CN113755572A

CN113755572A - Detection kit for purine drug metabolism marker and detection method and application thereof

Info

Publication number: CN113755572A
Application number: CN202111048035.9A
Authority: CN
Inventors: 刘丹; 孙悦; 陈立波
Original assignee: Fist Shanghai Biotechnology Co ltd
Current assignee: Fist Shanghai Biotechnology Co ltd
Priority date: 2021-09-08
Filing date: 2021-09-08
Publication date: 2021-12-07

Abstract

The invention discloses a detection kit for purine drug metabolism markers, a detection method and application thereof, wherein the purine drug metabolism markers are polymorphisms of two genes, namely TPMT 3C and NUDT15 3, the kit is used for designing an amplification primer and a sequencing primer aiming at the polymorphisms of the two genes, namely TPMT 3C and NUDT15, and the kit comprises the following components: TPMT 3C amplification primers, NUDT15 3 amplification primers, TPMT 3C sequencing primers, NUDT15 3 sequencing primers, and positive controls. The invention uses Recombinase Polymerase Amplification (RPA) to amplify TPMT 3C, NUDT15 3 in one tube, and uses streptavidin to capture target single-stranded DNA; after rinsing the product, adding a TPMT (T-T) 3C sequencing primer and a sequencing raw material to perform pyrosequencing, and adding ddATP (ddATP) into the last base to terminate the sequencing reaction; and then adding NUDT15 × 3 sequencing primer and corresponding dNTP for sequencing, and sequencing two sites by one-time treatment, thereby reducing the operation time and improving the sequencing flux.

Description

Detection kit for purine drug metabolism marker and detection method and application thereof

Technical Field

The invention relates to a detection kit for purine drug metabolism markers, a detection method and application thereof, and belongs to the field of gene detection.

Background

Thiopurine drugs include thioguanine, 6-mercaptopurine, and its prodrug azathioprine. Thioguanine and 6-mercaptopurine are used for induction and maintenance treatment of the stable phase of inflammatory bowel disease, and are also one of the most widely used drugs for treating acute lymphoblastic leukemia in children. Azathioprine is mainly used for treating autoimmune diseases and rejection after organ transplantation. The clinical curative effect and the adverse drug reaction of the thiopurine drugs have great individual difference, so that how to reasonably, individually and safely use the thiopurine drugs for treatment has very important clinical significance.

Thiopurine Methyltransferase (TPMT) is a key enzyme for in vivo metabolism of Thiopurine drugs, and the accumulation concentration of an active metabolite 6-thioguanine nucleotide in cells can be directly influenced by the activity of the TPMT, so that the clinical curative effect and the adverse drug reactions of the TPMT are influenced. AZP is converted into 6-MP as a prodrug in the liver by glutathione transferase. 6-MP is metabolized by hypoxanthine-guanine phosphoribosyl transferase to mercaptohypoxanthine monophosphate (TIMP), which is metabolized through a series of processes to the active metabolite 6-thioguanine nucleotide (6-TGN) and then exerts an antitumor effect. 6-MP can also be metabolized to inactive 6-methylmercaptopurine (6-methyl MP, 6-MMP) via TPMT. TPMT activity is inversely related to the level of 6-TNG, a 6-MP active metabolite, in erythrocytes and hematopoietic tissues, and a decrease in TPMT activity increases the toxicity (severe myelosuppression) of the hematopoietic system of thiopurine drugs. FDA has approved the drug instruction of 6-mercaptopurine, 6-thioguanine and azathioprine to increase the suggestion of TPMT gene polymorphism detection before drug administration

NUDT15 is a hydrolase that is primarily involved in the reverse reaction process of 6-thioinosine monophosphate (6-TIMP) to triphosphate (6-TGTP, 6-d TGTP) conversion during 6-MP metabolism, preventing 6-d TGTP from incorporating into DNA, thereby minimizing DNA damage and avoiding apoptosis. The mutation of the NUDT15 gene leads to the reduction of the activity of the NUDT15 enzyme, the reverse reaction process of the conversion of 6-TIMP to triphosphate is affected, the levels of 6-TGTP and 6-dTTP are increased, and the cytotoxicity of mercaptopurine is enhanced.

