatattcac ctacattcag aaatagttat 180

gtcagaaacg gatcgttgat cgagacgcta catccttctc tgaggactct gcatgagttg 240

ttcagtaact ctgttcagtt gtatggagaa agggactgtt tgggttctag actttatgac 300

catgatgtaa aggacggtta tgacgattat ttcacgtttg agaactacag gacgatttgc 360

gaacgaaagt ctaatttggg agctggtata attcattccg tgctagataa cgaatacaga 420

attgacccaa aagacggcgg ttttgacctt gcagattata acaccaataa cttcattgtc 480

agtctgtatg gtagaaatag ggctgaatgg gtgctatctg atttggcctg tcaaacctac 540

agtttaccgg acactgcatt gtatgataca ttaggaccca caacttccgc ttatatcctt 600

gagctgacaa agtctccagt agtaatttgc tgcgctgaga agattgaaaa acttattgag 660

ctcaagacaa acaatccaga gtcactcaag cattttatca ccatcatttc tatggataat 720

cttgattttc aagatttttc catcaacgac cttataaaaa gagccaacag tgttcaaatt 780

aaactgttag atttgggaca aacagaagag ctgggtaagg cttctcctgt ggcagaaata 840

cctccacttc cttcgaccat atacactatt tcgtttacct caggaaccac tggagttccc 900

aagggagtag tattgacaca caaaatagcc actgcagcag ccacgtttgc tttatcgcat 960

atagggcttc ctgacagcgg aagaacgctg agtattcttc ccttggctca tatttttgaa 1020

aggcaagtat ccaatctagc gcttgtcgct ggagtagctt taacattccc acatctccca 1080

ggcccagagc atattgttcc aaaccttcgt ataagtaaac cttgtgctct aactgctgtg 1140

ccgagattgt ataacaagtt tgaaagtgca atcaagtctt cccttctaag tggaccggag 1200

acaattaccc agaagctggt ttccgccata attagccaaa acatccgaac tcaatcggcc 1260

aaagatggga ataagggcaa caattttatt tcacgacaat tggtcacaaa gaaaatcagg 1320

gcatctttag gattagataa ctgtcaattc ttggttactg gctcagcacc cattgaccca 1380

gaaacgatga agttcttgaa gggatctcta ggagttggat ttatgcaagg ttatgggcta 1440

acggaatgtt atgctggaat ctgcatctca tcagcttatc tgaaagaaaa tggttcctgt 1500

ggtgccattg ggatatctgc tgaaatgagg ttgagagatg tgcctgaaat gaactatttc 1560

tctggaaaac aacttgcgga tgggtcgtat cacggtgagc tgcaattacg tggtcctcag 1620

gttttcagct actactataa aagacccgat gagactgaaa aagcatttga taaagacggc 1680

tggttctgta ctggagatat tgctagaatt gacaaaaatg gaaagcttta cattattgac 1740

agagttaaga attttttcaa attatcccaa ggggagtacg taacaccaga gaaaattgag 1800

aacatttacc ttagtagttc tcctttgatt tcacaagttt tcattcatgg tgactctctg 1860

cattcttttt tggtggctgt tgttggtgta gatgaaacgt ttttcaataa tttgagatca 1920

gttgacccgt caatcattaa gaattatgaa ctcaaatcca ctgaagacac cattgaaaaa 1980

tgcaatgcta ataaagattt gaagagatct cttctctttc tattcaataa gagtgtcgaa 2040

agtgctggat tgttgggttt tgaaaaaatc cacaactttc accttgcgtt tgaaccgtta 2100

aagattgaag acgatactct gactcctacg tttaaacttc gtagggttca agccaagcac 2160

aaatttgaca ccgaattggc taatttgtac aatgagaaga gtcttctgag ggagactaag 2220

atgtag 2226

<210> 6

<211> 2112

<212> DNA

<213> An artificial sequence

<400> 6

atgttcaaaa ttgaatcgat caaaagtcag tcgccgcagg tggccattga caaggagaga 60

aaagctacca agtttgatat caacaagatg tttgaatttt tggagagtgg caaggatgaa 120

gctgctctca caaagtctct gatgcaacaa atcgaaagag acaccatctt gaaaactaat 180

gccagttatt acgacttgac gaaagaccag cacagagagc tcacagctca gaagatcgcc 240

agattggcta cttatattga aaaggatgcc ccattctttg agaacttcca aaagagactg 300

aatctcattg ctattgttga tccacaacta ggtacgagag ttggggtcca tcttggattg 360

tttctgagtg caattagagg caacggtacg gaggaacagt tcaagtattg ggctttcgaa 420

cgtggtgccg cctacttgaa ggatgtgtat ggctgtttcg gtatgactga attagcccac 480

gggtcaaatg tggcgggtct ggaaaccaca gctacatttg atcaaaagac taaagagttt 540

gaaatcaaca cccctcattt gggtgccacc aaatggtgga ttggaggagc tgcccattct 600

gcaaatcact gtgtggtgta tgccaggtta attgtcagtg gtaaggatta cggagtgaaa 660

acttttgttg tccccatcag agacagaaat cataacttac attccggtgt ggctattggt 720

gacattggcg ctaagatggg cagagatggt attgacaacg gttggattca atttaccaac 780

gtccgaatcc cgatgaacta catgctgtcc aagtttacta aagtggactc agagacagga 840

gatgtagagg ttccaccttt ggagcagcta gcgtacggag ctttgctggg tggaagagtt 900

acaatggtta ccgattcttt tagaatggca cagcgtttca tcaccattgc tctaagatat 960

tccgttggaa gacgacagtt tggcgccaaa aattcctcag aggaactcaa attgattgac 1020

tacccattgc accagcgtcg tcttcttcct tacttggccc tgacctatgc tctgtcaata 1080

agttcttttg atttgtccca aacttatgac tccgttttga gtaatctaga tgccgccgga 1140

aagtcccaag atttttctaa gttgggccaa gcgattgccg gacttaagaa ccttttctgt 1200

gcttctgctt ctctgaaatc tactgcgacc tggtatgttg cccagctgat tgacgagtgt 1260

agacaggcat gtggtggaca tggatattcc tcgtattccg ggtttggtaa agcatataat 1320

gattgggttg ttcaatgtac ctgggaggga gataacaaca tccttgcaag taatgccggt 1380

aggattattg tgcaatctat tatcaagttg caagaaaagg aaaagaagat aaagggtgac 1440

ttgtcatact tgaatggaat cagcaatatc gacaaggaag ctattctgct tcctaacaaa 1500