At present, there are many methods for detecting gene polymorphism, such as direct sequencing, chip method, high-resolution melting curve method, allele-specific amplification method, taqman fluorescence probe method, etc. The sequencing method and the chip method have the disadvantages of complicated operation steps, long detection period and easy pollution of amplification products; the high-resolution melting curve method has simple steps, low specificity and higher requirements on instruments and equipment; the allele specific amplification method adopts ARMS primers for specific amplification, the design of the primers is difficult to optimize, and the detection condition is strict. The Taqman fluorescent probe method has high test cost and low amplification flux for a plurality of genes. Therefore, it is necessary to establish a simple, rapid, efficient, inexpensive, and highly specific method for detecting gene polymorphisms.

Disclosure of Invention

In view of the above problems in the prior art, the present invention aims to obtain a detection kit for purine drug metabolic markers, and a detection method and application thereof.

In order to achieve one of the above objects, the technical solution of the detection kit for purine drug metabolism markers adopted by the present invention is as follows:

the purine drug metabolism marker is polymorphism of two genes of TPMT 3C and NUDT15 3, the kit designs an amplification primer and a sequencing primer aiming at the polymorphism of the two genes of TPMT 3C and NUDT15 3, and the kit comprises the following components: TPMT 3C amplification primers, NUDT15 3 amplification primers, TPMT 3C sequencing primers, NUDT15 3 sequencing primers, and positive controls.

Preferably, the specific primers are designed as shown in the following table:

preferably, the sequence of the specific primer group of the TPMT 3C is shown in a sequence table SEQ ID NO. 1-SEQ ID NO. 2; the specific primer group sequence of the NUDT15 x 3 is shown in a sequence table SEQ ID NO. 3-SEQ ID NO. 4.

Preferably, the TPMT 3C sequencing primer and the NUDT15 3 sequencing primer are respectively shown as SEQ ID NO. 5-SEQ ID NO. 6 of the sequence table.

More preferably, the sequencing primer is a nucleic acid analogue, the skeleton of which is a peptide bond rather than a phosphodiester bond, and the peptide bond skeleton is connected with a corresponding base. The structure has stable biological properties, and is not easy to degrade by protease or nuclease. The binding to DNA is more stable than the binding of DNA/DNA

Preferably, the sequencing region corresponding to the TPMT 3C sequencing primer is a TPMT 3C to-be-detected sequence, and is shown as a sequence table SEQ ID NO. 7; the sequencing region corresponding to the NUDT15 × 3 sequencing primer is a to-be-detected NUDT15 × 3 sequence, and is shown as a sequence table SEQ ID NO. 8.

Preferably, TPMT 3C and NUDT15 3 share a dispense command as shown in SEQ ID No. 9 of the sequence listing. "ddA" in SEQ ID NO 9 indicates that the last base ddATP was added to the TPMT 3C sequencing reaction, and the addition of this base stops the sequencing reaction. The "-" in SEQ ID NO 9 indicates that the addition of the reagent was suspended for 3 min. During this pause NUDT15 x 3 sequencing primers were added.

Preferably, the magnetic beads are carboxyl magnetic beads, the particle size is 600mm, the suspension property is good, the magnetic property is strong, and the adsorption capacity is large. The concentration of magnetic beads in the reaction solution is 0.2mg/25 mu L, and the DNA adsorption amount in the blood sample is 30 ng-260 ng, which completely meets the DNA amount required by amplification.

Preferably, the reagent 1 comprises: amplification buffer, 18mM magnesium acetate;

preferably, the reagent 2 comprises: TPMT 3C rear primer (0.32uM), NUDT15 front 3 primer (0.32uM), NUDT15 front 3 primer (0.32uM), dNTPS (0.3mM), strand displacement DNA polymerase (1.2ng/μ L), single-stranded DNA binding protein (3.2ng/μ L), recombinase binding to single-stranded nucleic acid (4.8ng/μ L), trehalose (0.2%); simultaneous amplification of TPMT 3C/NUDT15 3 can be performed under isothermal conditions.