caaagtatga ccaacttgtc caagttgatt aatgcctatc agggtaccat tatccgtcta 1560

ggtgtacgtt gtgccgaatc catcggaagc aaaaagtcca catgggatga catagcagct 1620

caacgagtag tcctttccaa attgaatgct gttttatata tgctgcaaca tttggttttg 1680

aaaattaaac aacttggaga cgaggaagct cacaaacaat accttgttca aattgcagct 1740

ttgtttgcaa cctcacagat agaaatgaat tttgcatctt atttcttaca attcaaggcc 1800

atcgattcgt tggaacctgt tgctgatgtt gtgtctgaac tgtgcttatc agtgcgggac 1860

caagtcattg gattgactga ctctttccaa ttttcggact actttatcaa ctctgcattg 1920

ggatcacatt ctggagacat ttacaatacc tactttgaca ctgttaacaa tctgaacaat 1980

ccgcaagtca gggacggaaa ggcggcatac tccgaggcac ttgaagccat gctacgtagg 2040

gacccactag aagtgcggga atgctttgag aagagtgaca aagtattgaa gaagttggct 2100

cctaagattt ag 2112

<210> 7

<211> 20

<212> DNA

<213> An artificial sequence

<400> 7

ggttggtact atgtccaaca 20

<210> 8

<211> 3306

<212> DNA

<213> An artificial sequence

<400> 8

atgtccgcta aagctatttc cgaacaaact ggtaaagaat tattatacaa gtacatttgc 60

accacctcag ccatacaaaa cagattcaag tatgcaagag ttacaccaga taccgactgg 120

gcccatttgt tacaagatca cccttggttg ttatctcaat cattggttgt caaacctgac 180

caattgatta aaagacgtgg taaattgggt ttagtcggtg taaacttgag tttagatggt 240

gttaagtctt ggttgaagcc aagattaggt catgaagcta cagttggtaa agcaaagggt 300

ttcttgaaaa atttcttgat cgaaccattc gtacctcact cacaagctga agaattttac 360

gtttgtatct atgcaactag agaaggtgac tatgtcttgt ttcatcacga aggtggtgtt 420

gacgtcggtg acgttgacgc caaagctcaa aagttgttag taggtgttga tgaaaagtta 480

aacacagaag acatcaagag acatttgttg gtacacgccc cagaagataa aaaggaagtt 540

ttggcttcct ttataagtgg tttgtttaat ttctacgaag atttgtactt cacctacttg 600

gaaattaacc ctttagtagt tactaaggat ggtgtctata tattggactt agctgcaaaa 660

gtagatgcaa ctgccgacta catctgtaag gttaagtggg gtgacattga atttccacct 720

ccattcggta gagaagcata tccagaagaa gcctacattg ctgatttgga cgcaaaatct 780

ggtgcctcat tgaagttaac attgttgaac cctaagggta gaatatggac tatggttgct 840

ggtggtggtg caagtgtcgt atattctgat acaatctgcg acttgggtgg tgttaacgaa 900

ttagctaact acggtgaata ctcaggtgca ccatccgaac aacaaactta tgattacgct 960

aagaccatct tgagtttaat gactagagaa aagcatcctg aaggtaaaat tttgatcatc 1020

ggtggttcta tagcaaactt cactaacgtt gccgctacat tcaagggtat agtcagagct 1080

atcagagatt atcaaggtcc attgaaggaa cacgaagtta caatattcgt cagaagaggt 1140

ggtcctaact accaagaagg tttaagagta atgggtgaag ttggtaaaac tacaggtatc 1200

ccaattcatg tatttggtac tgaaacacac atgactgcca tcgttggtat ggctttaggt 1260

catagaccaa ttcctaatca acctccaaca gcagcccaca ccgccaattt cttgttaaac 1320

gcttccggta gtacctctac tccagcacca tcaagaactg cctcattctc cgaaagtaga 1380

gctgatgaag ttgctccagc taagaaagca aaaccagcca tgcctcaaga ctccgttcca 1440

agtcctagat cattgcaagg taaatcagca acattatttt ccagacatac caaagccatt 1500

gtatggggta tgcaaacaag agctgttcaa ggcatgttgg atttcgacta tgtttgtagt 1560

agagatgaac catctgtcgc tgcaatggta tatcctttta ccggtgacca taaacaaaag 1620

ttctactggg gtcacaagga aatattaatc ccagttttta aaaacatggc cgatgctatg 1680

aaaaagcatc ctgaagttga tgtattgatt aacttcgctt cattaagatc cgcttatgat 1740

tctactatgg aaacaatgaa ctacgcacaa attagaacca tagctatcat tgcagaaggt 1800

ataccagaag cattgactag aaagttaatc aaaaaggccg atcaaaaagg tgtcactata 1860

atcggtccag ctacagtagg tggtataaaa cctggttgtt ttaagatcgg taatactggt 1920

ggcatgttgg ataacatatt ggcatcaaaa ttgtatagac caggttccgt agcttacgtt 1980

tcaagaagcg gtggtatgag taacgaattg aacaacataa tttcaagaac cactgatggt 2040

gtttatgaag gtgtcgctat tggtggtgac agatacccag gttctacttt tatggatcat 2100

gttttgagat atcaagacac acctggtgtc aaaatgatcg ttgtcttagg tgaaataggt 2160

ggtactgaag aatacaaaat ttgcagaggt ataaaggaag gtagattgac aaaaccagta 2220

gtttgttggt gcattggtac ttgtgcaact atgttttctt cagaagttca attcggtcat 2280

gcaggtgcct gcgctaatca agcatctgaa acagcagttg ccaaaaacca agccttaaag 2340

gaagctggtg tttttgtccc tagatcattc gatgaattgg gtgaaatcat tcaatccgta 2400

tatgaagact tagttgccaa gggtgctatt gtcccagctc aagaagtacc tccacctact 2460

gttcctatgg attactcatg ggcaagagaa ttgggtttga tcagaaagcc agctagtttt 2520

atgacctcta tctgtgatga aagaggtcaa gaattgatct atgctggtat gcctatcact 2580

gaagtcttca aggaagaaat gggtatcggt ggtgtattgg gtttgttgtg gttccaaaga 2640

agattaccaa agtactcatg tcaattcata gaaatgtgct taatggttac agctgatcat 2700

ggtccagctg tttctggtgc ccacaacacc ataatctgcg ctagagcagg taaagatttg 2760

gtttcttctt tgacctctgg tttgttaact attggtgaca gatttggtgg tgcattggac 2820

gccgctgcaa aaatgttttc aaaggctttc gattccggta taatcccaat ggaatttgtt 2880

aataagatga aaaaggaggg taaattaatc atgggtatcg gtcatcgtgt taagtcaatt 2940

aataaccctg atatgagagt ccaaatattg aaggacttcg taaagcaaca cttcccagca 3000

acacctttgt tagattacgc cttagaagtt gaaaagatta caacctctaa aaagccaaat 3060

ttgatcttga acgttgatgg ttttataggt gtcgctttcg tagacatgtt aagaaactgt 3120

ggttctttta ctagagaaga agccgatgaa tatgttgaca ttggtgcttt gaatggtata 3180

tttgtcttag gtagatcaat gggttttatt ggtcattact tggatcaaaa gagattaaag 3240

caaggtttgt atagacaccc ttgggacgat atttcctacg ttttgcctga acacatgagt 3300

atgtaa 3306

<210> 9

<211> 20

<212> DNA

<213> An artificial sequence

<400> 9

tgtgtctttg aagcacacag 20

<210> 10

<211> 20

<212> DNA

<213> An artificial sequence

<400> 10

ttgtggctat ggcttgaatg 20

<210> 11

<211> 1239

<212> DNA

<213> An artificial sequence

<400> 11

atggctcatg caaaaatttc agtgaagact ccattagtgg agatggatgg tgatgaaatg 60

acgagaatca tctggaaact catcaaagat gagttgattc ttccattttt ggatatcgac 120

ctaaagtact acgacttggg aatcgagtat agagatcaaa ccgacgacca agtcactata 180

gatgctgctg aggccatcaa gaagtatggt gtcggtgtca agtgtgccac cattacccca 240

gatgaagcca gagttgagga gtttggtttg aagaaaatgt ggctgtctcc caacggtaca 300

atcagaaaca tattgggcgg aaccgttttc agagagccaa ttgtcattga caacatccca 360

agaattattc ctcagtggga gaagccaatt atcattggaa gacatgctta cggtgaccaa 420

tatagagcca ccgatttgct gattccaaaa gctggtgagt tgaagttggt tttcactcca 480

aaggacggat ctgaccctgt cgagacaaag gttttcgact acccatctgc cggtgtcgct 540

ctgactatgt acaacttgga tgattctatc cgagactttg ctctttcctc cttcaaactt 600

gctctagaaa agaaagtgaa cctgttctcg accaccaaga ataccatcct gaagaaatat 660

gatggtagat tcaaagacat ctttgacgaa acgtacgaaa cacaattcaa agaatctttt 720

gagaaggccg gtatttggta tgagcaccgt ctcattgacg atatggttgc tcagatgttg 780

aaatcaaagg gaggctatat cattgctatg aagaactacg atggtgacgt gcaatccgac 840

attgttgccc aaggtttcgg atctttaggt ttgatgacct ctgttttgac gaccccagat 900

ggaactgctt ttgagagtga agctgctcat ggaaccgtca ctagacatta cagacaacac 960

cagcaaggta aggagacctc caccaactct attgcctcta tcttcgcttg gactagaggt 1020

ttaattcaaa gaggactact ggacaacact cttcctgttg ttgagtttgg tcaacttctg 1080

gaaaatgcca ctatcaacac agttaaattg gatggaatca tgaccaaaga tctcgctctt 1140

gcaagaggtg agactgacag atcttcttat gtgaacactg aggagtttat caaagctgtt 1200

gctaagagat tgactagtga gtttgaagcc aagttttag 1239

<210> 12

<211> 945

<212> DNA

<213> An artificial sequence

<400> 12

atgccatcta ccactaatac tgctgcagca aacgtaatag aaaaaaagcc agtctcgttt 60

tctaatatcc tattgggtgc ctgtttaaac ttgtcagagg tgactacatt agggcaacct 120

ttggaggttg ttaagaccac aatggctgca aacagaaact tcacattttt agaatctgtt 180

aagcatgtct ggtcaagagg tggtatcttg ggttactacc aaggtttgat tccatgggca 240

tggatcgaag cctccactaa aggtgctgtg ttgctgttcg tgtcagctga ggctgagtat 300

cgtttcaaaa gtttggggtt gaacaacttt gcctcaggta tattaggtgg tgtcacgggt 360

ggtgtcactc aagcctactt aaccatgggg ttctgtacct gtatgaaaac ggtggaaatt 420

acaagacata aatctgcctc cgcaggtggt gtcccacaat cttcttggag tgtgttcaag 480

aatatttata aaaaggaagg tattagaggt attaataagg gtgttaatgc tgttgctatt 540

agacaaatga ccaactgggg ttctcgtttt ggtttgtcca gactagtgga agatggtatc 600

agaaagatca ccgggaaaac caataaagac gacaagttga atccgttcga gaaaattggt 660

gccagtgctt taggtggtgg tttaagtgct tggaatcaac caatcgaagt cattagagtt 720

gaaatgcaat ctaagaagga agatccaaac agaccaaaaa atttgactgt tggtaagaca 780

tttaaataca tctatcaatc aaatggtcta aagggtcttt accgtggtgt caccccaaga 840

attggtttag gtatctggca aactgtcttc atggttggtt ttggtgatat ggcgaaggaa 900

tttgtcgcca gaatgactgg tgaaacccca gttgccaaac attag 945

<210> 13

<211> 3525

<212> DNA

<213> An artificial sequence

<400> 13

atgagtccta tcactaggga ggagaggttg gagagaagga tccaagatct ttacgctaac 60

gacccacagt tcgctgccgc caaaccagct accgctatca ccgctgctat cgaaaggccc 120

ggacttccac ttccacagat catcgaaacc gtcatgactg gttatgccga tagaccagct 180

cttgcccaga ggagtgtcga attcgtcact gacgccggta ctggacacac cactttgagg 240

ttgttgcctc acttcgaaac catcagttat ggtgaattgt gggatagaat cagtgccctt 300

gccgacgtct tgagtaccga acagaccgtt aagcccggag atagagtctg cttgcttgga 360

ttcaacagtg tcgactatgc cactattgac atgacccttg ctaggttggg agctgttgct 420

gtccctttgc agacctctgc cgctattacc cagcttcagc caattgtcgc cgaaactcaa 480

ccaactatga tcgctgcctc tgttgatgct ttggctgatg ccaccgagct tgctctttct 540

ggtcaaaccg ccactagggt ccttgtcttt gaccaccata gacaagtcga tgctcataga 600

gctgctgtcg aatctgctag ggaaaggctt gccggatctg ctgtcgtcga aaccttggct 660