Preferably, the reaction volume is 25ul, and the reaction conditions are as follows: 15min at 42 ℃.

Preferably, the positive control comprises TPMT 3C, NUDT15 3 hybrid genomic DNA at a concentration of 20 ng/ul. The positive control corresponds to the heterozygosis of the detected gene locus, provides reference for the type determination of an unknown sample, and simultaneously performs quality control on the effectiveness of the reaction solution.

The invention also discloses a method for detecting the gene polymorphism related to the adverse reaction of purine drugs by using the kit, which comprises the following steps:

a. amplifying the amplification reaction solution and 5ul of genome DNA to be detected by adopting multiple RPA amplification;

b. binding the binding solution (containing the microbeads) with the amplification product;

c. treating the denatured liquid to obtain a single-chain product;

d. adding a washing buffer solution for rinsing;

e. adding a sequencing enzyme and a sequencing substrate to each sequencing tube;

f. taking an 8-calandria, and sequentially adding dATP, dTTP, dGTP, dCTP, TPMT 3C sequencing primer, NUDT15 3 sequencing primer and ddATP from one round smooth end to the flat end; lightly knocking the bottom of the calandria against the tabletop to enable the bases to be flatly paved at the bottom of the calandria;

g. pyrosequencing: adding TPMT 3C sequencing primer, adding various dNTPs according to the sequence of GCGTAGCATTG, and adding ddATP to terminate TPMT 3C sequencing reaction; adding NUDT15 × 3 sequencing primer, adding various dNTPs according to the sequence of AGCTGTGT, and carrying out NUDT15 × 3 site sequencing;

h. determining the genotypes of the TPMT 3C site and the NUDT15 3 site purine drug site.

The invention also discloses a kit for predicting the adverse reaction of purine drugs and application of the method, wherein the detection kit detects the gene polymorphism of TPMT 3C, NUDT15 so as to guide the prediction of the adverse reaction of purine drugs from a gene level.

Compared with the prior art, the invention uses the multiple RPA amplification and optimized pyrosequencing technology as a combination to detect the purine drug adverse reaction related gene polymorphism, and the kit can simultaneously detect the TPMT 3C, NUDT15 3 gene polymorphism purine drugs and provides gene angle suggestions for clinical personalized medication. The invention amplifies TPMT 3C, NUDT15 3 in one tube by Recombinase Polymerase Amplification (RPA), and captures target single-stranded DNA by streptavidin. After the product is rinsed, TPMT 3C sequencing primer and sequencing raw material are added to carry out pyrosequencing, and ddATP is added to the last base to terminate the sequencing reaction. Then NUDT15 × 3 sequencing primers and corresponding dNTPs were added for sequencing. The sequencing of two sites is carried out in sequence by one treatment, so that the operation time is reduced and the sequencing flux is improved.

Drawings

FIG. 1 is a diagram showing an example of the CC-type sequencing result of TPMT (A719G) AA/NUDT 15(C415T) provided by the present invention;

FIG. 2 is a diagram showing an example of the sequencing result of the AG type/NUDT 15(C415T) CT type of TPMT (A719G) provided by the present invention;

FIG. 3 is an exemplary graph of the TT type sequencing results of TPMT (A719G) GG type/NUDT 15(C415T) provided by the present invention.

Detailed Description

The following examples are provided to further describe the detection kit for purine drug metabolism markers, the detection method and the use thereof in detail and in full. The following examples are illustrative only and are not to be construed as limiting the invention.

The experimental procedures in the following examples are conventional unless otherwise specified. The experimental materials used in the following examples were all commercially available unless otherwise specified.

Example 1 preparation of kit

The kit provided by the invention designs specific amplification primers and sequencing primers aiming at TPMT 3C, NUDT15 3, and is used for isothermal amplification and pyrosequencing detection. The design of the primer based on the recombinase polymerase amplification technology is one of the keys of the invention, and the primer design of the technology cannot be carried out by auxiliary software and only depends on manual design. In order to ensure the amplification speed and the detection sensitivity, the length of the primer should be controlled to be 30-35 bp, the non-specific amplification is increased easily to cause false positive if the primer is designed to be too short, and the amplification cannot be performed easily if the primer is designed to be too long. Gene polymorphism sequences are subject to published sequences in Genebank.

The primer sequences of this example are as follows:

primer name	SEQ ID	Sequence (5 'to 3')	Decoration
				TPMT 3C pre-primer	1	gtgttgggattacaggtgtgag
TPMT 3C rear primer	2	ttcaaaagcatcaaccttctcaa	5`Biotin
				NUDT15 × 3 pre-primer	3	gggttccttgggaagaactacct
NUDT15 × 3 rear primer	4	atcccaccagatggttcagatctt	5`Biotin
				TPMT 3C sequencing primer	5	gtgtgagccaccgca
NUDT15 × 3 sequencing primer	6	gcttttctggggact
				TPMT 3C to-be-detected sequence	7	ccnagccaattttgagtatttttaaaag
NUDT15 × 3 sequence to be detected	8	gygttgtttaaaagaacaaggctatga
				TPMT 3C-NUDT15 3 allocate instruction	9	gcgtagcattga-agctgtgt

(II) the detection kit of the embodiment comprises the following components:

(III) the detection kit reagent 1 of the embodiment is prepared by the following single-person preparation system:

composition (I)	Volume (ul)
		Amplification buffer	18.8
300mM magnesium acetate	1.2

(IV) the detection kit reagent 2 of the embodiment is configured by the following single-person system:

the concentration of each component of the reagent 2 is as follows: TPMT 3C pre-primer (0.32uM), TPMT 3C post-primer (0.32uM), NUDT15 pre 3-primer (0.32uM), NUDT15 pre 3-primer (0.32uM), dNTPS (0.3mM), strand displacement DNA polymerase (1.2ng/μ L), single-stranded DNA binding protein (3.2ng/μ L), recombinase binding to single-stranded nucleic acid (4.8ng/μ L), trehalose (0.2%);

composition (I)	Volume (ul)
		Recombinase binding single-stranded nucleic acid (100 ng/. mu.L)	1.2
Single-stranded DNA binding protein (100 ng/. mu.L)	0.8
		Strand Displacement DNA polymerase (100 ng/. mu.L)	0.3
dNTPs(25mM)	0.3
		TPMT 3C pre-primer (20. mu.M)	0.4
TPMT 3C rear primer (20. mu.M)	0.4
		NUDT15 × 3 Pre-primer (20 μ M)	0.4
NUDT15 rear primer (20. mu.M)	0.4
		Trehalose (20%)	0.25

After the preparation is finished, 98 ul/tube is subpackaged and freeze-dried.

Example 2 detection of Pyrophosphoric acid

The apparatus used in the present invention is as follows: a thermostat;

pyrophosphoric acid sequencer: wuhan Firstet Biotech, Inc.

(1) Reagent preparation (reagent preparation Chamber)

The reagent was removed in advance and reagent 1 was vortexed for 15 seconds and centrifuged at low speed until use. 440ul of reagent 1 was added directly to reagent 2 (lyophilized) and mixed well by vortexing for 15 seconds. And determining the reaction number N, wherein N is the number of samples to be detected (N), the number of quality control products (1) and a blank control. It is recommended that positive control and blank control analyses be performed simultaneously for each PCR experiment. Then, the reaction solution was dispensed into a PCR reaction tube at a volume of 20. mu.L/tube.

(2) Application of sample detection (sample preparation room)

Adding the sample DNA, the positive control and the blank control into a PCR reaction tube according to the sample adding amount of 5 mu L, covering the tube cover tightly, centrifuging at low speed for 15 seconds to completely throw liquid on the tube wall to the tube bottom, and then immediately carrying out PCR amplification reaction.