gaggctattg ccagaggaga tgttccaaga ggtgcctctg ctggtagtgc tcccggaacc 720

gatgtctctg atgactctct tgccttgctt atctatacct ctggatctac cggagcccca 780

aagggagcca tgtacccaag aagaaacgtc gccaccttct ggaggaagag gacttggttc 840

gaaggaggat acgagccatc tatcactctt aatttcatgc caatgtctca cgtcatggga 900

aggcagatct tgtatggtac cctttgcaat ggtggtaccg cctacttcgt tgccaagagt 960

gacttgagta ctcttttcga ggacttggcc ttggttaggc ctaccgagtt gaccttcgtt 1020

cctagggtct gggacatggt cttcgacgag ttccagagtg aggtcgatag aagacttgtc 1080

gacggagctg atagggttgc ccttgaggcc caagtcaaag ccgaaatcag aaacgacgtc 1140

cttggtggta ggtacacctc tgccttgacc ggaagtgctc caatcagtga cgagatgaag 1200

gcttgggtcg aggagctttt ggatatgcac ttggttgaag gatacggatc taccgaggcc 1260

ggaatgatct tgattgacgg agctattaga aggccagccg tcttggatta caagttggtc 1320

gacgtcccag acttgggata cttcttgact gatagacctc acccaagagg tgaacttctt 1380

gtcaaaactg atagtctttt ccccggatat tatcagagag ctgaagtcac cgctgatgtt 1440

ttcgacgccg acggtttcta tagaaccggt gacatcatgg ctgaggttgg accagaacag 1500

ttcgtctacc ttgacagaag gaataacgtc ttgaagttga gtcaaggaga atttgttact 1560

gttagtaagt tggaagctgt cttcggagac tctcctttgg ttagacagat ctacatttac 1620

ggaaattctg ctagagctta ccttcttgcc gtcatcgtcc ctactcaaga agccttggac 1680

gccgtcccag ttgaggagtt gaaggctaga ttgggagact ctttgcaaga agtcgccaaa 1740

gctgccggtt tgcagtctta cgagatccca agagacttta tcattgagac cactccttgg 1800

acccttgaga acggacttct taccggaatt agaaagcttg ctagacctca gcttaagaaa 1860

cactatggtg agcttttgga gcagatctac actgacttgg cccatggtca agccgatgag 1920

cttaggtctc ttaggcagtc tggagccgat gccccagttc ttgtcactgt ttgcagagcc 1980

gctgccgctt tgttgggtgg atctgcttct gatgtccagc cagatgccca tttcactgat 2040

cttggtggag acagtctttc tgccttgtct ttcaccaatt tgttgcatga gatttttgat 2100

attgaggtcc cagttggagt cattgtctct ccagccaacg atttgcaagc tcttgctgac 2160

tatgtcgagg ctgctaggaa acccggatct tctaggccta cctttgcctc tgttcacgga 2220

gctagtaacg gtcaagtcac cgaagttcac gccggtgact tgtctcttga caagttcatc 2280

gacgccgcta ctcttgctga agctcctaga ttgccagctg ccaacactca agttagaacc 2340

gttttgctta ctggagccac cggatttctt ggaagatacc ttgcccttga gtggcttgaa 2400

aggatggact tggtcgacgg aaagcttatc tgccttgtta gagccaagtc tgacactgaa 2460

gctagggcca gattggacaa gacctttgac tctggtgacc cagagttgct tgcccactac 2520

agagccttgg ctggagatca cttggaggtt ttggccggtg ataagggtga ggccgacctt 2580

ggattggata gacaaacttg gcagaggctt gccgacactg ttgatttgat cgtcgaccca 2640

gccgctcttg tcaatcacgt ccttccttac tctcagttgt tcggaccaaa cgcccttgga 2700

actgctgaac ttcttagact tgcccttacc tctaagatta aaccatacag ttacacctct 2760

accatcggag tcgccgacca gatcccacca agtgccttca ctgaggacgc cgacattaga 2820

gttatctctg ctaccagagc cgttgacgac tcttacgcta acggatactc taactctaag 2880

tgggccggag aagtcttgct tagagaagcc cacgatcttt gcggtcttcc agttgccgtt 2940

tttagatgtg atatgatctt ggccgatacc acttgggctg gacagttgaa cgttccagat 3000

atgttcacta ggatgatttt gtctcttgcc gccaccggaa ttgcccccgg atctttctat 3060

gagcttgccg ccgatggagc taggcagagg gcccactacg acggattgcc agttgagttc 3120

attgccgagg ccatctctac tttgggtgcc cagtctcaag atggtttcca cacctatcac 3180

gttatgaatc catacgacga cggtatcggt ttggatgagt tcgtcgattg gttgaacgag 3240

tctggttgtc caatccagag aatcgccgac tatggtgact ggcttcagag gtttgaaacc 3300

gccttgagag ccttgccaga tagacaaagg cacagttctt tgcttccatt gcttcataat 3360

tatagacaac cagaaagacc agttagaggt tctattgccc caactgatag atttagggct 3420

gccgttcaag aagccaagat cggtccagac aaggatatcc ctcatgtcgg agctcctatc 3480

atcgtcaagt acgtttctga cttgaggctt cttggattgc tttga 3525

<210> 14

<211> 1035

<212> DNA

<213> An artificial sequence

<400> 14

atggttcaag ataccagttc tgcctctacc tctcctatcc ttactagatg gtacatcgac 60

accagaccat tgaccgcctc taccgctgct ttgccattgt tggagactct tcagccagct 120

gatcagattt ctgtccagaa gtactatcac cttaaagata aacatatgag tttggctagt 180

aaccttttga aatatctttt tgtccatagg aactgcagaa tcccatggag tagtatcgtc 240

atctctagga ccccagaccc tcataggaga ccatgctaca tcccaccttc tggtagtcaa 300

gaagactctt tcaaggacgg ttacaccggt atcaatgtcg agttcaacgt cagtcaccaa 360

gccagtatgg tcgctattgc cggaactgcc tttaccccta actctggagg agatagtaag 420

ttgaagccag aggtcggaat cgacatcact tgtgtcaatg agaggcaagg aagaaacgga 480

gaggagagga gtcttgagag tttgaggcaa tatatcgata tcttctctga ggtcttcagt 540

accgccgaga tggctaacat tagaaggttg gacggagtct ctagttcttc tttgagtgcc 600

gatagattgg tcgactacgg atatagactt ttttacactt actgggcctt gaaggaggcc 660

tacatcaaga tgaccggaga ggctttgctt gccccttggt tgagggaact tgagttcagt 720

aacgttgtcg ccccagctgc tgttgctgag tctggagaca gtgctggaga tttcggtgag 780

ccatacaccg gagtcagaac taccttgtat aaaaatttgg tcgaggacgt cagaatcgaa 840

gtcgccgctt tgggaggaga ctatttgttc gccactgctg ctaggggagg aggtatcgga 900

gcttcttcta gacccggagg tggaccagat ggaagtggaa ttagatctca agatccttgg 960

aggccattca agaagttgga cattgagagg gacatccagc catgcgccac cggagtctgt 1020

aattgcttgt cttga 1035

<210> 15

<211> 1986

<212> DNA

<213> An artificial sequence

<400> 15

atgaactact tccttaccgg aggtaccgga ttcatcggta ggttcttggt cgagaagttg 60

cttgccagag gaggaactgt ctacgtcttg gttagagagc agagtcaaga taagttggaa 120

aggcttaggg aaaggtgggg tgctgacgac aaacaagtca aggctgtcat cggagacttg 180

acctctaaga accttggtat cgacgccaag acccttaaat ctttgaaggg aaacattgat 240

cacgtcttcc acttggccgc tgtctatgat atgggagccg acgaggaggc ccaagccgct 300

accaacatcg aaggaactag ggctgctgtt caagctgctg aagccatggg agccaagcac 360

ttccaccacg tttcttctat cgccgctgcc ggtcttttca agggtatctt tagagaggac 420

atgttcgagg aagccgaaaa gcttgaccac ccttacctta ggaccaagca cgaaagtgag 480

aaggtcgtta gagaagagtg taaggtccct tttagaatct atagacccgg aatggtcatc 540

ggtcatagtg agaccggaga gatggataag gtcgatggac cttactattt cttcaagatg 600

atccagaaga ttagacacgc ccttccacag tgggttccta ccatcggtat cgagggaggt 660

aggcttaaca tcgtcccagt tgacttcgtc gtcgatgctt tggaccacat cgcccacttg 720

gagggagagg acggtaactg cttccacctt gttgactctg acccttacaa ggtcggagag 780

atcttgaata tcttctgcga ggccggtcac gcccctagaa tgggaatgag aatcgacagt 840

agaatgtttg gtttcatccc accatttatc agacaatcta ttaagaatct tccaccagtt 900

aagaggatca ctggagcctt gttggatgac atgggaatcc ctccaagtgt catgtctttt 960

attaactacc ctaccagatt tgacactaga gagcttgaga gggtccttaa gggaactgac 1020

attgaggtcc caagacttcc tagttacgcc ccagttatct gggactactg ggagaggaac 1080

cttgacccag acttgttcaa ggatagaacc ttgaagggaa ctgtcgaagg taaggtctgc 1140

gtcgttaccg gagccacctc tggtatcgga ttggccaccg ctgagaagtt ggccgaagct 1200

ggagccattc ttgtcatcgg tgctagaacc aaggaaaccc ttgatgaggt cgctgcctct 1260

ttggaagcca aaggaggtaa cgtccacgcc taccaatgcg atttctctga catggacgac 1320

tgcgataggt tcgtcaaaac cgtcttggat aaccacggac acgttgacgt ccttgtcaac 1380

aacgccggta ggagtattag aaggagtttg gctttgtctt tcgatagatt tcatgatttt 1440

gaaaggacta tgcaattgaa ttatttcggt agtgttagat tgatcatggg attcgctcca 1500

gctatgcttg agagaaggag gggtcacgtc gttaacatct cttctatcgg tgttcttacc 1560

aacgccccta ggttcagtgc ctacgtctct tctaagtctg ctttggacgc cttcagtagg 1620

tgtgccgccg ccgaatggtc tgacagaaac gtcactttta ctactattaa catgccattg 1680

gtcaagaccc caatgatcgc cccaaccaag atttacgact ctgtcccaac ccttacccca 1740

gatgaggccg cccaaatggt tgctgacgct atcgtctata gacctaagag aatcgccact 1800

agacttggag tcttcgccca agttcttcac gctcttgccc caaagatggg agagattatt 1860

atgaataccg gatacagaat gttcccagat tctccagccg ctgctggttc taagtctggt 1920

gagaagccaa aggtctctac tgagcaagtc gccttcgccg ccatcatgag aggaatttac 1980

tggtga 1986

<210> 16

<211> 20

<212> DNA

<213> An artificial sequence

<400> 16

cacgagccga gtaataaccg 20

<210> 17

<211> 20

<212> DNA

<213> An artificial sequence

<400> 17

cgaaagtatt tacagtaccg 20

<210> 18

<211> 1539

<212> DNA

<213> An artificial sequence

<400> 18

atgctggaat atactcaagt tgaagaaatt ggttctctcg tagataaagc tcgacaagtt 60

tttgatagta atgtattact aactgtccaa aatcgtttga atcaattacg gaatctgtac 120

tatgttttgt tggaccatca gacacagttt gaggatgccc tcagcaagga cttcaacagg 180

tcccgatttg agacgtctag attggagcta gcacaagtat ttggagaaat tctttatgtg 240

atgcagcatc tggagtcatg gagcaaaccc caaaaagtcg actacctccc tttatctttc 300

ggtactactt atagcacagt ggaaaagatt cctcttggtg taatacttat cattgcaccg 360

ttcaactacc cgatcgttct ttctttgtct cctatcattg gagccattgc tgccggaaac 420

actgttgttt tcaagccgtc tgaacttact cccaactgta gtacactcct aactgaggtg 480

ttacagagtt gttttgatta cccaattgta tccgtagtta atgggggaat caccgagacc 540

cagaaattgt tggaaccgaa gtttgacaag ataatgttca ccggaagtgg acatgtagga 600

aaaattattt ctaaagcagc tgctgagcac cttactcctg ttatcttaga attgggcgga 660

aagtctcctt gctttctgac ttccaattgt aagactacca aaattaaagc tctcctgagt 720

cgaatcattt ggtcttcatt tgtcaatagt ggacaaacct gcgtggcggt agactatcta 780

ttagttcacg aaagtattta cagtaccgtg gtacaagaat ctactaagat actaaaggaa 840

ttctattgca atatcacaga gaaaagtgat tttactcatc ttattgatcg aaagtcattc 900

aaacgaacta tgaccacatt gcaaagaacc aagggcaaaa agatcagttt cggtgtttct 960

catgaagaca ctaactttat acctcctaca ttgatttgtg acgtatcctg ggacgatgag 1020