(3) PCR amplification (between amplifications)

And (3) amplifying by adopting a PCR instrument, wherein the reaction system is 25 mu L, and the amplification conditions are as follows:

temperature of amplification	Time	Number of cycles
			42℃	15min	1

(4) Pyrophosphoric acid sequencing

1) Adding 40 mu L of binding solution and 3ul of agarose gel particles into a PCR reaction tube, adding 10 mu L of PCR product into the PCR reaction tube, placing the PCR reaction tube on a table type oscillator, and oscillating at 1100rpm for 10min to ensure that the microbeads and the PCR product are fully bound;

2) centrifuging at 7,000 Xg for 1min, and discarding the supernatant;

3) adding 22uL of diluted working solution of the denatured liquid, standing for 5min, centrifuging for 1min at 7,000 Xg, and collecting by an EP tube to obtain a single-chain product;

4) add 150uL of wash buffer to the EP tube and centrifuge at 7,000 Xg for 1min (repeat 3 times);

5) transferring the single-stranded product in the EP tube to a sequencing tube, and adding 3uL sequencing enzyme and 3uL sequencing substrate to each sequencing tube;

6) respectively adding 3uL sequencing enzyme and 3uL sequencing substrate into a sequencing tube;

7) taking an 8-calandria, and sequentially adding dATP, dTTP, dGTP, dCTP, TPMT 3C sequencing primer, NUDT15 3 sequencing primer and ddATP from one round smooth end to the flat end; lightly knocking the bottom of the calandria against the tabletop to enable the bases to be flatly paved at the bottom of the calandria;

8) pyrosequencing; the sequencing results are shown in FIGS. 1 to 3.

(5) Interpretation of results

1) And (3) judging the effectiveness:

the blank control of the kit does not pass, and the detection result of the positive control is TPMT 3C, NUDT15 3 type.

2) Criteria for determination of results

In the DNA sequencing peak plot of TPMT 3C,

the frequency of A is not less than 90 percent, the frequency of G is not less than 10 percent, and the product is AA type;

the frequency of 40% to A is 60% and the frequency of 40% to G is 60%, which is AG type;

the frequency of G is not less than 90 percent, the frequency of A is not less than 10 percent, and the product is GG type;

b. NUDT15 x 3 DNA sequencing peak plot,

the frequency of C is not less than 90 percent, the frequency of T is not less than 10 percent, and the model is CC;

the frequency of 40% to C is less than or equal to 60%, and the frequency of 40% to T is less than or equal to 60%, which is CT type;

the frequency of T is larger than or equal to 90 percent, the frequency of C is smaller than or equal to 10 percent, and the model is TT.

Example 3 correlation of Gene test results with adverse drug reactions

Relationship between Gene site and drug

Finally, it must be said here that: the above embodiments are only used for further detailed description of the technical solutions of the present invention, and should not be understood as limiting the scope of the present invention, and the insubstantial modifications and adaptations made by those skilled in the art according to the above descriptions of the present invention are within the scope of the present invention.

Sequence listing

<110> Firstat (Shanghai) Biotech Co., Ltd

<120> detection kit for purine drug metabolism marker, detection method and application thereof

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> unsure

<222> (1)..(22)

<400> 1

gtgttgggat tacaggtgtg ag 22

<210> 2

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> unsure

<222> (1)..(23)

<400> 2

ttcaaaagca tcaaccttct caa 23

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> unsure

<222> (1)..(23)

<400> 3

gggttccttg ggaagaacta cct 23

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> unsure

<222> (1)..(24)

<400> 4

atcccaccag atggttcaga tctt 24

<210> 5

<211> 15

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> unsure

<222> (1)..(15)

<400> 5

gtgtgagcca ccgca 15

<210> 6

<211> 15

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> unsure

<222> (1)..(15)

<400> 6

gcttttctgg ggact 15

<210> 7

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> unsure

<222> (1)..(28)

<220>

<221> misc_feature

<222> (3)..(3)