accatgcaat ctgaaaattt tgcgcccatt cttcccatca tcaaatactc cagtttagaa 1080

gatgttgtga gcgaggtgaa aactgagcat gacaccccgc tagcatgtta catcttttct 1140

gaagaccctc aagaacaaag gtacattcta aacaatttac gatcgggagg agtttgtata 1200

aatgaaacaa tgatgcacgt tggactttac actgcacctt tcgggggaat aggtgactca 1260

ggctatggaa attaccatgg gaagtggtca tttgattctt ttagtcactc aagaaccgtt 1320

ctaaaacaac cgttgtgggc agagttccta attaaagctc gttatcctcc ttacacaaga 1380

aaaaatagag cgactctgga gctcttagat aaaggtgtgg tttggtttga ccgttccggt 1440

aacgtccctt caagaagatc gtatttaacg aaagttattg gatactgcgg attgatggtt 1500

acaattgctg ctgcattaat tggtaaactt gttttttaa 1539

<210> 19

<211> 1074

<212> DNA

<213> An artificial sequence

<400> 19

atgcaaggaa tctctgctag tccagagagg atgaacgccc agcaaagagc cgcccacgtt 60

agacaagttg tcttggccag aggagacgag cttaggagga ggttccctct tttgagacac 120

caagatgccc ttggtgctgg aatcttggcc ttcgccttgt ctggaatgtt gggatctgcc 180

cttttgtacg tcaccggtca tcttgcttgg tgggcttgct tgttgcttaa cgccttcttc 240

gcctctctta cccacgagtt ggagcatgac cttattcatt ctatgtactt tagaaagcag 300

aggttgcctc ataaccttat gcttggattg gtttggttgg ctagaccatc tactatcaac 360

ccatgggtta gaaggcacct tcatcttaac caccacaagg tcagtggatc tgagagtgac 420

atcgaggaga gagctatcac caatggtgag ccatggggaa tcgctagact tttgatggtc 480

ggtgacaaca tgatggctgc cttcattaga cttcttaggg ctcccggagc taggagaaag 540

ttgggaatcc ttgttagaac cttggccgtt tatgcccctt tggccttgtt gcattgggga 600

gcttggtacg tcttccttgg attccacggt gctaacggag tcgccgcctt gcttggatct 660

ccaatccagt ggtctcaaga taccgccagt ttgatgcatt acgtcgacat cgccgtcgtc 720

gtcatcatcg gaccaaacgt tttgagaact ttctgcttgc attttgtctc ttctaacatg 780

cattactatg gagacatcga gcccggaaac gtcatccagc agacccaagt tcttaaccca 840

tggtggatgt ggccacttca agccttctgc tgcaacttcg gttctaccca tggaatccac 900

cacttcgtcg ttagagagcc tttctacatt agacagatga ctgcctctgt cgctcataag 960

gtcatggccg agatgggtgt tagattcaat gacttcggta cctttgctag agctaataga 1020

ttcactagac aagaaaggga agccatgcaa ccagcccaca atgctagagc ctga 1074

<210> 20

<211> 1269

<212> DNA

<213> An artificial sequence

<400> 20

atgaacgcca acgacaatgt tgtcatcgtc ggtaccggac ttgccggagt tgaagttgcc 60

ttcggtttga gggcttctgg ttgggagggt aacattagat tggttggaga cgccactgtt 120

atccctcacc acttgcctcc tctttctaag gcttacttgg ctggtaaggc cactgccgag 180

tctctttacc ttaggacccc agacgcctac gccgcccaga acatccaact tttgggaggt 240

acccaagtta ccgctatcaa tagagatagg cagcaagtta tcttgagtga cggtagagcc 300

ttggattacg atagacttgt ccttgccacc ggaggaagac caagaccttt gccagtcgcc 360

tctggagctg tcggaaaggc taacaacttt agatacctta gaaccttgga ggacgccgag 420

tgtatcagaa ggcagttgat cgccgacaat agattggttg tcatcggagg tggatacatc 480

ggattggaag tcgccgccac cgccatcaaa gccaacatgc acgtcaccct tcttgacacc 540

gctgccagag tccttgaaag ggttactgcc cctccagtct ctgcctttta cgagcacttg 600

catagggagg ctggagttga tattagaacc ggtacccaag tctgcggatt cgagatgtct 660

accgaccagc agaaggttac cgctgttctt tgcgaggacg gtactaggtt gccagctgac 720

ttggtcatcg ccggtatcgg tcttatccca aactgcgaac ttgcctctgc tgccggtttg 780

caagttgaca acggaatcgt catcaacgaa cacatgcaga cctctgaccc tcttattatg 840

gccgttggtg actgcgctag gttccattct cagttgtacg atagatgggt tagaattgag 900

tctgtcccta acgcccttga acaagctaga aagatcgccg ctatcctttg cggtaaggtc 960

cctagggatg aagctgcccc ttggttctgg agtgatcagt atgaaatcgg attgaagatg 1020

gtcggtctta gtgagggata cgataggatc atcgttagag gttctcttgc ccaaccagac 1080

ttttctgtct tctacttgca aggagacaga gtccttgctg tcgataccgt caatagacca 1140

gttgagttca accaatctaa gcaaatcatc accgatagat tgccagttga accaaacttg 1200

cttggtgacg agagtgtccc acttaaggag atcatcgccg ctgctaaggc cgaactttct 1260

agtgcctga 1269

<210> 21

<211> 324

<212> DNA

<213> An artificial sequence

<400> 21

atgtctaagg tcgtctacgt ctctcacgac ggtactagga gagagttgga tgtcgctgac 60

ggagtctctc ttatgcaagc tgccgtctct aacggaatct acgacatcgt cggtgactgt 120

ggaggtagtg cttcttgcgc tacttgccac gtctacgtca acgaggcctt caccgataag 180

gttccagccg ctaacgagag ggagatcgga atgttggagt gtgtcaccgc cgagttgaag 240

ccaaactcta ggctttgctg ccagatcatc atgaccccag agttggacgg tatcgtcgtc 300

gatgttccag ataggcagtg gtga 324

<210> 22

<211> 816

<212> DNA

<213> An artificial sequence

<400> 22

atggaaatca ctagaattaa ggagttgaag gtcatcgacg ccttcgtcag aatcggacca 60

cttatggatc cagctagtta tccacagtgg gcccagcaat tgatcgagga ctgcagagaa 120

tctaagagga gggttgtcga gcacgagttc tacgctagat tgagggacgg acagcttaag 180

cagtctacca ttagacagta ccttatcggt ggatggccag tcgtcgagca gttcagtctt 240

tatatggccc acaaccttac caagactaga tacggtagac accaaggaga agatatggct 300

agaaggtggc ttatgaggaa cattagagtc gagcttaacc acgccgacta ctgggtcaac 360

tggtgtcaag ctcatggtgt tcaccttcac gagcttcaag ctcaagaagt cccaccagag 420

cttaacggac ttaacgactg gtgctggaga gtttgcgcca ccgaaaactt ggccatctct 480

atggccgcca ctaactacgc tatcgaggga gctactggag agtggtctgc tgtcgtctgc 540

agtaccgata cctatgccca aggattccca gaagaaggta ggaagagggc catgaagtgg 600

cttaagatgc acgctcagta cgacgatgcc cacccatggg aggctttgga aatcatctgc 660

acccttgccg gtgaaaaccc taccttgggt ttgagaaccg agcttaggag ggccatctgc 720

aagtcttacg actgcatgtt tcttttcctt gaaaggtgca tgcagttgga gggaaggcaa 780

caaggaagga tgagaccagc tcttgctgct ggatga 816

<210> 23

<211> 1269

<212> DNA

<213> An artificial sequence

<400> 23

atggctactt tgaaaagaga taaaggattg gacaataccc ttaaggttct taaacaagga 60

tatctttata ctaccaacca gaggaataga ttgaacacct ctgtcttcca gaccaaagcc 120

ttgggaggaa agccattcgt cgtcgtcacc ggaaaggaag gtgccgagat gttctacaat 180

aacgacgtcg tccaaaggga gggaatgttg cctaagagga tcgtcaacac ccttttcgga 240

aagggagcta tccacaccgt cgatggtaag aagcacgtcg ataggaaggc tcttttcatg 300

agtcttatga ccgaaggaaa cttgaactac gtcagagagc ttactagaac cttgtggcac 360

gccaataccc agaggatgga gtctatggac gaagtcaaca tctacagaga gagtatcgtt 420

ttgttgacta aagtcggaac tagatgggct ggagttcaag ctcctccaga agatatcgaa 480

aggatcgcca ccgacatgga catcatgatc gatagtttca gagcccttgg aggtgccttc 540

aagggataca aggcctctaa ggaggctaga aggagagttg aggactggtt ggaggagcaa 600

atcatcgaga ctaggaaggg aaacatccac cctccagaag gaaccgcttt gtacgagttc 660

gcccactggg aggattacct tggtaaccca atggactcta ggacttgtgc catcgacctt 720

atgaacacct tcagacctct tattgccatt aataggttcg tcagtttcgg attgcacgcc 780

atgaacgaga accctattac tagggaaaag atcaagtctg agccagacta cgcctacaag 840

ttcgctcaag aagttagaag gtactaccca ttcgtcccat tcttgcccgg aaaggccaag 900

gtcgacattg acttccaagg agttaccatc ccagctggag ttggattggc cttggacgtc 960

tacggtacca cccacgatga gagtctttgg gacgacccta acgagttcag accagagaga 1020

ttcgagactt gggacggatc tcctttcgac cttattccac aaggaggtgg agactactgg 1080

accaaccata gatgcgccgg agaatggatc accgttatca tcatggaaga aaccatgaaa 1140

tactttgccg agaaaatcac ctacgacgtt ccagagcaag atcttgaggt cgaccttaac 1200

tctatccccg gatacgtcaa gagtggtttc gtcatcaaga acgttagaga ggtcgttgac 1260

agaacttga 1269

<210> 24

<211> 1224

<212> DNA

<213> An artificial sequence

<400> 24

atgtctttcg atgacgctga gctcaaacgc atatctaagg agctcgacaa gcaacttggt 60

ccagagttta tttgtacaag acctggccaa ggtggtatga aagtgtcgta tctctctggc 120

actactgcta ttagtttggc caatcacatc tttggcttta atgggtggca ttcggaagtt 180

aagagtacta cagtggattt tgtagatact cagcatggca aaatttcaat gggactttcg 240

tctgttattc gggtcacctt gaaagacggt tcttttcatg aggatattgg ttatggaagc 300

gtggaaaatg caaaatccaa ggccatagct tttgagaagt gcagaaaaga ggctatcacc 360

gacggactca agagagtttt gagatgtttt ggtaatgctt tgggtaattg tctgtacgac 420

aaggaatatt tacgaaagat ttcaaacgtt aaaactcaag ctatcacatt taatgaaggc 480

gatcttatga gacacaatca gcttgaggca cgaactctca aacaggaagc caagcttctg 540

gagattaatc aaaagaaagc taaaaacagc agcaagtcaa gaattaatgt ccctcccaag 600

cattttggtg acaatgaaga cgacgattcg catttgttca gcgatgaaat caacatcgat 660

agtgaggact ttatgaatga aattgatgat tacgagatgg atttgctgat gcaaaagaac 720

tctcagagag aaattgaaaa cgtaaacgac gatgagattg aaaataaggg tgacgctgtc 780

gacgctgtta ccaagagtaa tattgaaaat cagttcattg cccccaatag tccccagatt 840

atggacaaca tggtactgac tccagataaa atcccagcca aggttgaatt tgtttctgcc 900

aaggttgccg agaaggtcca aaacaatagt ccattgaacg tggaagaaaa gttcaaccca 960

tcattccagt ctccttcttt aagaagaact gtagatccta cgaaatcaat gcccattaga 1020

cgtacaatgg ttcaaacatc tgtgcttagt cagtccaagc agggtcctaa acgaatgatc 1080

ggaattcctc cagatacggc aaaaaggcat aagctgggat cacaaaacca aaacactgcc 1140

aacgataaac ccgaggagaa gcaattgagt cggttcaatt ctacaaaggc cccaggaaaa 1200

gaaaactctc cagcttcgaa ttaa 1224

<210> 25

<211> 20

<212> DNA

<213> An artificial sequence

<400> 25

aacgagagca gactacacca 20

Claims (22)

1. A method for constructing a recombinant pichia pastoris strain for producing fatty acids, the method comprising:

constructing a polypeptide having the sequence of SEQ ID NO:1, a sgRNA expression vector pPICZ-Cas9-gFAA1 of a targeting nucleotide sequence;

and introducing the sgRNA expression vector pPICZ-Cas9-gFAA1 into a Pichia pastoris strain, and knocking out KpFAA1 genes in the Pichia pastoris strain.