<223> n is a, c, g, t or u

<400> 7

ccnagccaat tttgagtatt tttaaaag 28

<210> 8

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> unsure

<222> (1)..(27)

<400> 8

gygttgttta aaagaacaag gctatga 27

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> unsure

<222> (1)..(20)

<400> 9

gcgtagcatt gaagctgtgt 20

Claims

1. A detection kit for purine drug metabolism markers, wherein the purine drug metabolism markers are polymorphisms of two genes TPMT 3C and NUDT15, the kit is used for designing amplification primers and sequencing primers aiming at the polymorphisms of the two genes TPMT 3C and NUDT15, and the kit comprises the following components: TPMT 3C amplification primer, NUDT15 3 amplification primer, TPMT 3C sequencing primer, NUDT15 3 sequencing primer, amplification reagent 1, amplification reagent 2 and positive control.

2. The detection kit for purine drug metabolism markers according to claim 1, wherein the amplification primer set sequence of TPMT 3C is shown in sequence tables SEQ ID NO 1-SEQ ID NO 2; the sequence of the amplification primer group of the NUDT15 x 3 is shown in a sequence table SEQ ID NO. 3-SEQ ID NO. 4.

3. The detection kit for the purine drug metabolism marker according to claim 1, wherein the TPMT 3C sequencing primer and the NUDT15 3 sequencing primer are shown as SEQ ID NO 5-SEQ ID NO 6 of the sequence list respectively.

4. The test kit for purine drug metabolism marker according to claim 1, wherein TPMT 3C and NUDT15 share a dispensing instruction as shown in sequence table SEQ ID No. 9.

5. The test kit for a purine drug metabolism marker according to claim 1, wherein the positive control comprises TPMT 3C, NUDT15 x 3 hybrid genomic DNA at a concentration of 20 ng/ul.

6. The detection kit for purine drug metabolism marker according to claim 1, wherein the reagent 1 comprises amplification buffer, 18mM magnesium acetate.

7. The detection kit for a purine drug metabolism marker according to claim 1, wherein the reagent 2 comprises: TPMT 3C rear primer 0.32uM, NUDT15 front 3 primer 0.32uM, NUDT15 front 3 primer 0.32uM, dNTPS 0.3mM, strand displacement DNA polymerase 1.2 ng/. mu.L, single-stranded DNA binding protein 3.2 ng/. mu.L, single-stranded nucleic acid binding recombinase 4.8 ng/. mu.L, and 0.2% trehalose.

8. The detection kit for purine drug metabolism marker according to claim 1, wherein the magnetic bead is a carboxyl magnetic bead with a particle size of 600 nm.

9. The method for detecting a purine drug metabolism marker kit according to any one of claims 1 to 8, wherein the method comprises the following steps:

a) amplifying the amplification reaction solution and 5ul of genome DNA to be detected by adopting multiple RPA amplification;

b) combining a binding solution containing magnetic beads with the amplification product;

c) treating the denatured liquid to obtain a single-chain product;

d) adding a washing buffer solution for rinsing;

e) adding a sequencing enzyme and a sequencing substrate to each sequencing tube;

f) taking an 8-calandria, and sequentially adding dATP, dTTP, dGTP, dCTP, TPMT 3C sequencing primer, NUDT15 3 sequencing primer and ddATP from one round smooth end to the flat end;

g) pyrosequencing: adding TPMT 3C sequencing primer, adding various dNTPs according to the sequence of GCGTAGCATTG, and adding ddATP to terminate TPMT 3C sequencing reaction; adding NUDT15 × 3 sequencing primer, adding various dNTPs according to the sequence of AGCTGTGT, and carrying out NUDT15 × 3 site sequencing;

h) determining the genotypes of the TPMT 3C site and the NUDT15 3 site purine drug site.

10. The use of the detection kit for purine drug metabolism marker and the detection method thereof according to any one of claims 1 to 9, wherein the detection kit and the detection method detect gene polymorphism of TPMT 3C, NUDT15 so as to guide prediction of purine drug adverse reaction from gene level.