2. The construction method according to claim 1, wherein the pichia pastoris strain is integrated with a Cas9 protein.

3. The construction method according to claim 1, characterized in that the construction method further comprises: constructing a polypeptide having the sequence of SEQ ID NO:2, a sgRNA expression vector pPICZ-Cas9-gFAA2 of a targeting nucleotide sequence;

and introducing the sgRNA expression vector pPICZ-Cas9-gFAA2 into a Pichia pastoris strain, and knocking out KpFAA2 genes in the Pichia pastoris strain.

4. The construction method according to claim 1, characterized in that the construction method further comprises: constructing a polypeptide having the sequence of SEQ ID NO:3, a sgRNA expression vector pPICZ-Cas9-gPOX1 of a targeting nucleotide sequence;

And introducing the sgRNA expression vector pPICZ-Cas9-gPOX1 into a Pichia pastoris strain, and knocking out KpPOX1 genes in the Pichia pastoris strain.

5. The construction method according to claim 1, characterized in that the construction method further comprises: over-expressing the recombinant pichia pastoris strain for citrate lyase encoded by the gene MmACL derived from mice, isocitrate dehydrogenase 2 encoded by the gene KpIDP2 derived from pichia pastoris, and citrate transporter encoded by the gene ScYHM2 derived from saccharomyces cerevisiae;

wherein the recombinant pichia pastoris strain overexpresses the gene KpRAD52 from pichia pastoris and knocks out the KpFAA1 gene;

wherein, the nucleotide sequence of the KpIDP2 gene is shown in SEQ ID NO: 11.

6. The construction method according to claim 5, wherein overexpressing the recombinant pichia pastoris strain the citrate lyase encoded by the gene MmACL comprises: the gene MmACL from mice was integrated into the recombinant pichia pastoris strain.

7. The construction method according to claim 5, wherein overexpressing the recombinant pichia pastoris strain for isocitrate dehydrogenase 2 encoded by gene KpIDP2 comprises:

The KpIDP2 gene derived from Pichia is integrated into the PNSI-3 locus of Pichia pastoris genome to enable the KpIDP2 gene to be over expressed.

8. The method of claim 5, wherein over-expressing the recombinant pichia pastoris strain for the citrate transporter encoded by the gene ScYHM2 comprises: the gene ScYHM2 derived from Saccharomyces cerevisiae was integrated into the recombinant Pichia pastoris strain.

9. The construction method according to claim 1, wherein the nucleotide sequence of KpFAA1 gene is as set forth in SEQ ID NO: 4.

10. A method of construction according to claim 3, wherein the nucleotide sequence of the KpFAA2 gene is set forth in SEQ ID NO: shown at 5.

11. The construction method according to claim 4, wherein the nucleotide sequence of KpPOX1 gene is as shown in SEQ ID NO: shown at 6.

12. The construction method according to claim 5, wherein,

the nucleotide sequence of the MmACL gene is shown as SEQ ID NO: shown as 8;

the nucleotide sequence of the ScYHM2 gene is shown as SEQ ID NO: shown at 12.

13. A recombinant pichia pastoris strain producing fatty acids, characterized in that the strain is constructed by the method of any one of claims 1 to 12.

14. A method for constructing a recombinant pichia pastoris strain for fatty alcohol synthesis, which is characterized by comprising the following steps:

taking the recombinant Pichia pastoris strain for producing fatty acid as a starting strain, knocking out a fatty aldehyde dehydrogenase gene KpHFD1, and further enabling the recombinant Pichia pastoris strain to overexpress a carboxylic acid reductase gene MmCAR derived from mycobacterium marine, a cofactor gene AnnpgA derived from Aspergillus nidulans, an alcohol dehydrogenase gene ScADH5 derived from Saccharomyces cerevisiae and a fatty acyl-CoA reductase gene FaCoAR;

the nucleotide sequence of the FaCoAR gene is shown in SEQ ID NO: 15;

the nucleotide sequence of the fatty aldehyde dehydrogenase gene KpHFD1 is shown in SEQ ID NO: shown at 18;

the nucleotide sequence of the MmCAR gene is shown in SEQ ID NO: shown at 13.

15. The method of claim 14, wherein the method of constructing a building is performed,

the nucleotide sequence of the AnnpgA gene is shown in SEQ ID NO: 14.

16. The method of claim 14, wherein knocking out fatty aldehyde dehydrogenase gene KpHFD1 comprises:

constructing a polypeptide having the sequence of SEQ ID NO:17, a sgRNA expression vector ppcz-Cas 9-gHFD1 of a targeting nucleotide sequence shown in seq id no;

The sgRNA expression vector pPICZ-Cas9-gHFD1 is introduced into the recombinant Pichia pastoris strain.

17. A pichia pastoris strain for fatty alcohol synthesis, characterized in that the strain is constructed by the method of any one of claims 14 to 16.

18. A method for constructing a recombinant pichia pastoris strain for synthesizing alpha-olefin, which is characterized by comprising the following steps: taking the recombinant Pichia pastoris strain producing fatty acid as a starting strain, enabling the recombinant Pichia pastoris strain producing fatty acid to be over-expressed with cofactor protein genes CamA and CamB, and further over-expressing one or more of fatty acid decarboxylase genes PfUndB, ppUndA and JeOlet;

wherein, the nucleotide sequence of the PfUndB gene is shown in SEQ ID NO: 19;

the nucleotide sequence of the PpUndA gene is shown as SEQ ID NO: shown at 22;

the nucleotide sequence of the JeOlet gene is shown in SEQ ID NO: indicated at 23;

the nucleotide sequence of the CamA gene is shown in SEQ ID NO: shown at 20;

the nucleotide sequence of the CamB gene is shown as SEQ ID NO: 21.

19. A recombinant pichia pastoris strain for -olefin synthesis, wherein the strain is constructed by the method of claim 18.

20. The construction method of any one of claims 1 to 12 and the use of the recombinant pichia pastoris strain for fatty acid production of claim 13 in the synthesis of fatty acids.

21. The construction method of any one of claims 14 to 16 and the use of the pichia pastoris strain for fatty alcohol synthesis according to claim 17 in fatty alcohol synthesis.

22. The construction method of claim 18 and the use of the fatty alcohol-synthesized pichia pastoris strain of claim 19 in the synthesis of alpha-olefins.